m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00375)

Target Name	Mutated in multiple advanced cancers 1 (PTEN)
Synonyms	Mutated in multiple advanced cancers 1; Phosphatase and tensin homolog; MMAC1; TEP1 Click to Show/Hide
Gene Name	PTEN
Chromosomal Location	10q23.31
Family	PTEN phosphatase protein family
Function	Tumor suppressor. Acts as a dual-specificity protein phosphatase, dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins. Also acts as a lipid phosphatase, removing the phosphate in the D3 position of the inositol ring from phosphatidylinositol 3,4,5-trisphosphate, phosphatidylinositol 3,4-diphosphate, phosphatidylinositol 3-phosphate and inositol 1,3,4,5-tetrakisphosphate with order of substrate preference in vitro PtdIns(3,4,5)P3 > PtdIns(3,4)P2 > PtdIns3P > Ins(1,3,4,5)P4. The lipid phosphatase activity is critical for its tumor suppressor function. Antagonizes the PI3K-AKT/PKB signaling pathway by dephosphorylating phosphoinositides and thereby modulating cell cycle progression and cell survival. The unphosphorylated form cooperates with MAGI2 to suppress AKT1 activation. Dephosphorylates tyrosine-phosphorylated focal adhesion kinase and inhibits cell migration and integrin-mediated cell spreading and focal adhesion formation. Plays a role as a key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation. May be a negative regulator of insulin signaling and glucose metabolism in adipose tissue. The nuclear monoubiquitinated form possesses greater apoptotic potential, whereas the cytoplasmic nonubiquitinated form induces less tumor suppressive ability. In motile cells, suppresses the formation of lateral pseudopods and thereby promotes cell polarization and directed movement.; [Isoform alpha]: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1. Click to Show/Hide
Gene ID	5728
Uniprot ID	PTEN_HUMAN
HGNC ID	HGNC:9588
KEGG ID	hsa:5728

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PTEN can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 9.60E-01 p-value: 1.46E-37
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between PTEN and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.25E+00	GSE60213

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, BCL2 and Mutated in multiple advanced cancers 1 (PTEN) mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Target Regulation	Up regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Cell Process	Cell differentiation and apoptosis
	Apoptosis (hsa04210)
In-vitro Model	HSPC (Human hematopoietic stem cell)
In-vivo Model	500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	The molecular mechanism underlying the effect of LINC00470 on chronic myelocytic leukaemia by reducing the Mutated in multiple advanced cancers 1 (PTEN) stability via RNA methyltransferase METTL3, thus leading to the inhibition of cell autophagy while promoting chemoresistance in CML.
Target Regulation	Down regulation
Responsed Disease	Chronic myeloid leukaemia		ICD-11: 2B33.2	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KCL-22	Chronic myelogenous leukemia	Homo sapiens	CVCL_2091
In-vivo Model	In the control mice or ADR mice group, the parental or chemo-resistant K562 cells were infected with LV-shCtrl. In the ADR + shLINC00470 group, the chemo-resistant K562 cells were infected with LV- shLINC00470. These cells were injected, respectively, into these 5-week-old mice subcutaneously.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Bete-elemene exerted the restrictive impacts on the cell growth of lung cancer in vivo and in vitro through targeting METTL3. Bete-elemene contributed to the augmented PTEN expression via suppressing its m6A modification.
Target Regulation	Down regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	Four-week-old BALB/c nude mice were randomly divided into three groups: (1) vector group, (2) vector + Bete-elemene group, and (3) Bete-elemene + METTL3 group. Nude mice were raised in an SPF level animal house and were free to eat and drink. Mice in the vector group were subcutaneously injected with lung cancer cells transfected with empty vector and did not receive Bete-elemene administration, and this group was implemented as the negative control. Following establishing orthotopic xenografts by using A549 or H1299 cells transfected with empty vector, mice in the vector + Bete-elemene group underwent intraperitoneal injection with Bete-elemene once a day. For the subcutaneous transplanted model, A549 or H1299 cells transfected with METTL3-overexpressing vector were inoculated into mice from the Bete-elemene + METTL3 group. Then, mice were intraperitoneally administrated with Bete-elemene once a day. Three weeks later, all the animals were euthanized with CO2. Xenografts were removed and weighted after mice were euthanatized.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3/YTHDF2/Mutated in multiple advanced cancers 1 (PTEN) axis exerts a significant role in hypoxia induced PASMCs proliferation, providing a novel therapeutic target for hypoxic pulmonary hypertension.
Target Regulation	Down regulation
Responsed Disease	Pulmonary hypertension due to lung disease or hypoxia		ICD-11: BB01.2	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell apoptosis
In-vitro Model	PASMC cell line (Pulmonary artery smooth muscle cell)
In-vivo Model	10 rats were divided into control and HPH group. In detail, 5 rats of the hypoxia groups were exposed to hypoxia (10%O₂) chamber (AiPu XBS-02B, China) for 4 weeks. In addition, 5 rats of control group were kept under normoxic conditions (21% O₂) for 4 weeks. Rats were housed in standard polypropylene cages under controlled photocycle (12 h light/12 h dark) under 22-25 ℃ temperature.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: -9.93E-01 p-value: 1.46E-04
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	METTL14 inhibits tumor growth and metastasis of Stomach Adenocarcinoma via stabilization of Mutated in multiple advanced cancers 1 (PTEN) mRNA expression. Therefore, METTL14 is a potential biomarker of prognosis and therapeutic targets for Stomach Adenocarcinoma.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	RGM1	Normal	Rattus norvegicus	CVCL_0499
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	For the purpose of enhancing the overall randomization of the experiment, a random comparison table had been employed. Accordingly, 5-wk-old male nude athymic BALB/c nu/nu mice (Slack, Shanghai, China) were randomly divided into two parts including a control group (NC) and the experimental group METTL14-OE. For developing subcutaneous xeno transplantation model, 5 × 10⁶ HGC-27 cells stably transfected with NC or METTL14 overexpression were subcutaneously incorporated for 5-week-old BALB/c nude mice. The mice experienced euthanasia after 27 days of inoculation and obtained xenografts's mass was obtained. Tumor volume over three days was obtained. To create mouse STAD liver metastasis orthotopic tumor model, 1 × 10⁶ HGC-27 cells under stable transfection with NC or METTL14 overexpression were added to subserosal gastric wall of BALB/c nude mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Upregulation of METTL14 inhibited ccRCC cells proliferation and migration in vitro. Overexpression of METTL14 increased the m6A enrichment of Mutated in multiple advanced cancers 1 (PTEN), and promoted Pten expression. METTL14-enhanced Pten mRNA stability was dependent on YTHDF1.
Target Regulation	Up regulation
Responsed Disease	Renal cell carcinoma of kidney		ICD-11: 2C90.0	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	METTL14-regulated PI3K/Akt signaling pathway via Mutated in multiple advanced cancers 1 (PTEN) affected HDAC5-mediated EMT of renal tubular cells in diabetic kidney disease.
Target Regulation	Down regulation
Responsed Disease	Chronic kidney disease		ICD-11: GB61.Z	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
In-vivo Model	Twenty mice were randomly divided into three groups: normal mice group (N), diabetic mice group (DM), and diabetic mice administrated with TSA group (DM + TSA).

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shALKBH5 MOLM-13 cells Control: shNS MOLM-13 cells		GSE144968
Regulation		logFC: -2.10E+00 p-value: 1.89E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[8]
Response Summary	ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15-AS1 bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated Mutated in multiple advanced cancers 1 (PTEN) transcription to inactivate AKT pathway.
Responsed Disease	Pancreatic cancer		ICD-11: 2C10	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Epithelial-mesenchymal transition
	Cell apoptosis
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480

YTH domain-containing protein 1 (YTHDC1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDC1*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shYTHDC1 MOLM13 cells Control: shControl MOLM13 cells		GSE168565
Regulation		logFC: 7.38E-01 p-value: 4.67E-08
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[9]
Response Summary	YTHDC1 promoted Mutated in multiple advanced cancers 1 (PTEN) mRNA degradation to increase Akt phosphorylation, thus facilitating neuronal survival in particular after ischemia, modulating m6A reader YTHDC1 provide a potential therapeutic target for ischemic stroke.
Target Regulation	Down regulation
Responsed Disease	Acute ischemic stroke		ICD-11: 8B11	Disease Info
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	Male SD rats weighing 200-250 g were anesthetized using 4% isoflurane in 70% N₂O and 30% O₂ with a mask. A midline incision was made in the neck, the left external carotid artery (ECA) was carefully exposed and dissected, a monofilament nylon suture with a diameter of about 0.22 mm was inserted from the ECA into the internal carotid artery, and the left middle cerebral artery (MCA) was blocked. After occlusion for 90 minutes, the suture was removed for reperfusion, and ECA was ligated to close the wound. Sham-operated rats underwent the same surgery except for suture insertion. Rats were maintained on top of a warming pad (RWD, 69003) during the above procedures. The breathing machine was used to monitor the respiration of rats. The rats were returned to a heated cage during the recovery phase with free access to food and water.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[6]
Response Summary	Upregulation of METTL14 inhibited ccRCC cells proliferation and migration in vitro. Overexpression of METTL14 increased the m6A enrichment of Mutated in multiple advanced cancers 1 (PTEN), and promoted Pten expression. METTL14-enhanced Pten mRNA stability was dependent on YTHDF1.
Target Regulation	Up regulation
Responsed Disease	Renal cell carcinoma of kidney	ICD-11: 2C90.0	Disease Info
Pathway Response	PI3K-Akt signaling pathway		hsa04151

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[4]
Response Summary	METTL3/YTHDF2/Mutated in multiple advanced cancers 1 (PTEN) axis exerts a significant role in hypoxia induced PASMCs proliferation, providing a novel therapeutic target for hypoxic pulmonary hypertension.
Target Regulation	Down regulation
Responsed Disease	Pulmonary hypertension due to lung disease or hypoxia	ICD-11: BB01.2	Disease Info
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	Cell apoptosis
In-vitro Model	PASMC cell line (Pulmonary artery smooth muscle cell)
In-vivo Model	10 rats were divided into control and HPH group. In detail, 5 rats of the hypoxia groups were exposed to hypoxia (10%O₂) chamber (AiPu XBS-02B, China) for 4 weeks. In addition, 5 rats of control group were kept under normoxic conditions (21% O₂) for 4 weeks. Rats were housed in standard polypropylene cages under controlled photocycle (12 h light/12 h dark) under 22-25 ℃ temperature.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	In this review, we discuss the specific roles of m6A "writers", "erasers", and "readers" in normal physiology and how their altered expression promotes tumorigenesis. We also describe the potential of exploiting the aberrant expression of these enzymes for cancer diagnosis, prognosis, and the development of novel therapies. The abnormal expression of m6A regulatory enzymes affects m6A abundance and consequently dysregulates the expression of tumor suppressor genes and oncogenes, including MYC, SOCS2, ADAM19, and Mutated in multiple advanced cancers 1 (PTEN).
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Acute myeloid leukaemia [ICD-11: 2A60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, BCL2 and Mutated in multiple advanced cancers 1 (PTEN) mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell differentiation and apoptosis
	Apoptosis (hsa04210)
In-vitro Model	HSPC (Human hematopoietic stem cell)
In-vivo Model	500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.

Malignant haematopoietic neoplasm [ICD-11: 2B33]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	The molecular mechanism underlying the effect of LINC00470 on chronic myelocytic leukaemia by reducing the Mutated in multiple advanced cancers 1 (PTEN) stability via RNA methyltransferase METTL3, thus leading to the inhibition of cell autophagy while promoting chemoresistance in CML.
Responsed Disease	Chronic myeloid leukaemia [ICD-11: 2B33.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KCL-22	Chronic myelogenous leukemia	Homo sapiens	CVCL_2091
In-vivo Model	In the control mice or ADR mice group, the parental or chemo-resistant K562 cells were infected with LV-shCtrl. In the ADR + shLINC00470 group, the chemo-resistant K562 cells were infected with LV- shLINC00470. These cells were injected, respectively, into these 5-week-old mice subcutaneously.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	METTL14 inhibits tumor growth and metastasis of Stomach Adenocarcinoma via stabilization of Mutated in multiple advanced cancers 1 (PTEN) mRNA expression. Therefore, METTL14 is a potential biomarker of prognosis and therapeutic targets for Stomach Adenocarcinoma.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	RGM1	Normal	Rattus norvegicus	CVCL_0499
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	For the purpose of enhancing the overall randomization of the experiment, a random comparison table had been employed. Accordingly, 5-wk-old male nude athymic BALB/c nu/nu mice (Slack, Shanghai, China) were randomly divided into two parts including a control group (NC) and the experimental group METTL14-OE. For developing subcutaneous xeno transplantation model, 5 × 10⁶ HGC-27 cells stably transfected with NC or METTL14 overexpression were subcutaneously incorporated for 5-week-old BALB/c nude mice. The mice experienced euthanasia after 27 days of inoculation and obtained xenografts's mass was obtained. Tumor volume over three days was obtained. To create mouse STAD liver metastasis orthotopic tumor model, 1 × 10⁶ HGC-27 cells under stable transfection with NC or METTL14 overexpression were added to subserosal gastric wall of BALB/c nude mice.

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[8]
Response Summary	ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15-AS1 bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated Mutated in multiple advanced cancers 1 (PTEN) transcription to inactivate AKT pathway.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Epithelial-mesenchymal transition
	Cell apoptosis
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	Bete-elemene exerted the restrictive impacts on the cell growth of lung cancer in vivo and in vitro through targeting METTL3. Bete-elemene contributed to the augmented PTEN expression via suppressing its m6A modification.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	Four-week-old BALB/c nude mice were randomly divided into three groups: (1) vector group, (2) vector + Bete-elemene group, and (3) Bete-elemene + METTL3 group. Nude mice were raised in an SPF level animal house and were free to eat and drink. Mice in the vector group were subcutaneously injected with lung cancer cells transfected with empty vector and did not receive Bete-elemene administration, and this group was implemented as the negative control. Following establishing orthotopic xenografts by using A549 or H1299 cells transfected with empty vector, mice in the vector + Bete-elemene group underwent intraperitoneal injection with Bete-elemene once a day. For the subcutaneous transplanted model, A549 or H1299 cells transfected with METTL3-overexpressing vector were inoculated into mice from the Bete-elemene + METTL3 group. Then, mice were intraperitoneally administrated with Bete-elemene once a day. Three weeks later, all the animals were euthanized with CO2. Xenografts were removed and weighted after mice were euthanatized.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[6]
Response Summary	Upregulation of METTL14 inhibited ccRCC cells proliferation and migration in vitro. Overexpression of METTL14 increased the m6A enrichment of Mutated in multiple advanced cancers 1 (PTEN), and promoted Pten expression. METTL14-enhanced Pten mRNA stability was dependent on YTHDF1.
Responsed Disease	Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator	Methyltransferase-like 14 (METTL14)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Experiment 2 Reporting the m6A-centered Disease Response			[6]
Response Summary	Upregulation of METTL14 inhibited ccRCC cells proliferation and migration in vitro. Overexpression of METTL14 increased the m6A enrichment of Mutated in multiple advanced cancers 1 (PTEN), and promoted Pten expression. METTL14-enhanced Pten mRNA stability was dependent on YTHDF1.
Responsed Disease	Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway		hsa04151

Acute ischemic stroke [ICD-11: 8B11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[9]
Response Summary	YTHDC1 promoted Mutated in multiple advanced cancers 1 (PTEN) mRNA degradation to increase Akt phosphorylation, thus facilitating neuronal survival in particular after ischemia, modulating m6A reader YTHDC1 provide a potential therapeutic target for ischemic stroke.
Responsed Disease	Acute ischemic stroke [ICD-11: 8B11]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	Male SD rats weighing 200-250 g were anesthetized using 4% isoflurane in 70% N₂O and 30% O₂ with a mask. A midline incision was made in the neck, the left external carotid artery (ECA) was carefully exposed and dissected, a monofilament nylon suture with a diameter of about 0.22 mm was inserted from the ECA into the internal carotid artery, and the left middle cerebral artery (MCA) was blocked. After occlusion for 90 minutes, the suture was removed for reperfusion, and ECA was ligated to close the wound. Sham-operated rats underwent the same surgery except for suture insertion. Rats were maintained on top of a warming pad (RWD, 69003) during the above procedures. The breathing machine was used to monitor the respiration of rats. The rats were returned to a heated cage during the recovery phase with free access to food and water.

Pulmonary hypertension [ICD-11: BB01]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[4]
Response Summary	METTL3/YTHDF2/Mutated in multiple advanced cancers 1 (PTEN) axis exerts a significant role in hypoxia induced PASMCs proliferation, providing a novel therapeutic target for hypoxic pulmonary hypertension.
Responsed Disease	Pulmonary hypertension due to lung disease or hypoxia [ICD-11: BB01.2]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	Cell apoptosis
In-vitro Model	PASMC cell line (Pulmonary artery smooth muscle cell)
In-vivo Model	10 rats were divided into control and HPH group. In detail, 5 rats of the hypoxia groups were exposed to hypoxia (10%O₂) chamber (AiPu XBS-02B, China) for 4 weeks. In addition, 5 rats of control group were kept under normoxic conditions (21% O₂) for 4 weeks. Rats were housed in standard polypropylene cages under controlled photocycle (12 h light/12 h dark) under 22-25 ℃ temperature.
Experiment 2 Reporting the m6A-centered Disease Response			[4]
Response Summary	METTL3/YTHDF2/Mutated in multiple advanced cancers 1 (PTEN) axis exerts a significant role in hypoxia induced PASMCs proliferation, providing a novel therapeutic target for hypoxic pulmonary hypertension.
Responsed Disease	Pulmonary hypertension due to lung disease or hypoxia [ICD-11: BB01.2]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)	READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	Cell apoptosis
In-vitro Model	PASMC cell line (Pulmonary artery smooth muscle cell)
In-vivo Model	10 rats were divided into control and HPH group. In detail, 5 rats of the hypoxia groups were exposed to hypoxia (10%O₂) chamber (AiPu XBS-02B, China) for 4 weeks. In addition, 5 rats of control group were kept under normoxic conditions (21% O₂) for 4 weeks. Rats were housed in standard polypropylene cages under controlled photocycle (12 h light/12 h dark) under 22-25 ℃ temperature.

Chronic kidney disease [ICD-11: GB61]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	METTL14-regulated PI3K/Akt signaling pathway via Mutated in multiple advanced cancers 1 (PTEN) affected HDAC5-mediated EMT of renal tubular cells in diabetic kidney disease.
Responsed Disease	Chronic kidney disease [ICD-11: GB61.Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
In-vivo Model	Twenty mice were randomly divided into three groups: normal mice group (N), diabetic mice group (DM), and diabetic mice administrated with TSA group (DM + TSA).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00409		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00410		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00446		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00510		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	hsa-mir-18a
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00411		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00412		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00447		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00511		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	hsa-mir-18a
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00413		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00414		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00448		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00512		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	hsa-mir-18a
Crosstalk relationship	A-to-I → m6A

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00415		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00416		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00449		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00513		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	hsa-mir-18a
Crosstalk relationship	A-to-I → m6A

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02148		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02161		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02174		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02187		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Histone modification

m6A Regulator: YTH domain-containing protein 2 (YTHDC2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03043		Crosstalk Info
Epigenetic Regulator	Polycomb Repressive Complex 2 (PRC2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	m6A → Histone modification
Disease	Skin cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03221		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03384		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03397		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03501		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05287		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info
Crosstalk ID: M6ACROT05364		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Chronic myeloid leukaemia	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05288		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00375)

Mutated in multiple advanced cancers 1 (PTEN)

Adenosine-to-Inosine editing (A-to-I)

In total 28 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004325		Click to Show/Hide the Full List
mod site	chr10:87871594-87871595:+		[18]
Sequence	GCCTCCGCCTCCTGGGTTCAAGCAATTCTCTTGCCGCAGCC
Transcript ID List	ENST00000371953.8; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17372
mod ID: A2ISITE004326		Click to Show/Hide the Full List
mod site	chr10:87871598-87871599:+		[18]
Sequence	CCGCCTCCTGGGTTCAAGCAATTCTCTTGCCGCAGCCTCCC
Transcript ID List	ENST00000371953.8; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17373
mod ID: A2ISITE004327		Click to Show/Hide the Full List
mod site	chr10:87871633-87871634:+		[19]
Sequence	CCTCCCAAGTAGCTGGAATTACAGGCATGCGCCACCACGCC
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17374
mod ID: A2ISITE004328		Click to Show/Hide the Full List
mod site	chr10:87871763-87871764:+		[18]
Sequence	TGCCTGTCTCAGCCTGCTAAAGTGCTGAGATTACAGGCATG
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17375
mod ID: A2ISITE004329		Click to Show/Hide the Full List
mod site	chr10:87873061-87873062:+		[19]
Sequence	CAGCGTTGGCAGATTGCTTGAGTCTGGAAGTTCGAGACCAG
Transcript ID List	ENST00000371953.8; rmsk_3372605; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17376
mod ID: A2ISITE004330		Click to Show/Hide the Full List
mod site	chr10:87873094-87873095:+		[18]
Sequence	GAGACCAGTCTGGGCAACATAGGCAGACCCTGTCTCTACAA
Transcript ID List	ENST00000462694.1; ENST00000371953.8; rmsk_3372605
External Link	RMBase: RNA-editing_site_17377
mod ID: A2ISITE004331		Click to Show/Hide the Full List
mod site	chr10:87873117-87873118:+		[18]
Sequence	CAGACCCTGTCTCTACAAAAAAAAATACAAAAATTAGTCGG
Transcript ID List	rmsk_3372605; ENST00000371953.8; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17378
mod ID: A2ISITE004332		Click to Show/Hide the Full List
mod site	chr10:87873120-87873121:+		[18]
Sequence	ACCCTGTCTCTACAAAAAAAAATACAAAAATTAGTCGGGTG
Transcript ID List	ENST00000371953.8; rmsk_3372605; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17379
mod ID: A2ISITE004333		Click to Show/Hide the Full List
mod site	chr10:87873158-87873159:+		[19]
Sequence	GTGTTATAGTGCGCATTGGTAGTCCCAGCTACTGAGGAGGC
Transcript ID List	rmsk_3372605; ENST00000371953.8; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17380
mod ID: A2ISITE004334		Click to Show/Hide the Full List
mod site	chr10:87873172-87873173:+		[18]
Sequence	ATTGGTAGTCCCAGCTACTGAGGAGGCTGAGGTGGGATCAC
Transcript ID List	ENST00000462694.1; ENST00000371953.8; rmsk_3372605
External Link	RMBase: RNA-editing_site_17381
mod ID: A2ISITE004335		Click to Show/Hide the Full List
mod site	chr10:87873196-87873197:+		[18]
Sequence	GGCTGAGGTGGGATCACCTGAGACTGGGACTTTGAGGCTGC
Transcript ID List	ENST00000371953.8; rmsk_3372605; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17382
mod ID: A2ISITE004336		Click to Show/Hide the Full List
mod site	chr10:87887714-87887715:+		[20]
Sequence	CACAGGCCCAGAGCTCTAGGAGGGCAGAATGGTTTGTGGCT
Transcript ID List	ENST00000371953.8; rmsk_3372624; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17383
mod ID: A2ISITE004337		Click to Show/Hide the Full List
mod site	chr10:87890927-87890928:+		[20]
Sequence	TATTGCCCAGCCTAGCCTCAAACTCCTGGGCTGAAGGAATC
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17384
mod ID: A2ISITE004338		Click to Show/Hide the Full List
mod site	chr10:87890953-87890954:+		[20]
Sequence	TGGGCTGAAGGAATCCACCCATCTCAGCCTCCCAAAGTGCT
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17385
mod ID: A2ISITE004339		Click to Show/Hide the Full List
mod site	chr10:87891199-87891200:+		[21]
Sequence	CTCCTTCTCTTGGAATGAAAAGGTATCCTAGGCTCACCTGT
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17386
mod ID: A2ISITE004340		Click to Show/Hide the Full List
mod site	chr10:87891611-87891612:+		[20]
Sequence	TTGCTTGAGCTCAGGAGTTCAAGACCAACCTGGGCAACATG
Transcript ID List	ENST00000371953.8; ENST00000462694.1; rmsk_3372630
External Link	RMBase: RNA-editing_site_17387
mod ID: A2ISITE004341		Click to Show/Hide the Full List
mod site	chr10:87891629-87891630:+		[20]
Sequence	TCAAGACCAACCTGGGCAACATGATGAAACCTTGTCTTTAC
Transcript ID List	ENST00000371953.8; rmsk_3372630; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17388
mod ID: A2ISITE004342		Click to Show/Hide the Full List
mod site	chr10:87891635-87891636:+		[20]
Sequence	CCAACCTGGGCAACATGATGAAACCTTGTCTTTACAAAAAA
Transcript ID List	ENST00000371953.8; rmsk_3372630; ENST00000462694.1
External Link	RMBase: RNA-editing_site_17389
mod ID: A2ISITE004343		Click to Show/Hide the Full List
mod site	chr10:87891637-87891638:+		[20]
Sequence	AACCTGGGCAACATGATGAAACCTTGTCTTTACAAAAAATT
Transcript ID List	ENST00000371953.8; ENST00000462694.1; rmsk_3372630
External Link	RMBase: RNA-editing_site_17390
mod ID: A2ISITE004344		Click to Show/Hide the Full List
mod site	chr10:87891684-87891685:+		[20]
Sequence	GCATGGTGGCATGTGCTTGTATTCCCAGCTACTCAGGAGGC
Transcript ID List	ENST00000462694.1; ENST00000371953.8; rmsk_3372630
External Link	RMBase: RNA-editing_site_17391
mod ID: A2ISITE004345		Click to Show/Hide the Full List
mod site	chr10:87891694-87891695:+		[20]
Sequence	ATGTGCTTGTATTCCCAGCTACTCAGGAGGCTGAGGTGGGA
Transcript ID List	ENST00000462694.1; ENST00000371953.8; rmsk_3372630
External Link	RMBase: RNA-editing_site_17392
mod ID: A2ISITE004346		Click to Show/Hide the Full List
mod site	chr10:87891698-87891699:+		[20]
Sequence	GCTTGTATTCCCAGCTACTCAGGAGGCTGAGGTGGGAGGAT
Transcript ID List	ENST00000462694.1; ENST00000371953.8; rmsk_3372630
External Link	RMBase: RNA-editing_site_17393
mod ID: A2ISITE004347		Click to Show/Hide the Full List
mod site	chr10:87891720-87891721:+		[20]
Sequence	GAGGCTGAGGTGGGAGGATCACCTGAGCCCAGGAGGTCAAG
Transcript ID List	rmsk_3372630; ENST00000462694.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17394
mod ID: A2ISITE004348		Click to Show/Hide the Full List
mod site	chr10:87907473-87907474:+		[21]
Sequence	GTAATTTTGTTACTGTGATAATATATTTTATATATATGTGT
Transcript ID List	rmsk_3372651; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17395
mod ID: A2ISITE004349		Click to Show/Hide the Full List
mod site	chr10:87909322-87909323:+		[19]
Sequence	TTTATTTACTTATTTTTTGAAATAGCATCTGGCTCTGTTGC
Transcript ID List	ENST00000371953.8
External Link	RMBase: RNA-editing_site_17396
mod ID: A2ISITE004350		Click to Show/Hide the Full List
mod site	chr10:87930808-87930809:+		[21]
Sequence	ACAAGTTTTTAAGCAAATGTATTAGCTCTAATTGCATACAC
Transcript ID List	ENST00000498703.1; ENST00000371953.8
External Link	RMBase: RNA-editing_site_17397
mod ID: A2ISITE004351		Click to Show/Hide the Full List
mod site	chr10:87940181-87940182:+		[18]
Sequence	GGTTGGGCACGGTGGCTCATACCTATATTCCCAGCACTTTG
Transcript ID List	ENST00000371953.8; rmsk_3372703
External Link	RMBase: RNA-editing_site_17398
mod ID: A2ISITE004352		Click to Show/Hide the Full List
mod site	chr10:87947839-87947840:+		[21]
Sequence	GCGTAGGTTGCAGTGAGCCGAGATCGTGCCACTGCACTCCA
Transcript ID List	ENST00000371953.8; rmsk_3372713
External Link	RMBase: RNA-editing_site_17399

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004732		Click to Show/Hide the Full List
mod site	chr10:87864050-87864051:+		[22]
Sequence	ATTTCCAGGGCTGGGAACGCCGGAGAGTTGGTCTCTCCCCT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m5C_site_5620

N6-methyladenosine (m6A)

In total 50 m6A sequence/site(s) in this target gene
mod ID: M6ASITE001224		Click to Show/Hide the Full List
mod site	chr10:87864117-87864118:+		[1]
Sequence	GGCGGCTGGCACATCCAGGGACCCGGGCCGGTTTTAAACCT
Motif Score	3.622404762
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109375
mod ID: M6ASITE001225		Click to Show/Hide the Full List
mod site	chr10:87864467-87864468:+		[23]
Sequence	CTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000371953.8; ENST00000487939.1; ENST00000462694.1
External Link	RMBase: m6A_site_109376
mod ID: M6ASITE001226		Click to Show/Hide the Full List
mod site	chr10:87864503-87864504:+		[23]
Sequence	CAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000462694.1; ENST00000487939.1; ENST00000371953.8; ENST00000618586.1
External Link	RMBase: m6A_site_109377
mod ID: M6ASITE001227		Click to Show/Hide the Full List
mod site	chr10:87864544-87864545:+		[24]
Sequence	ATGGATTCGACTTAGACTTGACCTGTATCCATTTCTGCGGC
Motif Score	2.839113095
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000487939.1; ENST00000371953.8; ENST00000462694.1; ENST00000618586.1
External Link	RMBase: m6A_site_109378
mod ID: M6ASITE001228		Click to Show/Hide the Full List
mod site	chr10:87876527-87876528:+		[1]
Sequence	TAAGAATTTAGTATTACAGGACTCAATCAGGGAACTGATTT
Motif Score	4.065041667
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: m6A_site_109379
mod ID: M6ASITE001229		Click to Show/Hide the Full List
mod site	chr10:87894036-87894037:+		[23]
Sequence	GTACTCAGATATTTATCCAAACATTATTGCTATGGGATTTC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000462694.1; ENST00000371953.8
External Link	RMBase: m6A_site_109380
mod ID: M6ASITE001230		Click to Show/Hide the Full List
mod site	chr10:87894087-87894088:+		[23]
Sequence	ACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000462694.1
External Link	RMBase: m6A_site_109381
mod ID: M6ASITE001231		Click to Show/Hide the Full List
mod site	chr10:87925541-87925542:+		[23]
Sequence	TTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000498703.1
External Link	RMBase: m6A_site_109382
mod ID: M6ASITE001232		Click to Show/Hide the Full List
mod site	chr10:87933105-87933106:+		[23]
Sequence	CCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000498703.1
External Link	RMBase: m6A_site_109383
mod ID: M6ASITE001233		Click to Show/Hide the Full List
mod site	chr10:87933149-87933150:+		[1]
Sequence	GTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCA
Motif Score	3.373380952
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000371953.8; ENST00000498703.1
External Link	RMBase: m6A_site_109384
mod ID: M6ASITE001234		Click to Show/Hide the Full List
mod site	chr10:87933178-87933179:+		[23]
Sequence	ATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498703.1; ENST00000371953.8
External Link	RMBase: m6A_site_109385
mod ID: M6ASITE001235		Click to Show/Hide the Full List
mod site	chr10:87933202-87933203:+		[23]
Sequence	CGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498703.1; ENST00000371953.8
External Link	RMBase: m6A_site_109386
mod ID: M6ASITE001236		Click to Show/Hide the Full List
mod site	chr10:87933243-87933244:+		[23]
Sequence	TGGGGAAGTAAGGACCAGAGACAAAAAGGTAAGTTATTTTT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000498703.1
External Link	RMBase: m6A_site_109387
mod ID: M6ASITE001237		Click to Show/Hide the Full List
mod site	chr10:87945821-87945822:+		[25]
Sequence	CTGGAAACTTTGGTTTTGGGACCCAGGAACACATTGATCTG
Motif Score	3.622404762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371953.8; ENST00000395256.2
External Link	RMBase: m6A_site_109388
mod ID: M6ASITE001238		Click to Show/Hide the Full List
mod site	chr10:87952211-87952212:+		[23]
Sequence	ACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000472832.2; ENST00000371953.8
External Link	RMBase: m6A_site_109389
mod ID: M6ASITE001239		Click to Show/Hide the Full List
mod site	chr10:87957911-87957912:+		[23]
Sequence	ATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000472832.2
External Link	RMBase: m6A_site_109390
mod ID: M6ASITE001240		Click to Show/Hide the Full List
mod site	chr10:87957924-87957925:+		[23]
Sequence	AGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000472832.2; ENST00000371953.8
External Link	RMBase: m6A_site_109391
mod ID: M6ASITE001241		Click to Show/Hide the Full List
mod site	chr10:87957993-87957994:+		[23]
Sequence	TATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000472832.2; ENST00000371953.8
External Link	RMBase: m6A_site_109392
mod ID: M6ASITE001242		Click to Show/Hide the Full List
mod site	chr10:87960920-87960921:+		[23]
Sequence	TGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000472832.2
External Link	RMBase: m6A_site_109393
mod ID: M6ASITE001243		Click to Show/Hide the Full List
mod site	chr10:87961026-87961027:+		[23]
Sequence	TATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8; ENST00000472832.2
External Link	RMBase: m6A_site_109394
mod ID: M6ASITE001244		Click to Show/Hide the Full List
mod site	chr10:87961083-87961084:+		[23]
Sequence	TCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000472832.2; ENST00000371953.8
External Link	RMBase: m6A_site_109395
mod ID: M6ASITE001245		Click to Show/Hide the Full List
mod site	chr10:87965301-87965302:+		[23]
Sequence	TCTAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109396
mod ID: M6ASITE001246		Click to Show/Hide the Full List
mod site	chr10:87965355-87965356:+		[23]
Sequence	CTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAAT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109397
mod ID: M6ASITE001247		Click to Show/Hide the Full List
mod site	chr10:87965497-87965498:+		[23]
Sequence	TTTTTATCAAGAGGGATAAAACACCATGAAAATAAACTTGA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109398
mod ID: M6ASITE001248		Click to Show/Hide the Full List
mod site	chr10:87965512-87965513:+		[24]
Sequence	ATAAAACACCATGAAAATAAACTTGAATAAACTGAAAATGG
Motif Score	2.627720238
Cell/Tissue List	CD8T; A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109399
mod ID: M6ASITE001249		Click to Show/Hide the Full List
mod site	chr10:87965522-87965523:+		[1]
Sequence	ATGAAAATAAACTTGAATAAACTGAAAATGGACCTTTTTTT
Motif Score	2.627720238
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109400
mod ID: M6ASITE001250		Click to Show/Hide the Full List
mod site	chr10:87965559-87965560:+		[23]
Sequence	TTTTTTTTAATGGCAATAGGACATTGTGTCAGATTACCAGT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109401
mod ID: M6ASITE001251		Click to Show/Hide the Full List
mod site	chr10:87965642-87965643:+		[23]
Sequence	TATACATCCACAGGGTTTTGACACTTGTTGTCCAGTTGAAA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109402
mod ID: M6ASITE001252		Click to Show/Hide the Full List
mod site	chr10:87965710-87965711:+		[23]
Sequence	TACCTTTTTGTGTCAAAAGGACATTTAAAATTCAATTAGGA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109403
mod ID: M6ASITE001253		Click to Show/Hide the Full List
mod site	chr10:87965897-87965898:+		[26]
Sequence	ACCCCTTTGCACTTGTGGCAACAGATAAGTTTGCAGTTGGC
Motif Score	2.173910714
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109404
mod ID: M6ASITE001254		Click to Show/Hide the Full List
mod site	chr10:87965945-87965946:+		[23]
Sequence	GGTTTCCGAAGGGTTTTGCTACATTCTAATGCATGTATTCG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109405
mod ID: M6ASITE001255		Click to Show/Hide the Full List
mod site	chr10:87966585-87966586:+		[26]
Sequence	AATTTTCAATTTGAGATTCTACAGTAAGCGTTTTTTTTCTT
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109406
mod ID: M6ASITE001256		Click to Show/Hide the Full List
mod site	chr10:87966836-87966837:+		[25]
Sequence	ATGCTGCACACAAAAAAAAGACATTTGATTTTTCAGTAGAA
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109407
mod ID: M6ASITE001257		Click to Show/Hide the Full List
mod site	chr10:87966865-87966866:+		[25]
Sequence	TTTTCAGTAGAAATTGTCCTACATGTGCTTTATTGATTTGC
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109408
mod ID: M6ASITE001258		Click to Show/Hide the Full List
mod site	chr10:87967059-87967060:+		[23]
Sequence	CATACGATTTTAAGCGGAGTACAACTACTATTGTAAAGCTA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109409
mod ID: M6ASITE001259		Click to Show/Hide the Full List
mod site	chr10:87967150-87967151:+		[23]
Sequence	CAAATTATACCTTCACCTTGACATTTGAATATCCAGCCATT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109410
mod ID: M6ASITE001260		Click to Show/Hide the Full List
mod site	chr10:87967257-87967258:+		[23]
Sequence	TGGTCTGACCTAGTTAATTTACAAATACAGATTGAATAGGA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109411
mod ID: M6ASITE001261		Click to Show/Hide the Full List
mod site	chr10:87967502-87967503:+		[23]
Sequence	TTAAATTGGTAAAGTTAGAGACAACTATTCTAACACCTCAC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109412
mod ID: M6ASITE001262		Click to Show/Hide the Full List
mod site	chr10:87967514-87967515:+		[23]
Sequence	AGTTAGAGACAACTATTCTAACACCTCACCATTGAAATTTA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109413
mod ID: M6ASITE001263		Click to Show/Hide the Full List
mod site	chr10:87967630-87967631:+		[23]
Sequence	TATAAATATTGTTCTTTGTTACAATTTCGGGCACCGCATAT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109414
mod ID: M6ASITE001264		Click to Show/Hide the Full List
mod site	chr10:87967681-87967682:+		[23]
Sequence	CTTTATTGTTCCAATATGTAACATGGAGGGCCAGGTCATAA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109415
mod ID: M6ASITE001265		Click to Show/Hide the Full List
mod site	chr10:87967708-87967709:+		[23]
Sequence	GGGCCAGGTCATAAATAATGACATTATAATGGGCTTTTGCA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109416
mod ID: M6ASITE001266		Click to Show/Hide the Full List
mod site	chr10:87967814-87967815:+		[23]
Sequence	GTTTTTGAGAAGCCTTGCTTACATTTTATGGTGTAGTCATT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109417
mod ID: M6ASITE001267		Click to Show/Hide the Full List
mod site	chr10:87967946-87967947:+		[25]
Sequence	ATTTGACAAGAATTGCTATGACTGAAAGGTTTTCGAGTCCT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109418
mod ID: M6ASITE001268		Click to Show/Hide the Full List
mod site	chr10:87968077-87968078:+		[26]
Sequence	TTTTGGATGTGCAGCAGCTTACATGTCTGAAGTTACTTGAA
Motif Score	2.07285119
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109419
mod ID: M6ASITE001269		Click to Show/Hide the Full List
mod site	chr10:87968229-87968230:+		[26]
Sequence	TCACCATTCTTTGCTGTGGCACAGGTTATAAACTTAAGTGG
Motif Score	2.830589286
Cell/Tissue List	brain; kidney; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109420
mod ID: M6ASITE001270		Click to Show/Hide the Full List
mod site	chr10:87968240-87968241:+		[25]
Sequence	TGCTGTGGCACAGGTTATAAACTTAAGTGGAGTTTACCGGC
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109421
mod ID: M6ASITE001271		Click to Show/Hide the Full List
mod site	chr10:87968711-87968712:+		[23]
Sequence	ATTTGTTATTGTGTTTGTTAACAACCCTTTATCTCTTAGTG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371953.8
External Link	RMBase: m6A_site_109422
mod ID: M6ASITE094741		Click to Show/Hide the Full List
mod site	KQ090021.1:79940-79941:+		[27]
Sequence	CGGCGGCGGCACATCCAGGGACCCGGGCCGGTTTTAAACCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; H1A; H1B; A549; LCLs; MM6; Jurkat; HEK293A-TOA; TREX; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000645317.1; ENST00000644628.1
External Link	RMBase: m6A_site_881922
mod ID: M6ASITE094742		Click to Show/Hide the Full List
mod site	KQ090021.1:79957-79958:+		[27]
Sequence	GGGACCCGGGCCGGTTTTAAACCTCCCGTCCGCCGCCGCCG
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; H1A; H1B; A549; LCLs; MM6; Jurkat; HEK293A-TOA; TREX; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000644628.1; ENST00000645317.1
External Link	RMBase: m6A_site_881923

Ref 1	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 2	Dysregulation of LINC00470 and METTL3 promotes chemoresistance and suppresses autophagy of chronic myelocytic leukaemia cells. J Cell Mol Med. 2021 May;25(9):4248-4259. doi: 10.1111/jcmm.16478. Epub 2021 Mar 21.
Ref 3	Beta-Elemene Restrains PTEN mRNA Degradation to Restrain the Growth of Lung Cancer Cells via METTL3-Mediated N(6) Methyladenosine Modification. J Oncol. 2022 Jan 12;2022:3472745. doi: 10.1155/2022/3472745. eCollection 2022.
Ref 4	The m(6)A methyltransferase METTL3 promotes hypoxic pulmonary arterial hypertension. Life Sci. 2021 Jun 1;274:119366. doi: 10.1016/j.lfs.2021.119366. Epub 2021 Mar 16.
Ref 5	The m6A Methyltransferase METTL14-Mediated N6-Methyladenosine Modification of PTEN mRNA Inhibits Tumor Growth and Metastasis in Stomach Adenocarcinoma. Front Oncol. 2021 Aug 12;11:699749. doi: 10.3389/fonc.2021.699749. eCollection 2021.
Ref 6	METTL14-mediated N6-methyladenosine modification of Pten mRNA inhibits tumour progression in clear-cell renal cell carcinoma. Br J Cancer. 2022 Jul;127(1):30-42. doi: 10.1038/s41416-022-01757-y. Epub 2022 Mar 5.
Ref 7	METTL14-regulated PI3K/Akt signaling pathway via PTEN affects HDAC5-mediated epithelial-mesenchymal transition of renal tubular cells in diabetic kidney disease. Cell Death Dis. 2021 Jan 4;12(1):32. doi: 10.1038/s41419-020-03312-0.
Ref 8	ALKBH5-mediated m(6)A demethylation of KCNK15-AS1 inhibits pancreatic cancer progression via regulating KCNK15 and PTEN/AKT signaling. Cell Death Dis. 2021 Dec 1;12(12):1121. doi: 10.1038/s41419-021-04401-4.
Ref 9	YTHDC1 mitigates ischemic stroke by promoting Akt phosphorylation through destabilizing PTEN mRNA. Cell Death Dis. 2020 Nov 13;11(11):977. doi: 10.1038/s41419-020-03186-2.
Ref 10	Chronic glucose-lowering effects of rosiglitazone and bis(ethylmaltolato) oxovanadium(IV) in ZDF rats. Canadian Journal of Physiology and Pharmacology. 12/2003; 81(11):1049-55.
Ref 11	Brain and Testis Accumulation of Regorafenib is Restricted by Breast Cancer Resistance Protein (BCRP/ABCG2) and P-glycoprotein (P-GP/ABCB1). Pharm Res. 2015 Jul;32(7):2205-16. doi: 10.1007/s11095-014-1609-7. Epub 2015 Jan 8.
Ref 12	Folate transporter expression decreases in the human placenta throughout pregnancy and in pre-eclampsia. Pregnancy Hypertens. 2012 Apr;2(2):123-31. doi: 10.1016/j.preghy.2011.12.001. Epub 2012 Jan 4.
Ref 13	LncRNA LINC00470 promotes the degradation of PTEN mRNA to facilitate malignant behavior in gastric cancer cells. Biochem Biophys Res Commun. 2020 Jan 22;521(4):887-893. doi: 10.1016/j.bbrc.2019.11.016. Epub 2019 Nov 8.
Ref 14	Glutathione transport is a unique function of the ATP-binding cassette protein ABCG2. J Biol Chem. 2010 May 28;285(22):16582-7. doi: 10.1074/jbc.M109.090506. Epub 2010 Mar 23.
Ref 15	Effects of arachidonic acid, prostaglandins, retinol, retinoic acid and cholecalciferol on xenobiotic oxidations catalysed by human cytochrome P450 enzymes. Xenobiotica. 1999 Mar;29(3):231-41. doi: 10.1080/004982599238632.
Ref 16	Anti-IP-10 antibody (BMS-936557) for ulcerative colitis: a phase II randomised study. Gut. 2014 Mar;63(3):442-50. doi: 10.1136/gutjnl-2012-303424. Epub 2013 Mar 5.
Ref 17	DOI: 10.1038/scibx.2012.669
Ref 18	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 19	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 20	Widespread RNA editing of embedded alu elements in the human transcriptome. Genome Res. 2004 Sep;14(9):1719-25. doi: 10.1101/gr.2855504.
Ref 21	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 22	Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):6784-6789. doi: 10.1073/pnas.1817334116. Epub 2019 Mar 14.
Ref 23	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 24	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 25	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 26	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 27	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map