m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00141)

Target Name	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Synonyms	MALAT1; metastasis associated lung adenocarcinoma transcript 1 (non-protein coding); PRO1073; MALAT-1; NCRNA00047; HCN; NEAT2; LINC00047; mascRNA; metastasis associated in lung adenocarcinoma transcript 1; non-protein coding RNA 47; hepcarcin; nuclear enriched abundant transcript 2; nuclear paraspeckle assembly transcript 2 (non-protein coding); long intergenic non-protein coding RNA 47 Click to Show/Hide
Gene Name	MALAT1
Chromosomal Location	11q13.1
Family	Long non-coding RNAs with non-systematic symbols
Gene ID	378938
HGNC ID	HGNC:29665

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MALAT1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	DKO-1 cell line	Homo sapiens
Treatment: METTL3 knockdown DKO-1 cell Control: DKO-1 cell		GSE182382
Regulation		logFC: 8.20E-01 p-value: 5.93E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between MALAT1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.28E+00	GSE60213

In total 9 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 promoted the malignant progression of IDH-wildtype gliomas and revealed important insight into the upstream regulatory mechanism of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and NF-Kappa-B with a primary focus on m6A modification.
Target Regulation	Up regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell proliferation and metastasis
In-vitro Model	H4	Astrocytoma	Homo sapiens	CVCL_1239
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	U87 (A primary glioblastoma cell line)
In-vivo Model	U87 cells (5 × 10⁵) transfected with an empty vector, METTL3 shRNA, or METTL3 overexpression vector were inoculated into the right frontal node of nude mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Target Regulation	Up regulation
Responsed Disease	Thymic epithelial tumors		ICD-11: 2C27.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Target Regulation	Up regulation
Responsed Disease	Thymic epithelial tumors		ICD-11: 2C27.Y	Disease Info
Responsed Drug	JQ-1		Phase 1	Drug Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3 can regulate the expression of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) through m6A, mediate the E2F1/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Silencing METTL3 down-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and HMGA2 by sponging miR-26b, and finally inhibit EMT, migration and invasion in breast cancer, providing a theoretical basis for clinical treatment of breast cancer.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MCF-10A	Normal	Homo sapiens	CVCL_0598
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Silencing METTL3 down-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and HMGA2 by sponging miR-26b, and finally inhibit EMT, migration and invasion in BC, providing a theoretical basis for clinical treatment of BC.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Eighteen BALB/C female nude mice aged 4-5 weeks and weighing 15-18 g were randomly assigned into three groups of six mice. The MCF-7 cell lines stably transfected with sh-NC + oe-NC, sh-METTL3 + oe-NC and sh-METTL3 + oe-HMGA2 were selected for subcutaneous establishment of the BC cell line MCF-7 as xenografts in the nude mice. For this purpose, MCF-7 cell lines in the logarithmic growth stage were prepared into a suspension with a concentration of about 1 × 10⁷ cells/ml. The prepared cell suspension was injected into the left armpit of the mice, and the subsequent tumor growth was recorded.
Experiment 8 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Renal fibrosis is a key factor in chronic kidney disease (CKD). Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)/miR-145/FAK pathway was involved in the effect of dihydroartemisinin (DHA) on TGF-beta1-induced renal fibrosis in vitro and in vivo.
Responsed Disease	Chronic kidney disease		ICD-11: GB61	Disease Info
Responsed Drug	Artenimol		Approved	Drug Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	For the unilateral ureteral obstruction (UUO) model, male C57BL/6J mice at 8 weeks of age (20-22 g body weight) were first anaesthetized with pentobarbital sodium (50 mg/kg) via intraperitoneal injection. Then, the left ureter was ligated using 3-0 silk and a left lateral incision.
Experiment 9 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	m6A modification is co-regulated by METTL3 and FTO in cadmium-treated cells. Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), LncRNA-PVT1 and m6A modification could be key nodes for cadmium-induced oxidative damage, and highlight their importance as promising preventive and therapeutic targets in cadmium toxicity.
Target Regulation	Up regulation
Responsed Disease	Kidney failure		ICD-11: GB6Z	Disease Info
In-vitro Model	NIT-1	Insulin tumor	Mus musculus	CVCL_3561

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: shFTO NB4 cells Control: shNS NB4 cells		GSE103494
Regulation		logFC: 8.67E-01 p-value: 5.83E-03
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[8]
Response Summary	In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and ITGA6 transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression.
Target Regulation	Down regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Notch signaling pathway			hsa04330
Cell Process	Cell proliferation
	Cell invasion
	Cell apoptosis
In-vitro Model	HT-1197	Recurrent bladder carcinoma	Homo sapiens	CVCL_1291
In-vitro Model	HT-1376	Bladder carcinoma	Homo sapiens	CVCL_1292
In-vivo Model	BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 10⁶ HT-1197 cells in control group or FTO plasmid group, respectively.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[9]
Response Summary	FTO facilitates the tumorigenesis of bladder cancer through regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)/miR-384/MAL2 axis in m6A RNA modification manner, which ensures the potential of FTO for serving as a diagnostic or prognostic biomarker in bladder cancer.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	RNA stability
In-vitro Model	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	SCaBER	Bladder squamous cell carcinoma	Homo sapiens	CVCL_3599
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	253J	Bladder carcinoma	Homo sapiens	CVCL_7935
	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
In-vivo Model	Approximately 5 × 10⁶ 253J and 5637 cells infected with indicated vectors were injected subcutaneously into the flank of the mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	m6A modification is co-regulated by METTL3 and FTO in cadmium-treated cells. Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), LncRNA-PVT1 and m6A modification could be key nodes for cadmium-induced oxidative damage, and highlight their importance as promising preventive and therapeutic targets in cadmium toxicity.
Target Regulation	Up regulation
Responsed Disease	Kidney failure		ICD-11: GB6Z	Disease Info
In-vitro Model	NIT-1	Insulin tumor	Mus musculus	CVCL_3561

RNA binding protein X (RBMX) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by RBMX*
Cell Line	HEK293 cell line	Homo sapiens
Treatment: RBMX overexpressed HEK293 cells Control: Wild type HEK293 cells		GSE68990
Regulation		logFC: -6.91E-01 p-value: 3.81E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene		[10]
Response Summary	HNRNPG can bind the m6A-modified hairpin of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1).

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	NOMO-1 cell line	Homo sapiens
Treatment: shALKBH5 NOMO-1 cells Control: shNS NOMO-1 cells		GSE144968
Regulation		logFC: 1.03E+00 p-value: 3.88E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	ALKBH5 could up-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) expression by demethylation. Furthermore, dexmedetomidine inhibited the expression of ALKBH5 in LPS-treated HK-2 cells. Dexmedetomidine suppressed the biological behavior of HK-2 cells treated with LPS by inhibiting the expression of ALKBH5 in vitro, which provides potential targets for the prevention and treatment of sepsis-induced kidney injury. Dexmedetomidine suppressed the biological behavior of HK-2 cells treated with LPS by inhibiting the expression of ALKBH5 in vitro, which provides potential targets for the prevention and treatment of sepsis-induced kidney injury.
Target Regulation	Up regulation
Responsed Disease	Injury of kidney		ICD-11: NB92.0	Disease Info
Cell Process	Cell cycle
	Cell proliferation
	Cell apoptosis
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28

YTH domain-containing protein 1 (YTHDC1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDC1*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shYTHDC1 MOLM13 cells Control: shControl MOLM13 cells		GSE168565
Regulation		logFC: 1.45E+00 p-value: 5.75E-21
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	MALAT1 hijacks both chimeric mRNAs and fusion protein in nuclear speckles during chromosomal translocation and mediates colocalization with METTL14 in an oncogenic fusion protein such as PML-RARalpha. Reducing MALAT1 or m6A methyltransferases and the 'reader' YTHDC1 result in the universal retention of distinct oncogenic gene (PML-RARalpha) mRNAs in nucleus. Targeting the lncRNA-triggered autoregulatory loop to disrupt chimeric mRNA transport represents a new common paradigm for treating blood malignancies.
Target Regulation	Up regulation
Responsed Disease	Blood malignancies		ICD-11: 2B33.Y	Disease Info
Cell Process	Oncogenic fusion protein expression
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
In-vivo Model	The NOD-SCID mice were intravenously (tail vein) implanted with sh-RNA-established NB4 cells. Direct injection of 5 × 10⁶ shRNA-transformed NB4 cells into 150 uL of PBS was performed to establish intravenous (tail vein) leukemia.

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between MALAT1 and the regulator*
Cell Line	HEK293T	Homo sapiens
Regulation	logFC: 1.31E+00	GSE90639

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[13]
Response Summary	IGF2BP2 promotes Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) stability in an m6A-dependent mechanism, thus promoting its downstream target autophagy-related (ATG)12 expression and NSCLC proliferation.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Lysosome			hsa04142
Cell Process	Cell autophagy
In-vitro Model	NCI-H157	Lung squamous cell carcinoma	Homo sapiens	CVCL_0463
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1703	Lung squamous cell carcinoma	Homo sapiens	CVCL_1490
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	Mice (male and 6 weeks old) were subcutaneously injected with NSCLC cells (1.0*10⁶ cells/200 uL). The mice were terminated after 4 weeks of induction, and the tumor volume and tumor weight were measured.

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between MALAT1 and the regulator*
Cell Line	HEK293T	Homo sapiens
Regulation	logFC: 2.96E+00	GSE90639

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[14]
Response Summary	CircRNA hsa_circ_0004287 was upregulated in peripheral blood mononuclear cells of both AD and psoriasis patients. hsa_circ_0004287 reduced the stability of its host gene Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) by competitively binding to IGF2BP3 with MALAT1 in an N6-methyladenosine (m6A)-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Atopic eczema		ICD-11: EA80	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Inflammation
	Proteasome pathway degradation
In-vitro Model	RAW 264.7	Mouse leukemia	Mus musculus	CVCL_0493
In-vivo Model	IMQ-induced psoriatic model was constructed by applying 10 mg per ear 5% IMQ for 8 consecutive days, and 6 ug macrophage-specific control or hsa_circ_0004287 plasmid was topically applied every 2 days (5 mice per group per experiment).

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between MALAT1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.44E+00	GSE63591

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between MALAT1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.66E+00	GSE86214

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	MALAT1 hijacks both chimeric mRNAs and fusion protein in nuclear speckles during chromosomal translocation and mediates colocalization with METTL14 in an oncogenic fusion protein such as PML-RARalpha. Reducing MALAT1 or m6A methyltransferases and the 'reader' YTHDC1 result in the universal retention of distinct oncogenic gene (PML-RARalpha) mRNAs in nucleus. Targeting the lncRNA-triggered autoregulatory loop to disrupt chimeric mRNA transport represents a new common paradigm for treating blood malignancies.
Target Regulation	Up regulation
Responsed Disease	Blood malignancies		ICD-11: 2B33.Y	Disease Info
Cell Process	Oncogenic fusion protein expression
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
In-vivo Model	The NOD-SCID mice were intravenously (tail vein) implanted with sh-RNA-established NB4 cells. Direct injection of 5 × 10⁶ shRNA-transformed NB4 cells into 150 uL of PBS was performed to establish intravenous (tail vein) leukemia.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[16]
Response Summary	METTL14 and lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) were upregulated, and miR-224-5p was downregulated in OSCC tissues and cells. METTL14 induced m6A modification of MALAT1 to upregulate MALAT1.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma		ICD-11: 2B6E.0	Disease Info
In-vitro Model	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	Hs 680.Tg	Normal	Homo sapiens	CVCL_0842
	FaDu	Hypopharyngeal squamous cell carcinoma	Homo sapiens	CVCL_1218
	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
In-vivo Model	Lentiviruses containing sh-METTL-14 and its negative control (RiboBio Co., Ltd., Guangzhou, China) were transduced into CAL27 cells and stably transduced cells were screened using puromycin. CAL27 cells (3 × 10⁶ cells/mouse) were subcutaneously inoculated into the posterior flank of each mouse (N = 12/group).

Methyltransferase-like 16 (METTL16) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene		[17]
Response Summary	LncRNAs are involved in a plethora of cellular signaling pathways and actively regulate gene expression via a broad selection of molecular mechanisms. Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) could serve a role as a regulator of RNA processing or modification events through guiding METTL16 onto its RNA targets.

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 promoted the malignant progression of IDH-wildtype gliomas and revealed important insight into the upstream regulatory mechanism of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and NF-Kappa-B with a primary focus on m6A modification.
Responsed Disease	Glioma [ICD-11: 2A00.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell proliferation and metastasis
In-vitro Model	H4	Astrocytoma	Homo sapiens	CVCL_1239
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	U87 (A primary glioblastoma cell line)
In-vivo Model	U87 cells (5 × 10⁵) transfected with an empty vector, METTL3 shRNA, or METTL3 overexpression vector were inoculated into the right frontal node of nude mice.

Malignant haematopoietic neoplasm [ICD-11: 2B33]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[12]
Response Summary	MALAT1 hijacks both chimeric mRNAs and fusion protein in nuclear speckles during chromosomal translocation and mediates colocalization with METTL14 in an oncogenic fusion protein such as PML-RARalpha. Reducing MALAT1 or m6A methyltransferases and the 'reader' YTHDC1 result in the universal retention of distinct oncogenic gene (PML-RARalpha) mRNAs in nucleus. Targeting the lncRNA-triggered autoregulatory loop to disrupt chimeric mRNA transport represents a new common paradigm for treating blood malignancies.
Responsed Disease	Blood malignancies [ICD-11: 2B33.Y]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Oncogenic fusion protein expression
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
In-vivo Model	The NOD-SCID mice were intravenously (tail vein) implanted with sh-RNA-established NB4 cells. Direct injection of 5 × 10⁶ shRNA-transformed NB4 cells into 150 uL of PBS was performed to establish intravenous (tail vein) leukemia.
Experiment 2 Reporting the m6A-centered Disease Response				[12]
Response Summary	MALAT1 hijacks both chimeric mRNAs and fusion protein in nuclear speckles during chromosomal translocation and mediates colocalization with METTL14 in an oncogenic fusion protein such as PML-RARalpha. Reducing MALAT1 or m6A methyltransferases and the 'reader' YTHDC1 result in the universal retention of distinct oncogenic gene (PML-RARalpha) mRNAs in nucleus. Targeting the lncRNA-triggered autoregulatory loop to disrupt chimeric mRNA transport represents a new common paradigm for treating blood malignancies.
Responsed Disease	Blood malignancies [ICD-11: 2B33.Y]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Oncogenic fusion protein expression
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
In-vivo Model	The NOD-SCID mice were intravenously (tail vein) implanted with sh-RNA-established NB4 cells. Direct injection of 5 × 10⁶ shRNA-transformed NB4 cells into 150 uL of PBS was performed to establish intravenous (tail vein) leukemia.

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[16]
Response Summary	METTL14 and lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) were upregulated, and miR-224-5p was downregulated in OSCC tissues and cells. METTL14 induced m6A modification of MALAT1 to upregulate MALAT1.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	Hs 680.Tg	Normal	Homo sapiens	CVCL_0842
	FaDu	Hypopharyngeal squamous cell carcinoma	Homo sapiens	CVCL_1218
	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
In-vivo Model	Lentiviruses containing sh-METTL-14 and its negative control (RiboBio Co., Ltd., Guangzhou, China) were transduced into CAL27 cells and stably transduced cells were screened using puromycin. CAL27 cells (3 × 10⁶ cells/mouse) were subcutaneously inoculated into the posterior flank of each mouse (N = 12/group).

Lung cancer [ICD-11: 2C25]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[13]
Response Summary	IGF2BP2 promotes Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) stability in an m6A-dependent mechanism, thus promoting its downstream target autophagy-related (ATG)12 expression and NSCLC proliferation.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Lysosome			hsa04142
Cell Process	Cell autophagy
In-vitro Model	NCI-H157	Lung squamous cell carcinoma	Homo sapiens	CVCL_0463
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1703	Lung squamous cell carcinoma	Homo sapiens	CVCL_1490
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	Mice (male and 6 weeks old) were subcutaneously injected with NSCLC cells (1.0*10⁶ cells/200 uL). The mice were terminated after 4 weeks of induction, and the tumor volume and tumor weight were measured.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 3 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 4 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Thymoma [ICD-11: 2C27]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Responsed Disease	Thymic epithelial tumors [ICD-11: 2C27.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Responsed Disease	Thymic epithelial tumors [ICD-11: 2C27.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	JQ-1		Phase 1	Drug Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024

Breast cancer [ICD-11: 2C60]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3 can regulate the expression of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) through m6A, mediate the E2F1/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.
Experiment 2 Reporting the m6A-centered Disease Response				[5]
Response Summary	Silencing METTL3 down-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and HMGA2 by sponging miR-26b, and finally inhibit EMT, migration and invasion in breast cancer, providing a theoretical basis for clinical treatment of breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MCF-10A	Normal	Homo sapiens	CVCL_0598
Experiment 3 Reporting the m6A-centered Disease Response				[5]
Response Summary	Silencing METTL3 down-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and HMGA2 by sponging miR-26b, and finally inhibit EMT, migration and invasion in BC, providing a theoretical basis for clinical treatment of BC.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Eighteen BALB/C female nude mice aged 4-5 weeks and weighing 15-18 g were randomly assigned into three groups of six mice. The MCF-7 cell lines stably transfected with sh-NC + oe-NC, sh-METTL3 + oe-NC and sh-METTL3 + oe-HMGA2 were selected for subcutaneous establishment of the BC cell line MCF-7 as xenografts in the nude mice. For this purpose, MCF-7 cell lines in the logarithmic growth stage were prepared into a suspension with a concentration of about 1 × 10⁷ cells/ml. The prepared cell suspension was injected into the left armpit of the mice, and the subsequent tumor growth was recorded.

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[8]
Response Summary	In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and ITGA6 transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Notch signaling pathway			hsa04330
Cell Process	Cell proliferation
	Cell invasion
	Cell apoptosis
In-vitro Model	HT-1197	Recurrent bladder carcinoma	Homo sapiens	CVCL_1291
In-vitro Model	HT-1376	Bladder carcinoma	Homo sapiens	CVCL_1292
In-vivo Model	BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 10⁶ HT-1197 cells in control group or FTO plasmid group, respectively.
Experiment 2 Reporting the m6A-centered Disease Response				[9]
Response Summary	FTO facilitates the tumorigenesis of bladder cancer through regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)/miR-384/MAL2 axis in m6A RNA modification manner, which ensures the potential of FTO for serving as a diagnostic or prognostic biomarker in bladder cancer.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
In-vitro Model	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	SCaBER	Bladder squamous cell carcinoma	Homo sapiens	CVCL_3599
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	253J	Bladder carcinoma	Homo sapiens	CVCL_7935
	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
In-vivo Model	Approximately 5 × 10⁶ 253J and 5637 cells infected with indicated vectors were injected subcutaneously into the flank of the mice.

Atopic eczema [ICD-11: EA80]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[14]
Response Summary	CircRNA hsa_circ_0004287 was upregulated in peripheral blood mononuclear cells of both AD and psoriasis patients. hsa_circ_0004287 reduced the stability of its host gene Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) by competitively binding to IGF2BP3 with MALAT1 in an N6-methyladenosine (m6A)-dependent manner.
Responsed Disease	Atopic eczema [ICD-11: EA80]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Inflammation
	Proteasome pathway degradation
In-vitro Model	RAW 264.7	Mouse leukemia	Mus musculus	CVCL_0493
In-vivo Model	IMQ-induced psoriatic model was constructed by applying 10 mg per ear 5% IMQ for 8 consecutive days, and 6 ug macrophage-specific control or hsa_circ_0004287 plasmid was topically applied every 2 days (5 mice per group per experiment).

Chronic kidney disease [ICD-11: GB61]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	Renal fibrosis is a key factor in chronic kidney disease (CKD). Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)/miR-145/FAK pathway was involved in the effect of dihydroartemisinin (DHA) on TGF-beta1-induced renal fibrosis in vitro and in vivo.
Responsed Disease	Chronic kidney disease [ICD-11: GB61]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Drug	Artenimol		Approved	Drug Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	For the unilateral ureteral obstruction (UUO) model, male C57BL/6J mice at 8 weeks of age (20-22 g body weight) were first anaesthetized with pentobarbital sodium (50 mg/kg) via intraperitoneal injection. Then, the left ureter was ligated using 3-0 silk and a left lateral incision.

Kidney failure [ICD-11: GB6Z]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	m6A modification is co-regulated by METTL3 and FTO in cadmium-treated cells. Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), LncRNA-PVT1 and m6A modification could be key nodes for cadmium-induced oxidative damage, and highlight their importance as promising preventive and therapeutic targets in cadmium toxicity.
Responsed Disease	Kidney failure [ICD-11: GB6Z]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	NIT-1	Insulin tumor	Mus musculus	CVCL_3561
Experiment 2 Reporting the m6A-centered Disease Response				[7]
Response Summary	m6A modification is co-regulated by METTL3 and FTO in cadmium-treated cells. Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), LncRNA-PVT1 and m6A modification could be key nodes for cadmium-induced oxidative damage, and highlight their importance as promising preventive and therapeutic targets in cadmium toxicity.
Responsed Disease	Kidney failure [ICD-11: GB6Z]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	NIT-1	Insulin tumor	Mus musculus	CVCL_3561

Urinary/pelvic organs injury [ICD-11: NB92]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[11]
Response Summary	ALKBH5 could up-regulate Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) expression by demethylation. Furthermore, dexmedetomidine inhibited the expression of ALKBH5 in LPS-treated HK-2 cells. Dexmedetomidine suppressed the biological behavior of HK-2 cells treated with LPS by inhibiting the expression of ALKBH5 in vitro, which provides potential targets for the prevention and treatment of sepsis-induced kidney injury. Dexmedetomidine suppressed the biological behavior of HK-2 cells treated with LPS by inhibiting the expression of ALKBH5 in vitro, which provides potential targets for the prevention and treatment of sepsis-induced kidney injury.
Responsed Disease	Injury of kidney [ICD-11: NB92.0]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell cycle
	Cell proliferation
	Cell apoptosis
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28

Artenimol [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	Renal fibrosis is a key factor in chronic kidney disease (CKD). Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)/miR-145/FAK pathway was involved in the effect of dihydroartemisinin (DHA) on TGF-beta1-induced renal fibrosis in vitro and in vivo.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Disease	Chronic kidney disease		ICD-11: GB61	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	For the unilateral ureteral obstruction (UUO) model, male C57BL/6J mice at 8 weeks of age (20-22 g body weight) were first anaesthetized with pentobarbital sodium (50 mg/kg) via intraperitoneal injection. Then, the left ureter was ligated using 3-0 silk and a left lateral incision.

Cisplatin [Approved]

Drug Info

In total 4 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 2 Reporting the m6A-centered Drug Response				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Thymic epithelial tumors		ICD-11: 2C27.Y	Disease Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024
Experiment 3 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 4 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)-miR-1914-3p-YAP axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	METTL3 can regulate the expression of Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) through m6A, mediate the E2F1/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

JQ-1 [Phase 1]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	This study highlighted METTL3 as a tumor promoter in Thymic tumors and c-MYC as a promising target to be exploited for the treatment of TET. High expression of c-MYC protein is enabled by lncRNA Metastasis associated lung adenocarcinoma transcript 1 (MALAT1), which is methylated and delocalized by METTL3. Silencing of METTL3 combined with cisplatin or c-MYC inhibitor induces cell death in TET cells. Blocking of c-MYC by using JQ1 inhibitor cooperates with METTL3 depletion in the inhibition of proliferation and induction of cell death.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Thymic epithelial tumors		ICD-11: 2C27.Y	Disease Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell viability and proliferation
In-vitro Model	T1889	Thymic undifferentiated carcinoma	Homo sapiens	CVCL_D024

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00533		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 26a-1 (MIR26A1)
Crosstalk relationship	m6A → A-to-I

m6A Regulator: Methyltransferase-like 16 (METTL16)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00534		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 26a-1 (MIR26A1)
Crosstalk relationship	m6A → A-to-I

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00535		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 26a-1 (MIR26A1)
Crosstalk relationship	m6A → A-to-I

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00536		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 26a-1 (MIR26A1)
Crosstalk relationship	m6A → A-to-I

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02047		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Secreted frizzled-related protein 2 (SFRP2)
Crosstalk relationship	m6A → DNA modification
Drug	Simvastatin	Drug Info
Crosstalk ID: M6ACROT02048		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Secreted frizzled-related protein 2 (SFRP2)
Crosstalk relationship	m6A → DNA modification
Drug	Simvastatin	Drug Info
Crosstalk ID: M6ACROT02049		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Secreted frizzled-related protein 2 (SFRP2)
Crosstalk relationship	m6A → DNA modification
Drug	Simvastatin	Drug Info

Histone modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03116		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 2A (KDM2A)
Crosstalk relationship	m6A → Histone modification
Disease	Oral squamous cell carcinoma	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03316		Crosstalk Info
Epigenetic Regulator	Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target	Histone H3 lysine 9 monomethylation (H3K9me1)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05275		Crosstalk Info
Epigenetic Regulator	hsa_circ_0004287 (Circ_MALAT1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship	ncRNA → m6A
Disease	Atopic eczema	Disease Info
Crosstalk ID: M6ACROT05638		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Protein S100-A8 (S100A8)
Crosstalk relationship	m6A → ncRNA
Disease	Atopic eczema	Disease Info
Crosstalk ID: M6ACROT06028		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Protein S100-A9 (S100A9)
Crosstalk relationship	m6A → ncRNA
Disease	Atopic eczema	Disease Info

m6A Regulator: Methyltransferase-like 16 (METTL16)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05374		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Crosstalk ID: M6ACROT05794		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05403		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Transcriptional coactivator YAP1 (YAP1)
Crosstalk relationship	m6A → ncRNA
Disease	Breast cancer	Disease Info
Drug	Tamoxifen	Drug Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 14 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05404		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Transcriptional coactivator YAP1 (YAP1)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT05424		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	MicroRNA 145 (MIR145)
Crosstalk relationship	m6A → ncRNA
Disease	Chronic kidney disease	Disease Info
Drug	Dihydroartemisinin	Drug Info
Crosstalk ID: M6ACROT05479		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Kidney failure	Disease Info
Crosstalk ID: M6ACROT05492		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Transcription factor p65 (RELA)
Crosstalk relationship	m6A → ncRNA
Disease	Brain cancer	Disease Info
Crosstalk ID: M6ACROT05510		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	hsa-miR-26b
Crosstalk relationship	m6A → ncRNA
Disease	Breast cancer	Disease Info
Crosstalk ID: M6ACROT05515		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Myc proto-oncogene protein (MYC)
Crosstalk relationship	m6A → ncRNA
Disease	Thymic epithelial tumors	Disease Info
Drug	JQ1	Drug Info
Crosstalk ID: M6ACROT05516		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Myc proto-oncogene protein (MYC)
Crosstalk relationship	m6A → ncRNA
Disease	Thymic epithelial tumors	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT05608		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	hsa-miR-26b
Crosstalk relationship	m6A → ncRNA
Disease	Breast cancer	Disease Info
Crosstalk ID: M6ACROT05613		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Transcription factor E2F1 (E2F1)
Crosstalk relationship	m6A → ncRNA
Disease	Breast cancer	Disease Info
Drug	Adriamycin	Drug Info
Crosstalk ID: M6ACROT05644		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Osteosarcoma	Disease Info
Crosstalk ID: M6ACROT05694		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	hsa-miR-124-3p
Crosstalk relationship	m6A → ncRNA
Disease	Ewing's sarcoma	Disease Info
Crosstalk ID: M6ACROT05728		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05822		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Osteosarcoma	Disease Info
Crosstalk ID: M6ACROT05930		Crosstalk Info
Epigenetic Regulator	MicroRNA 145 (MIR145)
Regulated Target	Focal adhesion kinase 1 (FAK)
Crosstalk relationship	m6A → ncRNA
Disease	Chronic kidney disease	Disease Info
Drug	Dihydroartemisinin	Drug Info

m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05405		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Transcriptional coactivator YAP1 (YAP1)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info
Drug	Cisplatin	Drug Info

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05477		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Kidney failure	Disease Info
Crosstalk ID: M6ACROT05514		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Bladder cancer	Disease Info
Crosstalk ID: M6ACROT05567		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	MicroRNA 384 (MIR384)
Crosstalk relationship	m6A → ncRNA
Disease	Bladder cancer	Disease Info

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05552		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA
Disease	Injury of kidney	Disease Info
Drug	Dexmedetomidine*	Drug Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05624		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	hsa-miR-224-5p
Crosstalk relationship	m6A → ncRNA
Disease	Oral squamous cell carcinoma	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05631		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	Ubiquitin-like protein ATG12 (ATG12)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info

m6A Regulator: Dihydropyrimidinase-related protein 2 (DPYSL2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05652		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA

m6A Regulator: Cytoplasmic FMR1-interacting protein 2 (CYFIP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05653		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Crosstalk relationship	m6A → ncRNA

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00141)

Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)

N4-acetylcytidine (ac4C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000158		Click to Show/Hide the Full List
mod site	chr11:65502077-65502078:+
Sequence	GGGGGAAGTTAAATATGAGCCACTGGGTGTACCAGTGCATT
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000508832.2; ENST00000616527.4; ENST00000619449.2
External Link	RMBase: ac4C_site_311
mod ID: AC4SITE000159		Click to Show/Hide the Full List
mod site	chr11:65503546-65503547:+
Sequence	GTTAGAATCAGATGTTACTGCTAAAATTTACATGTTGTGAT
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000508832.2; ENST00000616527.4; ENST00000618925.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: ac4C_site_312
mod ID: AC4SITE000160		Click to Show/Hide the Full List
mod site	chr11:65505165-65505166:+
Sequence	GGGGTGAGGTGGGCGCTAAGCCTTTTTTTAAGATTTTTCAG
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000618227.1; ENST00000619449.2; ENST00000534336.1; ENST00000610851.1
External Link	RMBase: ac4C_site_313

Adenosine-to-Inosine editing (A-to-I)

In total 32 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004917		Click to Show/Hide the Full List
mod site	chr11:65500886-65500887:+		[23]
Sequence	AAAGGGATTTATATGGGGACGTAGGCCGATTTCCGGGTGTT
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22723
mod ID: A2ISITE004918		Click to Show/Hide the Full List
mod site	chr11:65501190-65501191:+		[23]
Sequence	TTTTGTAAATGTAGAGTTTGGATGTGTAACTGAGGCGGGGG
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22724
mod ID: A2ISITE004919		Click to Show/Hide the Full List
mod site	chr11:65501357-65501358:+		[23]
Sequence	TATCAGGATAATCAGACCACCACAGGTTTACAGTTTATAGA
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22725
mod ID: A2ISITE004920		Click to Show/Hide the Full List
mod site	chr11:65501391-65501392:+		[23]
Sequence	TTATAGAAACTAGAGCAGTTCTCACGTTGAGGTCTGTGGAA
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: RNA-editing_site_22726
mod ID: A2ISITE004921		Click to Show/Hide the Full List
mod site	chr11:65501628-65501629:+		[23]
Sequence	GACAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTG
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: RNA-editing_site_22727
mod ID: A2ISITE004922		Click to Show/Hide the Full List
mod site	chr11:65501630-65501631:+		[23]
Sequence	CAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTGGC
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: RNA-editing_site_22728
mod ID: A2ISITE004923		Click to Show/Hide the Full List
mod site	chr11:65501844-65501845:+		[23]
Sequence	TAAAAGTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTA
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22729
mod ID: A2ISITE004924		Click to Show/Hide the Full List
mod site	chr11:65501849-65501850:+		[23]
Sequence	GTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTAGTTGG
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000508832.2
External Link	RMBase: RNA-editing_site_22730
mod ID: A2ISITE004925		Click to Show/Hide the Full List
mod site	chr11:65502195-65502196:+		[23]
Sequence	GTATTGAACTGGGGGTTGGTCTGGCCTACTGGGCTGACATT
Transcript ID List	ENST00000619449.2; ENST00000616527.4; ENST00000534336.1; ENST00000508832.2
External Link	RMBase: RNA-editing_site_22731
mod ID: A2ISITE004926		Click to Show/Hide the Full List
mod site	chr11:65502630-65502631:+		[23]
Sequence	AGGGGAAACTTTTTTTTTTTCTATAGACTTTTTTCAGATAA
Transcript ID List	ENST00000619449.2; ENST00000508832.2; ENST00000616527.4; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22732
mod ID: A2ISITE004927		Click to Show/Hide the Full List
mod site	chr11:65502675-65502676:+		[23]
Sequence	TTCTGAGTCATAACCAGCCTGGCAGTATGATGGCCTAGATG
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000616527.4; ENST00000508832.2
External Link	RMBase: RNA-editing_site_22733
mod ID: A2ISITE004928		Click to Show/Hide the Full List
mod site	chr11:65503000-65503001:+		[23]
Sequence	GAATAAAAGCGAAAAGAAATGAAAATGTTACACTACATTAA
Transcript ID List	ENST00000618249.1; ENST00000508832.2; ENST00000616527.4; ENST00000534336.1; ENST00000619449.2; ENST00000618925.1
External Link	RMBase: RNA-editing_site_22734
mod ID: A2ISITE004929		Click to Show/Hide the Full List
mod site	chr11:65503764-65503765:+		[23]
Sequence	CACTCTTTAATGGACCAGATCAGGATTTGAGCGGAAGAACG
Transcript ID List	ENST00000620465.4; ENST00000534336.1; ENST00000612781.1; ENST00000619449.2; ENST00000616527.4
External Link	RMBase: RNA-editing_site_22735
mod ID: A2ISITE004930		Click to Show/Hide the Full List
mod site	chr11:65503784-65503785:+		[23]
Sequence	CAGGATTTGAGCGGAAGAACGAATGTAACTTTAAGGCAGGA
Transcript ID List	ENST00000620465.4; ENST00000616527.4; ENST00000534336.1; ENST00000619449.2; ENST00000612781.1
External Link	RMBase: RNA-editing_site_22736
mod ID: A2ISITE004931		Click to Show/Hide the Full List
mod site	chr11:65503909-65503910:+		[23]
Sequence	ATAACCTCTTAGACAGGTGGGAGATTATGATCAGAGTAAAA
Transcript ID List	ENST00000620465.4; ENST00000616527.4; ENST00000534336.1; ENST00000619449.2; ENST00000612781.1
External Link	RMBase: RNA-editing_site_22737
mod ID: A2ISITE004932		Click to Show/Hide the Full List
mod site	chr11:65504091-65504092:+		[23]
Sequence	TTGACCTTATATAGGGAAGGGAGGGGGTGCCTGTGGGGTTT
Transcript ID List	ENST00000620465.4; ENST00000619449.2; ENST00000616527.4; ENST00000534336.1; ENST00000618132.1; ENST00000612781.1
External Link	RMBase: RNA-editing_site_22738
mod ID: A2ISITE004933		Click to Show/Hide the Full List
mod site	chr11:65504094-65504095:+		[23]
Sequence	ACCTTATATAGGGAAGGGAGGGGGTGCCTGTGGGGTTTTAA
Transcript ID List	ENST00000618132.1; ENST00000616527.4; ENST00000620465.4; ENST00000534336.1; ENST00000612781.1; ENST00000619449.2
External Link	RMBase: RNA-editing_site_22739
mod ID: A2ISITE004934		Click to Show/Hide the Full List
mod site	chr11:65504798-65504799:+		[23]
Sequence	GTTTCTCTCTCCCCTCCCTTGGTCTTAATTCTTACATGCAG
Transcript ID List	ENST00000534336.1; ENST00000618132.1; ENST00000619449.2; ENST00000613376.1; ENST00000610851.1
External Link	RMBase: RNA-editing_site_22740
mod ID: A2ISITE004935		Click to Show/Hide the Full List
mod site	chr11:65504822-65504823:+		[23]
Sequence	TTAATTCTTACATGCAGGAACACTCAGCAGACACACGTATG
Transcript ID List	ENST00000534336.1; ENST00000610851.1; ENST00000618132.1; ENST00000619449.2; ENST00000613376.1
External Link	RMBase: RNA-editing_site_22741
mod ID: A2ISITE004936		Click to Show/Hide the Full List
mod site	chr11:65504825-65504826:+		[23]
Sequence	ATTCTTACATGCAGGAACACTCAGCAGACACACGTATGCGA
Transcript ID List	ENST00000610851.1; ENST00000618132.1; ENST00000613376.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22742
mod ID: A2ISITE004937		Click to Show/Hide the Full List
mod site	chr11:65504853-65504854:+		[23]
Sequence	CACACGTATGCGAAGGGCCAGAGAAGCCAGACCCAGTAAGA
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000618227.1; ENST00000610851.1
External Link	RMBase: RNA-editing_site_22743
mod ID: A2ISITE004938		Click to Show/Hide the Full List
mod site	chr11:65504868-65504869:+		[23]
Sequence	GGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCCTATTT
Transcript ID List	ENST00000610851.1; ENST00000534336.1; ENST00000619449.2; ENST00000618227.1
External Link	RMBase: RNA-editing_site_22744
mod ID: A2ISITE004939		Click to Show/Hide the Full List
mod site	chr11:65505117-65505118:+		[23]
Sequence	TGCTGGAGTAACTGGCATGTGAGCAAACTGTGTTGGCGTGG
Transcript ID List	ENST00000610851.1; ENST00000534336.1; ENST00000618227.1; ENST00000619449.2
External Link	RMBase: RNA-editing_site_22745
mod ID: A2ISITE004940		Click to Show/Hide the Full List
mod site	chr11:65505387-65505388:+		[23]
Sequence	TGCTTGAAGTACCCCTGGGCTTCTCTTAACATTTAAGCAAG
Transcript ID List	ENST00000616691.1; ENST00000610851.1; ENST00000619449.2; ENST00000617489.1; ENST00000618227.1; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22746
mod ID: A2ISITE004941		Click to Show/Hide the Full List
mod site	chr11:65505561-65505562:+		[23]
Sequence	AGCAACTTCTCTGCCACATCGCCACCCCGTGCCTTTTGATC
Transcript ID List	ENST00000616691.1; ENST00000619449.2; ENST00000610851.1; ENST00000618227.1; ENST00000534336.1; ENST00000617489.1
External Link	RMBase: RNA-editing_site_22747
mod ID: A2ISITE004942		Click to Show/Hide the Full List
mod site	chr11:65505565-65505566:+		[23]
Sequence	ACTTCTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGC
Transcript ID List	ENST00000616691.1; ENST00000619449.2; ENST00000610851.1; ENST00000618227.1; ENST00000534336.1; ENST00000617489.1
External Link	RMBase: RNA-editing_site_22748
mod ID: A2ISITE004943		Click to Show/Hide the Full List
mod site	chr11:65505566-65505567:+		[23]
Sequence	CTTCTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGCA
Transcript ID List	ENST00000610851.1; ENST00000617489.1; ENST00000534336.1; ENST00000616691.1; ENST00000619449.2; ENST00000618227.1
External Link	RMBase: RNA-editing_site_22749
mod ID: A2ISITE004944		Click to Show/Hide the Full List
mod site	chr11:65505567-65505568:+		[23]
Sequence	TTCTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGCAC
Transcript ID List	ENST00000616691.1; ENST00000619449.2; ENST00000618227.1; ENST00000610851.1; ENST00000534336.1; ENST00000617489.1
External Link	RMBase: RNA-editing_site_22750
mod ID: A2ISITE004945		Click to Show/Hide the Full List
mod site	chr11:65505569-65505570:+		[23]
Sequence	CTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGCACAG
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000616691.1; ENST00000618227.1; ENST00000610851.1; ENST00000617489.1
External Link	RMBase: RNA-editing_site_22751
mod ID: A2ISITE004946		Click to Show/Hide the Full List
mod site	chr11:65505596-65505597:+		[23]
Sequence	TTGATCTAGCACAGACCCTTCACCCCTCACCTCGATGCAGC
Transcript ID List	ENST00000610851.1; ENST00000617489.1; ENST00000618227.1; ENST00000619449.2; ENST00000616691.1; ENST00000534336.1
External Link	RMBase: RNA-editing_site_22752
mod ID: A2ISITE004947		Click to Show/Hide the Full List
mod site	chr11:65505856-65505857:+		[23]
Sequence	GAACTGTAATGCTGGGTGGGAACATGTAACTTGTAGACTGG
Transcript ID List	ENST00000534336.1; ENST00000610851.1; ENST00000619449.2; ENST00000617489.1; ENST00000616691.1; ENST00000618227.1
External Link	RMBase: RNA-editing_site_22753
mod ID: A2ISITE004948		Click to Show/Hide the Full List
mod site	chr11:65506158-65506159:+		[24]
Sequence	GGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGTCTTTGCT
Transcript ID List	ENST00000619449.2; ENST00000611300.1; ENST00000618227.1; ENST00000617489.1; ENST00000610851.1; ENST00000534336.1; ENST00000616691.1
External Link	RMBase: RNA-editing_site_22754

2'-O-Methylation (2'-O-Me)

In total 18 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000005		Click to Show/Hide the Full List
mod site	chr11:65499674-65499675:+		[25]
Sequence	GAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGGCGAAGA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	rmsk_3569609; ENST00000620902.1; ENST00000544868.2; ENST00000617791.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: Nm_site_1004
mod ID: 2OMSITE000007		Click to Show/Hide the Full List
mod site	chr11:65500431-65500432:+		[25]
Sequence	GTGGATTCAGTGAATCTAGGAAGACAGCAGCAGACAGGATT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000544868.2; ENST00000534336.1; ENST00000619449.2; ENST00000610481.1
External Link	RMBase: Nm_site_1006
mod ID: 2OMSITE000008		Click to Show/Hide the Full List
mod site	chr11:65501295-65501296:+		[25]
Sequence	AGGTCTGTCTAGAATCCTAAAGGCAAATGACTCAAGGTGTA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: Nm_site_1007
mod ID: 2OMSITE000014		Click to Show/Hide the Full List
mod site	chr11:65503531-65503532:+		[25]
Sequence	ATAGCATGATGTGCTGTTAGAATCAGATGTTACTGCTAAAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000508832.2; ENST00000616527.4; ENST00000619449.2; ENST00000534336.1; ENST00000618925.1
External Link	RMBase: Nm_site_1013
mod ID: 2OMSITE000004		Click to Show/Hide the Full List
mod site	chr11:65499673-65499674:+		[25]
Sequence	TGAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGGCGAAG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000617791.1; ENST00000534336.1; rmsk_3569609; ENST00000620902.1
External Link	RMBase: Nm_site_1003
mod ID: 2OMSITE000021		Click to Show/Hide the Full List
mod site	chr11:65506000-65506001:+		[25]
Sequence	ATCTTAGCGGAAGCTGATCTCCAATGCTCTTCAGTAGGGTC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000618227.1; ENST00000534336.1; ENST00000610851.1; ENST00000619449.2; ENST00000617489.1; ENST00000616691.1
External Link	RMBase: Nm_site_1020
mod ID: 2OMSITE000006		Click to Show/Hide the Full List
mod site	chr11:65499679-65499680:+		[25]
Sequence	GGAAAACTGGAAGACAGAAGTACGGGAAGGCGAAGAAAAGA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	rmsk_3569609; ENST00000534336.1; ENST00000617791.1; ENST00000619449.2; ENST00000544868.2; ENST00000620902.1
External Link	RMBase: Nm_site_1005
mod ID: 2OMSITE000009		Click to Show/Hide the Full List
mod site	chr11:65501306-65501307:+		[25]
Sequence	GAATCCTAAAGGCAAATGACTCAAGGTGTAACAGAAAACAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: Nm_site_1008
mod ID: 2OMSITE000010		Click to Show/Hide the Full List
mod site	chr11:65502273-65502274:+		[25]
Sequence	TGGTAGTGTGTGGTTCTCTTTTGGAATTTTTTTCAGGTGAT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534336.1; ENST00000616527.4; ENST00000508832.2; ENST00000619449.2
External Link	RMBase: Nm_site_1009
mod ID: 2OMSITE000011		Click to Show/Hide the Full List
mod site	chr11:65503262-65503263:+		[25]
Sequence	TTTAAGAGCTGTGGAGTTCTTAAATATCAACCATGGCACTT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534336.1; ENST00000616527.4; ENST00000618925.1; ENST00000619449.2; ENST00000508832.2
External Link	RMBase: Nm_site_1010
mod ID: 2OMSITE000012		Click to Show/Hide the Full List
mod site	chr11:65503324-65503325:+		[25]
Sequence	GGATTTCAGGATTGAGAAATTTTTCCATCGAGCCTTTTTAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000508832.2; ENST00000616527.4; ENST00000619449.2; ENST00000618925.1; ENST00000534336.1
External Link	RMBase: Nm_site_1011
mod ID: 2OMSITE000013		Click to Show/Hide the Full List
mod site	chr11:65503326-65503327:+		[25]
Sequence	ATTTCAGGATTGAGAAATTTTTCCATCGAGCCTTTTTAAAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000619449.2; ENST00000508832.2; ENST00000618925.1; ENST00000616527.4; ENST00000534336.1
External Link	RMBase: Nm_site_1012
mod ID: 2OMSITE000015		Click to Show/Hide the Full List
mod site	chr11:65504172-65504173:+		[25]
Sequence	AGCCATTCAGGATTTTGAATTGCATATGAGTGCTTGGCTCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000616527.4; ENST00000620465.4; ENST00000618132.1; ENST00000534336.1; ENST00000612781.1; ENST00000619449.2
External Link	RMBase: Nm_site_1014
mod ID: 2OMSITE000016		Click to Show/Hide the Full List
mod site	chr11:65504201-65504202:+		[25]
Sequence	GTGCTTGGCTCTTCCTTCTGTTCTAGTGAGTGTATGAGACC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000620465.4; ENST00000616527.4; ENST00000534336.1; ENST00000619449.2; ENST00000612781.1; ENST00000618132.1
External Link	RMBase: Nm_site_1015
mod ID: 2OMSITE000017		Click to Show/Hide the Full List
mod site	chr11:65504202-65504203:+		[25]
Sequence	TGCTTGGCTCTTCCTTCTGTTCTAGTGAGTGTATGAGACCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000619449.2; ENST00000618132.1; ENST00000534336.1; ENST00000616527.4; ENST00000620465.4; ENST00000612781.1
External Link	RMBase: Nm_site_1016
mod ID: 2OMSITE000018		Click to Show/Hide the Full List
mod site	chr11:65504520-65504521:+		[25]
Sequence	TGAGTGATAAAGGCTGAGTGTTGAGGAAATTTCTGCAGTTT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000619449.2; ENST00000613376.1; ENST00000610851.1; ENST00000618132.1; ENST00000534336.1; ENST00000612781.1
External Link	RMBase: Nm_site_1017
mod ID: 2OMSITE000019		Click to Show/Hide the Full List
mod site	chr11:65504644-65504645:+		[25]
Sequence	TGGGAGGGGACTGAAGCCTTTAGTCTTTTCCAGATGCAACC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534336.1; ENST00000612781.1; ENST00000610851.1; ENST00000618132.1; ENST00000619449.2; ENST00000613376.1
External Link	RMBase: Nm_site_1018
mod ID: 2OMSITE000020		Click to Show/Hide the Full List
mod site	chr11:65505999-65506000:+		[25]
Sequence	CATCTTAGCGGAAGCTGATCTCCAATGCTCTTCAGTAGGGT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000618227.1; ENST00000610851.1; ENST00000616691.1; ENST00000617489.1; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: Nm_site_1019

N1-methyladenosine (m1A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000020		Click to Show/Hide the Full List
mod site	chr11:65506158-65506159:+		[26]
Sequence	GGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGTCTTTGCT
Cell/Tissue List	HEK293T
Seq Type List	m1A-seq
Transcript ID List	ENST00000610851.1; ENST00000617489.1; ENST00000611300.1; ENST00000619449.2; ENST00000616691.1; ENST00000618227.1; ENST00000534336.1
External Link	RMBase: m1A_site_202

N6-methyladenosine (m6A)

In total 134 m6A sequence/site(s) in this target gene
mod ID: M6ASITE006913		Click to Show/Hide the Full List
mod site	chr11:65497755-65497756:+		[27]
Sequence	TCCGCAGCCTGCAGCCCGAGACTTCTGTAAAGGACTGGGGC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2
External Link	RMBase: m6A_site_147942
mod ID: M6ASITE006914		Click to Show/Hide the Full List
mod site	chr11:65497768-65497769:+		[27]
Sequence	GCCCGAGACTTCTGTAAAGGACTGGGGCCCCGCAACTGGCC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147943
mod ID: M6ASITE006915		Click to Show/Hide the Full List
mod site	chr11:65498483-65498484:+		[28]
Sequence	TTCTAAGATTTCCCAAGCAGACAGCCCGTGCTGCTCCGATT
Motif Score	2.897386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147944
mod ID: M6ASITE006916		Click to Show/Hide the Full List
mod site	chr11:65498510-65498511:+		[28]
Sequence	GTGCTGCTCCGATTTCTCGAACAAAAAAGCAAAACGTGTGG
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147945
mod ID: M6ASITE006917		Click to Show/Hide the Full List
mod site	chr11:65498918-65498919:+		[27]
Sequence	GAAAAATCTAGAAAAGTAAAACTAGAACCTATTTTTAACCG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147946
mod ID: M6ASITE006918		Click to Show/Hide the Full List
mod site	chr11:65498924-65498925:+		[27]
Sequence	TCTAGAAAAGTAAAACTAGAACCTATTTTTAACCGAAGAAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147947
mod ID: M6ASITE006919		Click to Show/Hide the Full List
mod site	chr11:65498943-65498944:+		[29]
Sequence	AACCTATTTTTAACCGAAGAACTACTTTTTGCCTCCCTCAC
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147948
mod ID: M6ASITE006920		Click to Show/Hide the Full List
mod site	chr11:65499103-65499104:+		[27]
Sequence	GGCAGGCGGAGCTTGAGGAAACCGCAGATAAGTTTTTTTCT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; LCLs; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000620902.1; ENST00000619449.2; ENST00000617791.1; ENST00000544868.2
External Link	RMBase: m6A_site_147949
mod ID: M6ASITE006921		Click to Show/Hide the Full List
mod site	chr11:65499151-65499152:+		[30]
Sequence	AGATAGAGATTAATACAACTACTTAAAAAATATAGTCAATA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000620902.1; ENST00000617791.1; ENST00000544868.2
External Link	RMBase: m6A_site_147950
mod ID: M6ASITE006922		Click to Show/Hide the Full List
mod site	chr11:65499248-65499249:+		[27]
Sequence	TTTTAAGAGAAAATATGAAGACTTAGAAGAGTAGCATGAGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; hNPCs; hESCs; fibroblasts; LCLs; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000544868.2; ENST00000617791.1; ENST00000619449.2; ENST00000620902.1
External Link	RMBase: m6A_site_147951
mod ID: M6ASITE006923		Click to Show/Hide the Full List
mod site	chr11:65499294-65499295:+		[27]
Sequence	AAAGATAAAAGGTTTCTAAAACATGACGGAGGTTGAGATGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; hNPCs; hESCs; fibroblasts; LCLs; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000617791.1; ENST00000619449.2; ENST00000544868.2; ENST00000534336.1; ENST00000620902.1
External Link	RMBase: m6A_site_147952
mod ID: M6ASITE006924		Click to Show/Hide the Full List
mod site	chr11:65499299-65499300:+		[30]
Sequence	TAAAAGGTTTCTAAAACATGACGGAGGTTGAGATGAAGCTT
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000534336.1; ENST00000620902.1; ENST00000544868.2; ENST00000619449.2; ENST00000617791.1
External Link	RMBase: m6A_site_147953
mod ID: M6ASITE006925		Click to Show/Hide the Full List
mod site	chr11:65499365-65499366:+		[27]
Sequence	AAAGAAAATTGAGAGAAAGGACTACAGAGCCCCGAATTAAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; Huh7; iSLK; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000620902.1; ENST00000617791.1; ENST00000534336.1; ENST00000544868.2
External Link	RMBase: m6A_site_147954
mod ID: M6ASITE006926		Click to Show/Hide the Full List
mod site	chr11:65499432-65499433:+		[27]
Sequence	TTAAAATGAAGGTGACTTAAACAGCTTAAAGTTTAGTTTAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000544868.2; ENST00000617791.1; ENST00000620902.1
External Link	RMBase: m6A_site_147955
mod ID: M6ASITE006927		Click to Show/Hide the Full List
mod site	chr11:65499505-65499506:+		[27]
Sequence	ATCTTTTAAAAAGAGATTAAACCGAAGGTGATTAAAAGACC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620902.1; ENST00000544868.2; ENST00000617791.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147956
mod ID: M6ASITE006928		Click to Show/Hide the Full List
mod site	chr11:65499523-65499524:+		[27]
Sequence	AAACCGAAGGTGATTAAAAGACCTTGAAATCCATGACGCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; iSLK; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000617791.1; ENST00000619449.2; ENST00000544868.2; ENST00000620902.1; ENST00000534336.1
External Link	RMBase: m6A_site_147957
mod ID: M6ASITE006929		Click to Show/Hide the Full List
mod site	chr11:65499586-65499587:+		[30]
Sequence	CTAGTTAACGCATTTACTAAACGCAGACGAAAATGGAAAGA
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000620902.1; ENST00000534336.1; ENST00000544868.2; ENST00000619449.2; ENST00000617791.1
External Link	RMBase: m6A_site_147958
mod ID: M6ASITE006930		Click to Show/Hide the Full List
mod site	chr11:65499630-65499631:+		[27]
Sequence	ATTGGGAGTGGTAGGATGAAACAATTTGGAGAAGATAGAAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000617791.1; ENST00000620902.1; ENST00000619449.2; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: m6A_site_147959
mod ID: M6ASITE006931		Click to Show/Hide the Full List
mod site	chr11:65499664-65499665:+		[27]
Sequence	ATAGAAGTTTGAAGTGGAAAACTGGAAGACAGAAGTACGGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	rmsk_3569609; ENST00000617791.1; ENST00000534336.1; ENST00000620902.1; ENST00000544868.2; ENST00000619449.2
External Link	RMBase: m6A_site_147960
mod ID: M6ASITE006932		Click to Show/Hide the Full List
mod site	chr11:65499672-65499673:+		[27]
Sequence	TTGAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGGCGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; H1299; Huh7; iSLK; TIME; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	rmsk_3569609; ENST00000617791.1; ENST00000534336.1; ENST00000619449.2; ENST00000544868.2; ENST00000620902.1
External Link	RMBase: m6A_site_147961
mod ID: M6ASITE006933		Click to Show/Hide the Full List
mod site	chr11:65499731-65499732:+		[27]
Sequence	AGGGAAATTAGAAGATAAAAACATACTTTTAGAAGAAAAAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	rmsk_3569609; ENST00000534336.1; ENST00000619449.2; ENST00000617791.1; ENST00000544868.2
External Link	RMBase: m6A_site_147962
mod ID: M6ASITE006934		Click to Show/Hide the Full List
mod site	chr11:65499763-65499764:+		[27]
Sequence	AAGAAAAAAGATAAATTTAAACCTGAAAAGTAGGAAGCAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544868.2; ENST00000534336.1; rmsk_3569609; ENST00000619449.2; ENST00000617791.1
External Link	RMBase: m6A_site_147963
mod ID: M6ASITE006935		Click to Show/Hide the Full List
mod site	chr11:65499793-65499794:+		[27]
Sequence	TAGGAAGCAGAAGAAAAAAGACAAGCTAGGAAACAAAAAGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544868.2; rmsk_3569609; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147964
mod ID: M6ASITE006936		Click to Show/Hide the Full List
mod site	chr11:65499805-65499806:+		[27]
Sequence	GAAAAAAGACAAGCTAGGAAACAAAAAGCTAAGGGCAAAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000534336.1; rmsk_3569609; ENST00000619449.2
External Link	RMBase: m6A_site_147965
mod ID: M6ASITE006937		Click to Show/Hide the Full List
mod site	chr11:65499832-65499833:+		[27]
Sequence	GCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000534336.1; rmsk_3569609
External Link	RMBase: m6A_site_147966
mod ID: M6ASITE006938		Click to Show/Hide the Full List
mod site	chr11:65499858-65499859:+		[27]
Sequence	AAGAAAATTGGAAGATAGAAACAAGATAGAAAATGAAAATA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544868.2; ENST00000534336.1; rmsk_3569609; ENST00000619449.2
External Link	RMBase: m6A_site_147967
mod ID: M6ASITE006939		Click to Show/Hide the Full List
mod site	chr11:65499909-65499910:+		[27]
Sequence	TTTCAGATAGAAAATGAAAAACAAGCTAAGACAAGTATTGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; iSLK; TIME; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000544868.2; rmsk_3569609
External Link	RMBase: m6A_site_147968
mod ID: M6ASITE006940		Click to Show/Hide the Full List
mod site	chr11:65499919-65499920:+		[27]
Sequence	AAAATGAAAAACAAGCTAAGACAAGTATTGGAGAAGTATAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3569609; ENST00000544868.2; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147969
mod ID: M6ASITE006941		Click to Show/Hide the Full List
mod site	chr11:65500096-65500097:+		[27]
Sequence	AGATGAGGGTGTTTACGTAGACCAGAACCAATTTAGAAGAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147970
mod ID: M6ASITE006942		Click to Show/Hide the Full List
mod site	chr11:65500102-65500103:+		[27]
Sequence	GGGTGTTTACGTAGACCAGAACCAATTTAGAAGAATACTTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HEK293T; BGC823; HepG2; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: m6A_site_147971
mod ID: M6ASITE006943		Click to Show/Hide the Full List
mod site	chr11:65500174-65500175:+		[27]
Sequence	ATCAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; BGC823; Brain; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000544868.2
External Link	RMBase: m6A_site_147972
mod ID: M6ASITE006944		Click to Show/Hide the Full List
mod site	chr11:65500194-65500195:+		[27]
Sequence	ACTGGTGTAATTTAAAAAAAACTAAGGCAGAAGGCTTTTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; BGC823; Brain; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147973
mod ID: M6ASITE006945		Click to Show/Hide the Full List
mod site	chr11:65500275-65500276:+		[27]
Sequence	TAGTTTGAAAAATGTGAAGGACTTTCGTAACGGAAGTAATT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; BGC823; Brain; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000610481.1; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: m6A_site_147974
mod ID: M6ASITE006946		Click to Show/Hide the Full List
mod site	chr11:65500284-65500285:+		[30]
Sequence	AAATGTGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAA
Motif Score	2.142029762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000544868.2; ENST00000534336.1; ENST00000619449.2; ENST00000610481.1
External Link	RMBase: m6A_site_147975
mod ID: M6ASITE006947		Click to Show/Hide the Full List
mod site	chr11:65500317-65500318:+		[30]
Sequence	AAGATCAAGAGTAATTACCAACTTAATGTTTTTGCATTGGA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000544868.2; ENST00000610481.1; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147976
mod ID: M6ASITE006948		Click to Show/Hide the Full List
mod site	chr11:65500337-65500338:+		[27]
Sequence	ACTTAATGTTTTTGCATTGGACTTTGAGTTAAGATTATTTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1; ENST00000610481.1
External Link	RMBase: m6A_site_147977
mod ID: M6ASITE006949		Click to Show/Hide the Full List
mod site	chr11:65500371-65500372:+		[27]
Sequence	TTATTTTTTAAATCCTGAGGACTAGCATTAATTGACAGCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1; ENST00000610481.1
External Link	RMBase: m6A_site_147978
mod ID: M6ASITE006950		Click to Show/Hide the Full List
mod site	chr11:65500385-65500386:+		[31]
Sequence	CTGAGGACTAGCATTAATTGACAGCTGACCCAGGTGCTACA
Motif Score	2.859755952
Cell/Tissue List	A549; AML
Seq Type List	m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000534336.1; ENST00000610481.1
External Link	RMBase: m6A_site_147979
mod ID: M6ASITE006951		Click to Show/Hide the Full List
mod site	chr11:65500392-65500393:+		[31]
Sequence	CTAGCATTAATTGACAGCTGACCCAGGTGCTACACAGAAGT
Motif Score	2.839113095
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000610481.1; ENST00000534336.1; ENST00000619449.2; ENST00000544868.2
External Link	RMBase: m6A_site_147980
mod ID: M6ASITE006952		Click to Show/Hide the Full List
mod site	chr11:65500434-65500435:+		[27]
Sequence	GATTCAGTGAATCTAGGAAGACAGCAGCAGACAGGATTCCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000619449.2; ENST00000610481.1; ENST00000534336.1
External Link	RMBase: m6A_site_147981
mod ID: M6ASITE006953		Click to Show/Hide the Full List
mod site	chr11:65500444-65500445:+		[27]
Sequence	ATCTAGGAAGACAGCAGCAGACAGGATTCCAGGAACCAGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1; ENST00000610481.1
External Link	RMBase: m6A_site_147982
mod ID: M6ASITE006954		Click to Show/Hide the Full List
mod site	chr11:65500458-65500459:+		[27]
Sequence	CAGCAGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAG
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544868.2; ENST00000610481.1; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147983
mod ID: M6ASITE006955		Click to Show/Hide the Full List
mod site	chr11:65500480-65500481:+		[27]
Sequence	CAGTGTTTGATGAAGCTAGGACTGAGGAGCAAGCGAGCAAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; BGC823; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000534336.1; ENST00000544868.2; ENST00000610481.1; ENST00000619449.2
External Link	RMBase: m6A_site_147984
mod ID: M6ASITE006956		Click to Show/Hide the Full List
mod site	chr11:65500585-65500586:+		[31]
Sequence	GGAAGAAGGAAGGAGCGCTAACGATTTGGTGGTGAAGCTAG
Motif Score	2.142029762
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000544868.2; ENST00000610481.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147985
mod ID: M6ASITE006957		Click to Show/Hide the Full List
mod site	chr11:65500718-65500719:+		[27]
Sequence	TTGTGCGTAGAGGATCCTAGACCAGCATGCCAGTGTGCCAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: m6A_site_147986
mod ID: M6ASITE006958		Click to Show/Hide the Full List
mod site	chr11:65500803-65500804:+		[27]
Sequence	CAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; hNPCs; fibroblasts; GM12878; LCLs; A549; H1299; Huh7; peripheral-blood; iSLK; MSC; TIME; TREX; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147987
mod ID: M6ASITE006959		Click to Show/Hide the Full List
mod site	chr11:65500807-65500808:+		[30]
Sequence	ATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTTATTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000619449.2; ENST00000544868.2; ENST00000534336.1
External Link	RMBase: m6A_site_147988
mod ID: M6ASITE006960		Click to Show/Hide the Full List
mod site	chr11:65500817-65500818:+		[31]
Sequence	TCTGGAACTTACTTATGGTAACCTTTTATTTATTTTCTAAT
Motif Score	2.147452381
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000534336.1; ENST00000544868.2; ENST00000619449.2
External Link	RMBase: m6A_site_147989
mod ID: M6ASITE006961		Click to Show/Hide the Full List
mod site	chr11:65500856-65500857:+		[30]
Sequence	ATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000544868.2; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147990
mod ID: M6ASITE006962		Click to Show/Hide the Full List
mod site	chr11:65500966-65500967:+		[27]
Sequence	TCTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGGAGAAAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; fibroblasts; LCLs; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000544868.2; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147991
mod ID: M6ASITE006963		Click to Show/Hide the Full List
mod site	chr11:65501037-65501038:+		[27]
Sequence	TTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; U2OS; LCLs; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147992
mod ID: M6ASITE006964		Click to Show/Hide the Full List
mod site	chr11:65501065-65501066:+		[27]
Sequence	AATTTGATAGCCAAATTGAGACAATTTCAGCAAATCTGTAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; U2OS; LCLs; iSLK; MSC; TREX; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147993
mod ID: M6ASITE006965		Click to Show/Hide the Full List
mod site	chr11:65501140-65501141:+		[32]
Sequence	TTCAGTTTTGTGAATAGATGACCTGTTTTTACTTCCTCACC
Motif Score	2.839113095
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147994
mod ID: M6ASITE006966		Click to Show/Hide the Full List
mod site	chr11:65501198-65501199:+		[32]
Sequence	ATGTAGAGTTTGGATGTGTAACTGAGGCGGGGGGGAGTTTT
Motif Score	2.590089286
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147995
mod ID: M6ASITE006967		Click to Show/Hide the Full List
mod site	chr11:65501304-65501305:+		[30]
Sequence	TAGAATCCTAAAGGCAAATGACTCAAGGTGTAACAGAAAAC
Motif Score	3.28175
Cell/Tissue List	HEK293T; AML
Seq Type List	DART-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147996
mod ID: M6ASITE006968		Click to Show/Hide the Full List
mod site	chr11:65501323-65501324:+		[27]
Sequence	GACTCAAGGTGTAACAGAAAACAAGAAAATCCAATATCAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; fibroblasts; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_147997
mod ID: M6ASITE006969		Click to Show/Hide the Full List
mod site	chr11:65501352-65501353:+		[27]
Sequence	TCCAATATCAGGATAATCAGACCACCACAGGTTTACAGTTT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; fibroblasts; MT4; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147998
mod ID: M6ASITE006970		Click to Show/Hide the Full List
mod site	chr11:65501379-65501380:+		[27]
Sequence	CAGGTTTACAGTTTATAGAAACTAGAGCAGTTCTCACGTTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; fibroblasts; MT4; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_147999
mod ID: M6ASITE006972		Click to Show/Hide the Full List
mod site	chr11:65501473-65501474:+		[27]
Sequence	CCCCCCACCCCCTTAATCAGACTTTAAAAGTGCTTAACCCC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HEK293T; fibroblasts; MT4; HEC-1-A; AML
Seq Type List	m6A-seq; DART-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148000
mod ID: M6ASITE006973		Click to Show/Hide the Full List
mod site	chr11:65501498-65501499:+		[27]
Sequence	AAAAGTGCTTAACCCCTTAAACTTGTTATTTTTTACTTGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; fibroblasts; MT4; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_148001
mod ID: M6ASITE006974		Click to Show/Hide the Full List
mod site	chr11:65501538-65501539:+		[33]
Sequence	AGCATTTTGGGATGGTCTTAACAGGGAAGAGAGAGGGTGGG
Motif Score	2.168095238
Cell/Tissue List	HEK293; AML
Seq Type List	m6A-REF-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148002
mod ID: M6ASITE006975		Click to Show/Hide the Full List
mod site	chr11:65501609-65501610:+		[32]
Sequence	CAGATGCTATAGTACTATTGACAAACTGGGTTAGAGAAGGA
Motif Score	2.859755952
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148003
mod ID: M6ASITE006976		Click to Show/Hide the Full List
mod site	chr11:65501613-65501614:+		[27]
Sequence	TGCTATAGTACTATTGACAAACTGGGTTAGAGAAGGAGTGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; fibroblasts; MT4; endometrial; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_148004
mod ID: M6ASITE006977		Click to Show/Hide the Full List
mod site	chr11:65501655-65501656:+		[27]
Sequence	CCGCTGTGCTGTTGGCACGAACACCTTCAGGGACTGGAGCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; fibroblasts; MT4; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_148005
mod ID: M6ASITE006978		Click to Show/Hide the Full List
mod site	chr11:65501667-65501668:+		[27]
Sequence	TGGCACGAACACCTTCAGGGACTGGAGCTGCTTTTATCCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; fibroblasts; MT4; endometrial; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148006
mod ID: M6ASITE006979		Click to Show/Hide the Full List
mod site	chr11:65501763-65501764:+		[27]
Sequence	TATTCAGTCATCTCAGGAGAACTTCAGAAGAGCTTGAGTAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; MT4; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148007
mod ID: M6ASITE006980		Click to Show/Hide the Full List
mod site	chr11:65501939-65501940:+		[27]
Sequence	TAGTTTATGATTGCAGATAAACTCATGCCAGAGAACTTAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; MT4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000534336.1; ENST00000508832.2; ENST00000619449.2
External Link	RMBase: m6A_site_148008
mod ID: M6ASITE006981		Click to Show/Hide the Full List
mod site	chr11:65501953-65501954:+		[27]
Sequence	AGATAAACTCATGCCAGAGAACTTAAAGTCTTAGAATGGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000508832.2
External Link	RMBase: m6A_site_148009
mod ID: M6ASITE006982		Click to Show/Hide the Full List
mod site	chr11:65502010-65502011:+		[32]
Sequence	AACTTCCAAGTTGGCAAGTAACTCCCAATGATTTAGTTTTT
Motif Score	2.590089286
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000616527.4; ENST00000508832.2; ENST00000534336.1
External Link	RMBase: m6A_site_148010
mod ID: M6ASITE006983		Click to Show/Hide the Full List
mod site	chr11:65502182-65502183:+		[27]
Sequence	TTGGGGAAGGAAAGTATTGAACTGGGGGTTGGTCTGGCCTA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; AML
Seq Type List	m6A-seq; DART-seq; miCLIP
Transcript ID List	ENST00000508832.2; ENST00000534336.1; ENST00000619449.2; ENST00000616527.4
External Link	RMBase: m6A_site_148011
mod ID: M6ASITE006984		Click to Show/Hide the Full List
mod site	chr11:65502211-65502212:+		[32]
Sequence	TGGTCTGGCCTACTGGGCTGACATTAACTACAATTATGGGA
Motif Score	2.859755952
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000616527.4; ENST00000508832.2
External Link	RMBase: m6A_site_148012
mod ID: M6ASITE006985		Click to Show/Hide the Full List
mod site	chr11:65502310-65502311:+		[27]
Sequence	TGATTTAATAATAATTTAAAACTACTATAGAAACTGCAGAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000508832.2; ENST00000616527.4; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_148013
mod ID: M6ASITE006986		Click to Show/Hide the Full List
mod site	chr11:65502313-65502314:+		[30]
Sequence	TTTAATAATAATTTAAAACTACTATAGAAACTGCAGAGCAA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000508832.2; ENST00000619449.2; ENST00000616527.4; ENST00000534336.1
External Link	RMBase: m6A_site_148014
mod ID: M6ASITE006987		Click to Show/Hide the Full List
mod site	chr11:65502322-65502323:+		[27]
Sequence	AATTTAAAACTACTATAGAAACTGCAGAGCAAAGGAAGTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000508832.2; ENST00000616527.4
External Link	RMBase: m6A_site_148015
mod ID: M6ASITE006988		Click to Show/Hide the Full List
mod site	chr11:65502473-65502474:+		[27]
Sequence	TTCCATTGTTTAACTGCAAAACAAGATGTTAAGGTATGCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000616527.4; ENST00000534336.1; ENST00000508832.2; ENST00000619449.2
External Link	RMBase: m6A_site_148016
mod ID: M6ASITE006989		Click to Show/Hide the Full List
mod site	chr11:65502522-65502523:+		[27]
Sequence	TTGTAAATTGTTTATTTTAAACTTATCTGTTTGTAAATTGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000508832.2; ENST00000619449.2; rmsk_3569611; ENST00000616527.4
External Link	RMBase: m6A_site_148017
mod ID: M6ASITE006990		Click to Show/Hide the Full List
mod site	chr11:65502617-65502618:+		[27]
Sequence	TTGTTGATGAGGGAGGGGAAACTTTTTTTTTTTCTATAGAC
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000508832.2; ENST00000616527.4; ENST00000534336.1
External Link	RMBase: m6A_site_148018
mod ID: M6ASITE006991		Click to Show/Hide the Full List
mod site	chr11:65502636-65502637:+		[27]
Sequence	AACTTTTTTTTTTTCTATAGACTTTTTTCAGATAACATCTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000508832.2; ENST00000534336.1; ENST00000616527.4
External Link	RMBase: m6A_site_148019
mod ID: M6ASITE006992		Click to Show/Hide the Full List
mod site	chr11:65502667-65502668:+		[32]
Sequence	ATAACATCTTCTGAGTCATAACCAGCCTGGCAGTATGATGG
Motif Score	2.147452381
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000508832.2; ENST00000616527.4
External Link	RMBase: m6A_site_148020
mod ID: M6ASITE006993		Click to Show/Hide the Full List
mod site	chr11:65502704-65502705:+		[27]
Sequence	ATGGCCTAGATGCAGAGAAAACAGCTCCTTGGTGAATTGAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; fibroblasts; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000508832.2; ENST00000534336.1; ENST00000616527.4; ENST00000619449.2
External Link	RMBase: m6A_site_148021
mod ID: M6ASITE006994		Click to Show/Hide the Full List
mod site	chr11:65502777-65502778:+		[31]
Sequence	TCCATTGGGGAATAAGCATAACCCTGAGATTCTTACTACTG
Motif Score	2.147452381
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000534336.1; ENST00000508832.2; ENST00000618925.1; ENST00000619449.2; ENST00000616527.4
External Link	RMBase: m6A_site_148022
mod ID: M6ASITE006995		Click to Show/Hide the Full List
mod site	chr11:65502804-65502805:+		[27]
Sequence	GATTCTTACTACTGATGAGAACATTATCTGCATATGCCAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; brain; kidney; liver; HEK293T; HepG2; hNPCs; fibroblasts; CD8T; A549; iSLK; HEC-1-A; AML
Seq Type List	m6A-seq; m6A-REF-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000616527.4; ENST00000534336.1; ENST00000508832.2; ENST00000619449.2; ENST00000618925.1
External Link	RMBase: m6A_site_148023
mod ID: M6ASITE006996		Click to Show/Hide the Full List
mod site	chr11:65503116-65503117:+		[27]
Sequence	CAATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293; hNPCs; fibroblasts; HEC-1-A; AML
Seq Type List	m6A-seq; m6A-REF-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000508832.2; ENST00000618925.1; ENST00000616527.4
External Link	RMBase: m6A_site_148024
mod ID: M6ASITE006997		Click to Show/Hide the Full List
mod site	chr11:65503170-65503171:+		[27]
Sequence	ATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAACAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000618925.1; ENST00000534336.1; ENST00000616527.4; ENST00000508832.2; ENST00000619449.2
External Link	RMBase: m6A_site_148025
mod ID: M6ASITE006998		Click to Show/Hide the Full List
mod site	chr11:65503354-65503355:+		[27]
Sequence	AGCCTTTTTAAAATTGTAGGACTTGTTCCTGTGGGCTTCAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000616527.4; ENST00000619449.2; ENST00000618925.1; ENST00000508832.2; ENST00000534336.1
External Link	RMBase: m6A_site_148026
mod ID: M6ASITE006999		Click to Show/Hide the Full List
mod site	chr11:65503583-65503584:+		[27]
Sequence	TGATGTAAATTGTGTAGAAAACCATTAAATCATTCAAAATA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000616527.4; ENST00000618925.1; ENST00000534336.1; ENST00000508832.2
External Link	RMBase: m6A_site_148027
mod ID: M6ASITE007000		Click to Show/Hide the Full List
mod site	chr11:65503608-65503609:+		[27]
Sequence	TAAATCATTCAAAATAATAAACTATTTTTATTAGAGAATGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000618925.1; ENST00000508832.2; ENST00000534336.1; ENST00000616527.4
External Link	RMBase: m6A_site_148028
mod ID: M6ASITE007001		Click to Show/Hide the Full List
mod site	chr11:65503730-65503731:+		[27]
Sequence	TCTTCTCTAATCTTTCAGAAACTTTGTCTGCGAACACTCTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000618925.1; ENST00000619449.2; ENST00000612781.1; ENST00000620465.4; ENST00000616527.4
External Link	RMBase: m6A_site_148029
mod ID: M6ASITE007002		Click to Show/Hide the Full List
mod site	chr11:65503743-65503744:+		[27]
Sequence	TTCAGAAACTTTGTCTGCGAACACTCTTTAATGGACCAGAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000619449.2; ENST00000618925.1; ENST00000534336.1; ENST00000620465.4; ENST00000616527.4; ENST00000612781.1
External Link	RMBase: m6A_site_148030
mod ID: M6ASITE007003		Click to Show/Hide the Full List
mod site	chr11:65503757-65503758:+		[27]
Sequence	CTGCGAACACTCTTTAATGGACCAGATCAGGATTTGAGCGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000612781.1; ENST00000620465.4; ENST00000618925.1; ENST00000619449.2; ENST00000534336.1; ENST00000616527.4
External Link	RMBase: m6A_site_148031
mod ID: M6ASITE007004		Click to Show/Hide the Full List
mod site	chr11:65503808-65503809:+		[27]
Sequence	GTAACTTTAAGGCAGGAAAGACAAATTTTATTCTTCATAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000612781.1; ENST00000616527.4; ENST00000620465.4
External Link	RMBase: m6A_site_148032
mod ID: M6ASITE007005		Click to Show/Hide the Full List
mod site	chr11:65503901-65503902:+		[27]
Sequence	AGGAATAAATAACCTCTTAGACAGGTGGGAGATTATGATCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000616527.4; ENST00000612781.1; ENST00000620465.4
External Link	RMBase: m6A_site_148033
mod ID: M6ASITE007006		Click to Show/Hide the Full List
mod site	chr11:65503976-65503977:+		[32]
Sequence	AGTCAGGGGTCTATAAATTGACAGTGATTAGAGTAATACTT
Motif Score	2.859755952
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000616527.4; ENST00000612781.1; ENST00000534336.1; ENST00000619449.2; ENST00000620465.4
External Link	RMBase: m6A_site_148034
mod ID: M6ASITE007007		Click to Show/Hide the Full List
mod site	chr11:65504037-65504038:+		[30]
Sequence	CATGTTAACTTTAAATGCTTACAATCTTAGAGTGGTAGGCA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000618132.1; ENST00000620465.4; ENST00000616527.4; ENST00000612781.1
External Link	RMBase: m6A_site_148035
mod ID: M6ASITE007008		Click to Show/Hide the Full List
mod site	chr11:65504219-65504220:+		[27]
Sequence	TGTTCTAGTGAGTGTATGAGACCTTGCAGTGAGTTTATCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000620465.4; ENST00000616527.4; ENST00000619449.2; ENST00000534336.1; ENST00000618132.1; ENST00000612781.1
External Link	RMBase: m6A_site_148036
mod ID: M6ASITE007009		Click to Show/Hide the Full List
mod site	chr11:65504325-65504326:+		[27]
Sequence	AGCTTTTTTTTTTTTTACAGACTTCACAGAGAATGCAGTTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000618132.1; ENST00000620465.4; ENST00000612781.1; ENST00000534336.1; ENST00000616527.4
External Link	RMBase: m6A_site_148037
mod ID: M6ASITE007010		Click to Show/Hide the Full List
mod site	chr11:65504633-65504634:+		[27]
Sequence	ATTTCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000610851.1; ENST00000613376.1; ENST00000612781.1; ENST00000618132.1; ENST00000534336.1
External Link	RMBase: m6A_site_148038
mod ID: M6ASITE007011		Click to Show/Hide the Full List
mod site	chr11:65504677-65504678:+		[32]
Sequence	ATGCAACCTTAAAATCAGTGACAAGAAACATTCCAAACAAG
Motif Score	2.859755952
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000613376.1; ENST00000618132.1; ENST00000612781.1; ENST00000534336.1; ENST00000610851.1
External Link	RMBase: m6A_site_148039
mod ID: M6ASITE007013		Click to Show/Hide the Full List
mod site	chr11:65504684-65504685:+		[27]
Sequence	CTTAAAATCAGTGACAAGAAACATTCCAAACAAGCAACAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000612781.1; ENST00000534336.1; ENST00000613376.1; ENST00000619449.2; ENST00000610851.1; ENST00000618132.1
External Link	RMBase: m6A_site_148040
mod ID: M6ASITE007014		Click to Show/Hide the Full List
mod site	chr11:65504693-65504694:+		[27]
Sequence	AGTGACAAGAAACATTCCAAACAAGCAACAGTCTTCAAGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000613376.1; ENST00000610851.1; ENST00000618132.1; ENST00000534336.1
External Link	RMBase: m6A_site_148041
mod ID: M6ASITE007015		Click to Show/Hide the Full List
mod site	chr11:65504719-65504720:+		[27]
Sequence	AACAGTCTTCAAGAAATTAAACTGGCAAGTGGAAATGTTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000610851.1; ENST00000619449.2; ENST00000618132.1; ENST00000534336.1; ENST00000613376.1
External Link	RMBase: m6A_site_148042
mod ID: M6ASITE007016		Click to Show/Hide the Full List
mod site	chr11:65504741-65504742:+		[27]
Sequence	TGGCAAGTGGAAATGTTTAAACAGTTCAGTGATCTTTAGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000613376.1; ENST00000619449.2; ENST00000534336.1; ENST00000610851.1; ENST00000618132.1
External Link	RMBase: m6A_site_148043
mod ID: M6ASITE007017		Click to Show/Hide the Full List
mod site	chr11:65504821-65504822:+		[27]
Sequence	CTTAATTCTTACATGCAGGAACACTCAGCAGACACACGTAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000613376.1; ENST00000619449.2; ENST00000610851.1; ENST00000618132.1; ENST00000534336.1
External Link	RMBase: m6A_site_148044
mod ID: M6ASITE007018		Click to Show/Hide the Full List
mod site	chr11:65504832-65504833:+		[27]
Sequence	CATGCAGGAACACTCAGCAGACACACGTATGCGAAGGGCCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000613376.1; ENST00000618132.1; ENST00000610851.1
External Link	RMBase: m6A_site_148045
mod ID: M6ASITE007019		Click to Show/Hide the Full List
mod site	chr11:65504863-65504864:+		[27]
Sequence	CGAAGGGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000610851.1; ENST00000618227.1; ENST00000619449.2; ENST00000534336.1
External Link	RMBase: m6A_site_148046
mod ID: M6ASITE007020		Click to Show/Hide the Full List
mod site	chr11:65504900-65504901:+		[27]
Sequence	AGCCTATTTACTTTAAATAAACCAAACATTCCATTTTAAAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000610851.1; ENST00000619449.2; ENST00000534336.1; ENST00000618227.1
External Link	RMBase: m6A_site_148047
mod ID: M6ASITE007021		Click to Show/Hide the Full List
mod site	chr11:65504905-65504906:+		[27]
Sequence	ATTTACTTTAAATAAACCAAACATTCCATTTTAAATGTGGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000618227.1; ENST00000610851.1
External Link	RMBase: m6A_site_148048
mod ID: M6ASITE007022		Click to Show/Hide the Full List
mod site	chr11:65504934-65504935:+		[27]
Sequence	TTTAAATGTGGGGATTGGGAACCACTAGTTCTTTCAGATGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000618227.1; ENST00000610851.1; ENST00000534336.1
External Link	RMBase: m6A_site_148049
mod ID: M6ASITE007024		Click to Show/Hide the Full List
mod site	chr11:65504965-65504966:+		[27]
Sequence	TTTCAGATGGTATTCTTCAGACTATAGAAGGAGCTTCCAGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000618227.1; ENST00000534336.1; ENST00000610851.1; ENST00000619449.2
External Link	RMBase: m6A_site_148050
mod ID: M6ASITE007025		Click to Show/Hide the Full List
mod site	chr11:65505001-65505002:+		[27]
Sequence	CCAGTTGAATTCACCAGTGGACAAAATGAGGAAAACAGGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000618227.1; ENST00000619449.2; ENST00000534336.1; ENST00000610851.1
External Link	RMBase: m6A_site_148051
mod ID: M6ASITE007026		Click to Show/Hide the Full List
mod site	chr11:65505015-65505016:+		[27]
Sequence	CAGTGGACAAAATGAGGAAAACAGGTGAACAAGCTTTTTCT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000610851.1; ENST00000618227.1; ENST00000534336.1
External Link	RMBase: m6A_site_148052
mod ID: M6ASITE007027		Click to Show/Hide the Full List
mod site	chr11:65505023-65505024:+		[27]
Sequence	AAAATGAGGAAAACAGGTGAACAAGCTTTTTCTGTATTTAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000610851.1; ENST00000619449.2; ENST00000618227.1
External Link	RMBase: m6A_site_148053
mod ID: M6ASITE007028		Click to Show/Hide the Full List
mod site	chr11:65505068-65505069:+		[27]
Sequence	AAAGTCAGATCAGTTATGGGACAATAGTATTGAATAGATTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000610851.1; ENST00000618227.1; ENST00000534336.1; ENST00000619449.2
External Link	RMBase: m6A_site_148054
mod ID: M6ASITE007029		Click to Show/Hide the Full List
mod site	chr11:65505123-65505124:+		[27]
Sequence	AGTAACTGGCATGTGAGCAAACTGTGTTGGCGTGGGGGTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000618227.1; ENST00000619449.2; ENST00000610851.1
External Link	RMBase: m6A_site_148055
mod ID: M6ASITE007030		Click to Show/Hide the Full List
mod site	chr11:65505223-65505224:+		[27]
Sequence	CACCGAAGGCTTAAAGTAGGACAACCATGGAGCCTTCCTGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000534336.1; ENST00000617489.1; ENST00000618227.1; ENST00000619449.2; ENST00000610851.1; ENST00000616691.1
External Link	RMBase: m6A_site_148056
mod ID: M6ASITE007031		Click to Show/Hide the Full List
mod site	chr11:65505254-65505255:+		[27]
Sequence	GCCTTCCTGTGGCAGGAGAGACAACAAAGCGCTATTATCCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000617489.1; ENST00000618227.1; ENST00000619449.2; ENST00000616691.1; ENST00000610851.1
External Link	RMBase: m6A_site_148057
mod ID: M6ASITE007032		Click to Show/Hide the Full List
mod site	chr11:65505323-65505324:+		[29]
Sequence	GATTTTTATTAGTAATGAGGACTTGCCTCAACTCCCTCTTT
Motif Score	4.065041667
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000617489.1; ENST00000618227.1; ENST00000610851.1; ENST00000534336.1; ENST00000619449.2; ENST00000616691.1
External Link	RMBase: m6A_site_148058
mod ID: M6ASITE007033		Click to Show/Hide the Full List
mod site	chr11:65505556-65505557:+		[33]
Sequence	CCACAAGCAACTTCTCTGCCACATCGCCACCCCGTGCCTTT
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000616691.1; ENST00000610851.1; ENST00000617489.1; ENST00000619449.2; ENST00000534336.1; ENST00000618227.1
External Link	RMBase: m6A_site_148059
mod ID: M6ASITE007035		Click to Show/Hide the Full List
mod site	chr11:65505590-65505591:+		[29]
Sequence	TGCCTTTTGATCTAGCACAGACCCTTCACCCCTCACCTCGA
Motif Score	2.876744048
Cell/Tissue List	CD34; HepG2; MT4; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000617489.1; ENST00000610851.1; ENST00000534336.1; ENST00000619449.2; ENST00000616691.1; ENST00000618227.1
External Link	RMBase: m6A_site_148060
mod ID: M6ASITE007036		Click to Show/Hide the Full List
mod site	chr11:65505695-65505696:+		[27]
Sequence	CGAGGTCTTTGGTGGGTTGAACTATGTTAGAAAAGGCCATT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000610851.1; ENST00000534336.1; ENST00000617489.1; ENST00000619449.2; ENST00000618227.1; ENST00000616691.1
External Link	RMBase: m6A_site_148061
mod ID: M6ASITE007037		Click to Show/Hide the Full List
mod site	chr11:65505736-65505737:+		[32]
Sequence	AATTTGCCTGCAAATTGTTAACAGAAGGGTATTAAAACCAC
Motif Score	2.168095238
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000618227.1; ENST00000610851.1; ENST00000617489.1; ENST00000616691.1
External Link	RMBase: m6A_site_148062
mod ID: M6ASITE007038		Click to Show/Hide the Full List
mod site	chr11:65505752-65505753:+		[27]
Sequence	GTTAACAGAAGGGTATTAAAACCACAGCTAAGTAGCTCTAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000618227.1; ENST00000616691.1; ENST00000619449.2; ENST00000617489.1; ENST00000610851.1; ENST00000534336.1
External Link	RMBase: m6A_site_148063
mod ID: M6ASITE007039		Click to Show/Hide the Full List
mod site	chr11:65505791-65505792:+		[32]
Sequence	ATTATAATACTTATCCAGTGACTAAAACCAACTTAAACCAG
Motif Score	3.28175
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000617489.1; ENST00000619449.2; ENST00000534336.1; ENST00000610851.1; ENST00000616691.1; ENST00000618227.1
External Link	RMBase: m6A_site_148064
mod ID: M6ASITE007040		Click to Show/Hide the Full List
mod site	chr11:65505797-65505798:+		[27]
Sequence	ATACTTATCCAGTGACTAAAACCAACTTAAACCAGTAAGTG
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000617489.1; ENST00000618227.1; ENST00000619449.2; ENST00000610851.1; ENST00000534336.1; ENST00000616691.1
External Link	RMBase: m6A_site_148065
mod ID: M6ASITE007041		Click to Show/Hide the Full List
mod site	chr11:65505807-65505808:+		[27]
Sequence	AGTGACTAAAACCAACTTAAACCAGTAAGTGGAGAAATAAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000616691.1; ENST00000534336.1; ENST00000618227.1; ENST00000619449.2; ENST00000610851.1; ENST00000617489.1
External Link	RMBase: m6A_site_148066
mod ID: M6ASITE007042		Click to Show/Hide the Full List
mod site	chr11:65505838-65505839:+		[27]
Sequence	GAGAAATAACATGTTCAAGAACTGTAATGCTGGGTGGGAAC
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000616691.1; ENST00000617489.1; ENST00000619449.2; ENST00000534336.1; ENST00000610851.1; ENST00000618227.1
External Link	RMBase: m6A_site_148067
mod ID: M6ASITE007043		Click to Show/Hide the Full List
mod site	chr11:65505857-65505858:+		[27]
Sequence	AACTGTAATGCTGGGTGGGAACATGTAACTTGTAGACTGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000610851.1; ENST00000617489.1; ENST00000618227.1; ENST00000619449.2; ENST00000534336.1; ENST00000616691.1
External Link	RMBase: m6A_site_148068
mod ID: M6ASITE007044		Click to Show/Hide the Full List
mod site	chr11:65505872-65505873:+		[27]
Sequence	TGGGAACATGTAACTTGTAGACTGGAGAAGATAGGCATTTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000617489.1; ENST00000619449.2; ENST00000534336.1; ENST00000618227.1; ENST00000610851.1; ENST00000616691.1
External Link	RMBase: m6A_site_148069
mod ID: M6ASITE007046		Click to Show/Hide the Full List
mod site	chr11:65505941-65505942:+		[27]
Sequence	TGCAAAAATTCTCTGCTAAGACTTTTTCAGGTGAACATAAC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000617489.1; ENST00000534336.1; ENST00000610851.1; ENST00000619449.2; ENST00000616691.1; ENST00000618227.1
External Link	RMBase: m6A_site_148070
mod ID: M6ASITE007047		Click to Show/Hide the Full List
mod site	chr11:65505955-65505956:+		[29]
Sequence	GCTAAGACTTTTTCAGGTGAACATAACAGACTTGGCCAAGC
Motif Score	2.951386905
Cell/Tissue List	CD34; HepG2; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000616691.1; ENST00000610851.1; ENST00000534336.1; ENST00000619449.2; ENST00000618227.1; ENST00000617489.1
External Link	RMBase: m6A_site_148071
mod ID: M6ASITE007048		Click to Show/Hide the Full List
mod site	chr11:65505964-65505965:+		[29]
Sequence	TTTTCAGGTGAACATAACAGACTTGGCCAAGCTAGCATCTT
Motif Score	3.319380952
Cell/Tissue List	CD34; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000610851.1; ENST00000616691.1; ENST00000619449.2; ENST00000617489.1; ENST00000618227.1
External Link	RMBase: m6A_site_148072
mod ID: M6ASITE007049		Click to Show/Hide the Full List
mod site	chr11:65506047-65506048:+		[27]
Sequence	GTTTTTCTTTTCCTGAGAAAACAACACGTATTGTTTTCTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000619449.2; ENST00000616691.1; ENST00000534336.1; ENST00000617489.1; ENST00000610851.1; ENST00000618227.1
External Link	RMBase: m6A_site_148073
mod ID: M6ASITE007050		Click to Show/Hide the Full List
mod site	chr11:65506148-65506149:+		[31]
Sequence	TGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGG
Motif Score	3.616982143
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000618227.1; ENST00000616691.1; ENST00000610851.1; ENST00000534336.1; ENST00000617489.1; ENST00000611300.1; ENST00000619449.2
External Link	RMBase: m6A_site_148074
mod ID: M6ASITE007051		Click to Show/Hide the Full List
mod site	chr11:65506287-65506288:+		[29]
Sequence	TAACAGCACAATATCTTTGAACTATATACATCCTTGATGTA
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000534336.1; ENST00000619449.2; ENST00000616691.1; ENST00000610851.1; ENST00000618227.1; ENST00000617489.1
External Link	RMBase: m6A_site_148075

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000009		Click to Show/Hide the Full List
mod site	chr11:65500854-65500855:+		[34]
Sequence	TAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATT
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000619449.2; ENST00000534336.1; ENST00000544868.2
External Link	RMBase: m7G_site_167

Pseudouridine (Pseudo)

In total 4 m6A sequence/site(s) in this target gene
mod ID: PSESITE000325		Click to Show/Hide the Full List
mod site	chr11:65501134-65501135:+		[35]
Sequence	AAGTATTTCAGTTTTGTGAATAGATGACCTGTTTTTACTTC
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: Pseudo_site_931
mod ID: PSESITE000326		Click to Show/Hide the Full List
mod site	chr11:65501280-65501281:+		[36]
Sequence	AGTTCTTTTTCCCTTAGGTCTGTCTAGAATCCTAAAGGCAA
Transcript ID List	ENST00000534336.1; ENST00000619449.2
External Link	RMBase: Pseudo_site_932
mod ID: PSESITE000327		Click to Show/Hide the Full List
mod site	chr11:65502920-65502921:+		[37]
Sequence	ATAACCACAAAAATAATGAATTGATGAGAAATACAATGAAG
Transcript ID List	ENST00000619449.2; ENST00000508832.2; ENST00000534336.1; ENST00000616527.4; ENST00000618249.1; ENST00000618925.1
External Link	RMBase: Pseudo_site_933
mod ID: PSESITE000328		Click to Show/Hide the Full List
mod site	chr11:65503350-65503351:+		[37]
Sequence	ATCGAGCCTTTTTAAAATTGTAGGACTTGTTCCTGTGGGCT
Transcript ID List	ENST00000534336.1; ENST00000618925.1; ENST00000616527.4; ENST00000508832.2; ENST00000619449.2
External Link	RMBase: Pseudo_site_934

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map

Ref 1	METTL3 enhances the stability of MALAT1 with the assistance of HuR via m6A modification and activates NF-KappaB to promote the malignant progression of IDH-wildtype glioma. Cancer Lett. 2021 Jul 28;511:36-46. doi: 10.1016/j.canlet.2021.04.020. Epub 2021 Apr 29.
Ref 2	m(6)A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis. J Hematol Oncol. 2019 Dec 9;12(1):135. doi: 10.1186/s13045-019-0830-6.
Ref 3	METTL3-dependent MALAT1 delocalization drives c-Myc induction in thymic epithelial tumors. Clin Epigenetics. 2021 Sep 16;13(1):173. doi: 10.1186/s13148-021-01159-6.
Ref 4	Effect of m6A methyltransferase METTL3 -mediated MALAT1/E2F1/AGR2 axis on adriamycin resistance in breast cancer. J Biochem Mol Toxicol. 2022 Jan;36(1):e22922. doi: 10.1002/jbt.22922. Epub 2021 Dec 28.
Ref 5	The m6A methyltransferase METTL3 controls epithelial-mesenchymal transition, migration and invasion of breast cancer through the MALAT1/miR-26b/HMGA2 axis. Cancer Cell Int. 2021 Aug 21;21(1):441. doi: 10.1186/s12935-021-02113-5.
Ref 6	m(6)A-induced lncRNA MALAT1 aggravates renal fibrogenesis in obstructive nephropathy through the miR-145/FAK pathway. Aging (Albany NY). 2020 Mar 23;12(6):5280-5299. doi: 10.18632/aging.102950. Epub 2020 Mar 23.
Ref 7	Changes and relationship of N(6)-methyladenosine modification and long non-coding RNAs in oxidative damage induced by cadmium in pancreatic Beta-cells. Toxicol Lett. 2021 Jun 1;343:56-66. doi: 10.1016/j.toxlet.2021.02.014. Epub 2021 Feb 24.
Ref 8	The tumor-suppressive effects of alpha-ketoglutarate-dependent dioxygenase FTO via N6-methyladenosine RNA methylation on bladder cancer patients. Bioengineered. 2021 Dec;12(1):5323-5333. doi: 10.1080/21655979.2021.1964893.
Ref 9	FTO modifies the m6A level of MALAT and promotes bladder cancer progression. Clin Transl Med. 2021 Feb;11(2):e310. doi: 10.1002/ctm2.310.
Ref 10	The functions of N6-methyladenosine modification in lncRNAs. Genes Dis. 2020 Mar 19;7(4):598-605. doi: 10.1016/j.gendis.2020.03.005. eCollection 2020 Dec.
Ref 11	Dexmedetomidine Suppressed the Biological Behavior of HK-2 Cells Treated with LPS by Down-Regulating ALKBH5. Inflammation. 2020 Dec;43(6):2256-2263. doi: 10.1007/s10753-020-01293-y.
Ref 12	Nuclear export of chimeric mRNAs depends on an lncRNA-triggered autoregulatory loop in blood malignancies. Cell Death Dis. 2020 Jul 23;11(7):566. doi: 10.1038/s41419-020-02795-1.
Ref 13	IGF2BP2 Regulates MALAT1 by Serving as an N6-Methyladenosine Reader to Promote NSCLC Proliferation. Front Mol Biosci. 2022 Jan 17;8:780089. doi: 10.3389/fmolb.2021.780089. eCollection 2021.
Ref 14	Hsa_circ_0004287 inhibits macrophage-mediated inflammation in an N(6)-methyladenosine-dependent manner in atopic dermatitis and psoriasis. J Allergy Clin Immunol. 2022 Jun;149(6):2021-2033. doi: 10.1016/j.jaci.2021.11.024. Epub 2021 Dec 23.
Ref 15	The selective class I PI3K inhibitor CH5132799 targets human cancers harboring oncogenic PIK3CA mutations. Clin Cancer Res. 2011 May 15;17(10):3272-81. doi: 10.1158/1078-0432.CCR-10-2882. Epub 2011 May 10.
Ref 16	Mechanism of METTL14 and m6A modification of lncRNA MALAT1 in the proliferation of oral squamous cell carcinoma cells. Oral Dis. 2022 Apr 25. doi: 10.1111/odi.14220. Online ahead of print.
Ref 17	The Dark Side of the Epitranscriptome: Chemical Modifications in Long Non-Coding RNAs. Int J Mol Sci. 2017 Nov 10;18(11):2387. doi: 10.3390/ijms18112387.
Ref 18	UCN-01: a potent abrogator of G2 checkpoint function in cancer cells with disrupted p53. J Natl Cancer Inst. 1996 Jul 17;88(14):956-65. doi: 10.1093/jnci/88.14.956.
Ref 19	Antibody-Dependent Cellular Cytotoxicity Activity of a Novel Anti-PD-L1 Antibody Avelumab (MSB0010718C) on Human Tumor Cells. Cancer Immunol Res. 2015 Oct;3(10):1148-1157. doi: 10.1158/2326-6066.CIR-15-0059. Epub 2015 May 26.
Ref 20	Marine-Sourced Anti-Cancer and Cancer Pain Control Agents in Clinical and Late Preclinical Development. Mar Drugs. 2014 January; 12(1): 255-278.
Ref 21	Recent advances in Hsp90 inhibitors as antitumor agents. Anticancer Agents Med Chem. 2008 Oct;8(7):761-82. doi: 10.2174/187152008785914824.
Ref 22	A phase II study of ABT-510 (thrombospondin-1 analog) for the treatment of metastatic melanoma. Am J Clin Oncol. 2007 Jun;30(3):303-9. doi: 10.1097/01.coc.0000256104.80089.35.
Ref 23	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 24	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 25	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 26	The m1A landscape on cytosolic and mitochondrial mRNA at single-base resolution. Nature. 2017 Nov 9;551(7679):251-255. doi: 10.1038/nature24456. Epub 2017 Oct 25.
Ref 27	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 28	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 29	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 30	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 31	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 32	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 33	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 34	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.
Ref 35	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.
Ref 36	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.
Ref 37	Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature. 2014 Nov 6;515(7525):143-6. doi: 10.1038/nature13802. Epub 2014 Sep 5.