m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00399)

Target Name	Zinc finger protein SNAI1 (SNAI1)
Synonyms	Protein snail homolog 1; Protein sna; SNAH Click to Show/Hide
Gene Name	SNAI1
Chromosomal Location	20q13.13
Family	snail C2H2-type zinc-finger protein family
Function	Involved in induction of the epithelial to mesenchymal transition (EMT), formation and maintenance of embryonic mesoderm, growth arrest, survival and cell migration. Binds to 3 E-boxes of the E-cadherin/CDH1 gene promoter and to the promoters of CLDN7 and KRT8 and, in association with histone demethylase KDM1A which it recruits to the promoters, causes a decrease in dimethylated H3K4 levels and represses transcription. The N-terminal SNAG domain competes with histone H3 for the same binding site on the histone demethylase complex formed by KDM1A and RCOR1, and thereby inhibits demethylation of histone H3 at 'Lys-4' (in vitro). During EMT, involved with LOXL2 in negatively regulating pericentromeric heterochromatin transcription (By similarity). SNAI1 recruits LOXL2 to pericentromeric regions to oxidize histone H3 and repress transcription which leads to release of heterochromatin component CBX5/HP1A, enabling chromatin reorganization and acquisition of mesenchymal traits (By similarity). Associates with EGR1 and SP1 to mediate tetradecanoyl phorbol acetate (TPA)-induced up-regulation of CDKN2B, possibly by binding to the CDKN2B promoter region 5'-TCACA-3. In addition, may also activate the CDKN2B promoter by itself. Click to Show/Hide
Gene ID	6615
Uniprot ID	SNAI1_HUMAN
HGNC ID	HGNC:11128
KEGG ID	hsa:6615

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SNAI1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -7.78E-01 p-value: 5.01E-07
More Results	Click to View More RNA-seq Results

In total 5 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The expression of TGFbeta1 was up-regulated, while self-stimulated expression of TGFbeta1 was suppressed in METTL3Mut/- cells. m6A performed multi-functional roles in TGFbeta1 expression and EMT modulation, suggesting the critical roles of m6A in cancer progression regulation. Zinc finger protein SNAI1 (SNAI1), which was down-regulated in Mettl3Mut/- cells, was a key factor responding to TGF-Beta-1-induced EMT.
Target Regulation	Up regulation
Responsed Disease	Solid tumour/cancer		ICD-11: 2A00-2F9Z	Disease Info
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Overexpression of Zinc finger protein SNAI1 (SNAI1) partially reversed the regulatory effects of METTL3 on EMT-related gene expressions and metastatic abilities in nasopharyngeal carcinoma. Knockdown of METTL3 decreased the enrichment abundance of Snail in anti-IGF2BP2.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 acts as a critical m6A methyltransferase capable of facilitating colorectal cancer(CRC) progression, and revealed a novel mechanism by which METTL3 promotes CRC cell proliferation and invasion via stabilizing Zinc finger protein SNAI1 (SNAI1) mRNA in an m6A-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Adherens junction			hsa04520
Cell Process	Cell proliferation
Cell Process	Cell invasion
In-vitro Model	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HIEC-6	Normal	Homo sapiens	CVCL_6C21
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HEK293T	Normal	Homo sapiens	CVCL_0063
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	The upregulation of METTL3 and YTHDF1 act as adverse prognosis factors for overall survival (OS) rate of liver cancer patients. m6A-sequencing and functional studies confirm that Zinc finger protein SNAI1 (SNAI1), a key transcription factor of EMT, is involved in m6A-regulated EMT.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Epithelial-mesenchymal transition
	cell migration
	invasion
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	All animal experiments complied with Zhongshan School of Medicine Policy on Care and Use of Laboratory Animals. For subcutaneous transplanted model, sh-control and sh-METTL3 Huh7 cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 uL of PBS + 200 uL Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice to investigate tumor growth.
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	SUMOylation of Mettl3 was found to regulate hepatocellular carcinoma progression via controlling Zinc finger protein SNAI1 (SNAI1) mRNA homeostasis in an m6A methyltransferase activity-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	1×10⁶/mouse cells were suspended in 50 uL of serum-free DMEM and subcutaneously injected into the flank of each mouse. Tumor diameters and volume (length × width² × 0.5236) were calculated every other day using calipers.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	CAG cell line	Homo sapiens
Treatment: shALKBH5 CAG cells Control: shNC CAG cells		GSE180214
Regulation		logFC: 1.03E+00 p-value: 7.72E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	ALKBH5 overexpression incurred a significant reduction in iron-regulatory protein IRP2 and the modulator of epithelial-mesenchymal transition (EMT) Zinc finger protein SNAI1 (SNAI1). Owing to FBXL5-mediated degradation, ALKBH5 overexpression incurred a significant reduction in iron-regulatory protein IRP2 and the modulator of epithelial-mesenchymal transition (EMT) SNAI1. ALKBH5 in protecting against PDAC through modulating regulators of iron metabolism and underscore the multifaceted role of m6A in pancreatic cancer.
Target Regulation	Down regulation
Responsed Disease	Pancreatic cancer		ICD-11: 2C10	Disease Info
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[9]
Response Summary	HNRNPA2B1, as an m6A reader, is critical in OSCC development. Its expression is significantly associated with the prognosis of Oral Squamous Cell Carcinoma(OSCC). m6A acts as a proto-oncogene that promotes the OSCC proliferation, migration, and invasion through the EMT progression via the LINE-1/TGF-beta1/Zinc finger protein SNAI1 (SNAI1)/Smad2 signaling pathway.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma		ICD-11: 2B6E.0	Disease Info
Pathway Response	TGF-beta signaling pathway			hsa04350
In-vitro Model	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
In-vitro Model	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Overexpression of Zinc finger protein SNAI1 (SNAI1) partially reversed the regulatory effects of METTL3 on EMT-related gene expressions and metastatic abilities in nasopharyngeal carcinoma. Knockdown of METTL3 decreased the enrichment abundance of Snail in anti-IGF2BP2.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	KIAA1429 could significantly promote the migration and invasion of breast cancer cells. KIAA1429 could bind to the motif in the 3' UTR of SMC1A mRNA directly and enhance SMC1A mRNA stability. In conclusion, the study revealed a novel mechanism of the KIAA1429/SMC1A/Zinc finger protein SNAI1 (SNAI1) axis in the regulation of metastasis of breast cancer.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	SUM1315MO2	Invasive breast carcinoma of no special type	Homo sapiens	CVCL_5589
In-vivo Model	For the mouse lung metastasis model, SUM-1315 cells (2 × 10⁶/0.2 mL) expressing NC, shKIAA1429, SNAIL, or shKIAA1429+SNAIL were injected into the nude mice through the tail vein.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	The upregulation of METTL3 and YTHDF1 act as adverse prognosis factors for overall survival (OS) rate of liver cancer patients. m6A-sequencing and functional studies confirm that Zinc finger protein SNAI1 (SNAI1), a key transcription factor of EMT, is involved in m6A-regulated EMT.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	All animal experiments complied with Zhongshan School of Medicine Policy on Care and Use of Laboratory Animals. For subcutaneous transplanted model, sh-control and sh-METTL3 Huh7 cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 uL of PBS + 200 uL Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice to investigate tumor growth.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The expression of TGFbeta1 was up-regulated, while self-stimulated expression of TGFbeta1 was suppressed in METTL3Mut/- cells. m6A performed multi-functional roles in TGFbeta1 expression and EMT modulation, suggesting the critical roles of m6A in cancer progression regulation. Zinc finger protein SNAI1 (SNAI1), which was down-regulated in Mettl3Mut/- cells, was a key factor responding to TGF-Beta-1-induced EMT.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Overexpression of Zinc finger protein SNAI1 (SNAI1) partially reversed the regulatory effects of METTL3 on EMT-related gene expressions and metastatic abilities in nasopharyngeal carcinoma. Knockdown of METTL3 decreased the enrichment abundance of Snail in anti-IGF2BP2.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	Overexpression of Zinc finger protein SNAI1 (SNAI1) partially reversed the regulatory effects of METTL3 on EMT-related gene expressions and metastatic abilities in nasopharyngeal carcinoma. Knockdown of METTL3 decreased the enrichment abundance of Snail in anti-IGF2BP2.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[9]
Response Summary	HNRNPA2B1, as an m6A reader, is critical in OSCC development. Its expression is significantly associated with the prognosis of Oral Squamous Cell Carcinoma(OSCC). m6A acts as a proto-oncogene that promotes the OSCC proliferation, migration, and invasion through the EMT progression via the LINE-1/TGF-beta1/Zinc finger protein SNAI1 (SNAI1)/Smad2 signaling pathway.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	TGF-beta signaling pathway			hsa04350
In-vitro Model	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
In-vitro Model	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 acts as a critical m6A methyltransferase capable of facilitating colorectal cancer(CRC) progression, and revealed a novel mechanism by which METTL3 promotes CRC cell proliferation and invasion via stabilizing Zinc finger protein SNAI1 (SNAI1) mRNA in an m6A-dependent manner.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Adherens junction			hsa04520
Cell Process	Cell proliferation
Cell Process	Cell invasion
In-vitro Model	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HIEC-6	Normal	Homo sapiens	CVCL_6C21
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HEK293T	Normal	Homo sapiens	CVCL_0063

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	ALKBH5 overexpression incurred a significant reduction in iron-regulatory protein IRP2 and the modulator of epithelial-mesenchymal transition (EMT) Zinc finger protein SNAI1 (SNAI1). Owing to FBXL5-mediated degradation, ALKBH5 overexpression incurred a significant reduction in iron-regulatory protein IRP2 and the modulator of epithelial-mesenchymal transition (EMT) SNAI1. ALKBH5 in protecting against PDAC through modulating regulators of iron metabolism and underscore the multifaceted role of m6A in pancreatic cancer.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428

Liver cancer [ICD-11: 2C12]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	The upregulation of METTL3 and YTHDF1 act as adverse prognosis factors for overall survival (OS) rate of liver cancer patients. m6A-sequencing and functional studies confirm that Zinc finger protein SNAI1 (SNAI1), a key transcription factor of EMT, is involved in m6A-regulated EMT.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
	cell migration
	invasion
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	All animal experiments complied with Zhongshan School of Medicine Policy on Care and Use of Laboratory Animals. For subcutaneous transplanted model, sh-control and sh-METTL3 Huh7 cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 uL of PBS + 200 uL Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice to investigate tumor growth.
Experiment 2 Reporting the m6A-centered Disease Response				[5]
Response Summary	SUMOylation of Mettl3 was found to regulate hepatocellular carcinoma progression via controlling Zinc finger protein SNAI1 (SNAI1) mRNA homeostasis in an m6A methyltransferase activity-dependent manner.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	1×10⁶/mouse cells were suspended in 50 uL of serum-free DMEM and subcutaneously injected into the flank of each mouse. Tumor diameters and volume (length × width² × 0.5236) were calculated every other day using calipers.
Experiment 3 Reporting the m6A-centered Disease Response				[4]
Response Summary	The upregulation of METTL3 and YTHDF1 act as adverse prognosis factors for overall survival (OS) rate of liver cancer patients. m6A-sequencing and functional studies confirm that Zinc finger protein SNAI1 (SNAI1), a key transcription factor of EMT, is involved in m6A-regulated EMT.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	All animal experiments complied with Zhongshan School of Medicine Policy on Care and Use of Laboratory Animals. For subcutaneous transplanted model, sh-control and sh-METTL3 Huh7 cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 uL of PBS + 200 uL Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice to investigate tumor growth.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[12]
Response Summary	KIAA1429 could significantly promote the migration and invasion of breast cancer cells. KIAA1429 could bind to the motif in the 3' UTR of SMC1A mRNA directly and enhance SMC1A mRNA stability. In conclusion, the study revealed a novel mechanism of the KIAA1429/SMC1A/Zinc finger protein SNAI1 (SNAI1) axis in the regulation of metastasis of breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Protein virilizer homolog (VIRMA)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	SUM1315MO2	Invasive breast carcinoma of no special type	Homo sapiens	CVCL_5589
In-vivo Model	For the mouse lung metastasis model, SUM-1315 cells (2 × 10⁶/0.2 mL) expressing NC, shKIAA1429, SNAIL, or shKIAA1429+SNAIL were injected into the nude mice through the tail vein.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00483		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	hsa-mir-22
Crosstalk relationship	m6Am → m6A

m6A Regulator: Zinc finger CCCH domain-containing protein 13 (ZC3H13)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00484		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	hsa-mir-22
Crosstalk relationship	m6Am → m6A

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00485		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	hsa-mir-22
Crosstalk relationship	m6Am → m6A

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00486		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	hsa-mir-22
Crosstalk relationship	m6Am → m6A

m6A Regulator: Leucine-rich PPR motif-containing protein, mitochondrial (LRPPRC)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00487		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	hsa-mir-22
Crosstalk relationship	m6Am → m6A

Histone modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03159		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 4C (KDM4C)
Regulated Target	Histone H3 lysine 9 trimethylation (H3K9me3)
Crosstalk relationship	Histone modification → m6A
Disease	Hepatic fibrosis/cirrhosis	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03572		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03617		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05201		Crosstalk Info
Epigenetic Regulator	GATA6 antisense RNA 1 (head to head) (GATA6-AS1)
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Pancreatic cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05230		Crosstalk Info
Epigenetic Regulator	hsa-miR-145-5p
Regulated Target	YTH domain-containing family protein 1 (YTHDF1)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00399)

Zinc finger protein SNAI1 (SNAI1)

N6-methyladenosine (m6A)

In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE053514		Click to Show/Hide the Full List
mod site	chr20:49983129-49983130:+		[16]
Sequence	TAACTACAGCGAGCTGCAGGACTCTAATCCAGGTGCGTTGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536116
mod ID: M6ASITE053515		Click to Show/Hide the Full List
mod site	chr20:49983925-49983926:+		[16]
Sequence	GCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536117
mod ID: M6ASITE053516		Click to Show/Hide the Full List
mod site	chr20:49984024-49984025:+		[16]
Sequence	GACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; peripheral-blood; GSC-11; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536118
mod ID: M6ASITE053517		Click to Show/Hide the Full List
mod site	chr20:49987945-49987946:+		[16]
Sequence	ACCTGCGGGCCCACCTCCAGACCCACTCAGATGTCAAGAAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536119
mod ID: M6ASITE053518		Click to Show/Hide the Full List
mod site	chr20:49987990-49987991:+		[16]
Sequence	AGTGCCAGGCGTGTGCTCGGACCTTCTCCCGAATGTCCCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; U2OS
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536120
mod ID: M6ASITE053519		Click to Show/Hide the Full List
mod site	chr20:49988126-49988127:+		[16]
Sequence	CCCCAGCTCCAGCAGGAAGGACCCCACATCCTTCTCACTGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; U2OS; hESCs; HEK293A-TOA; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536121
mod ID: M6ASITE053520		Click to Show/Hide the Full List
mod site	chr20:49988198-49988199:+		[16]
Sequence	GGCCACATCAGCCCCACAGGACTTTGATGAAGACCATTTTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; H1A; HEK293A-TOA; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536122
mod ID: M6ASITE053521		Click to Show/Hide the Full List
mod site	chr20:49988210-49988211:+		[16]
Sequence	CCCACAGGACTTTGATGAAGACCATTTTCTGGTTCTGTGTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; H1A; HEK293A-TOA; MSC; TIME; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536123
mod ID: M6ASITE053522		Click to Show/Hide the Full List
mod site	chr20:49988381-49988382:+		[16]
Sequence	CAGCTGCTTTGAGCTACAGGACAAAGGCTGACAGACTCACT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536124
mod ID: M6ASITE053523		Click to Show/Hide the Full List
mod site	chr20:49988395-49988396:+		[16]
Sequence	TACAGGACAAAGGCTGACAGACTCACTGGGAAGCTCCCACC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536125
mod ID: M6ASITE053524		Click to Show/Hide the Full List
mod site	chr20:49988427-49988428:+		[16]
Sequence	GCTCCCACCCCACTCAGGGGACCCCACTCCCCTCACACACA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536126
mod ID: M6ASITE053525		Click to Show/Hide the Full List
mod site	chr20:49988462-49988463:+		[16]
Sequence	CACACACCCCCCCACAAGGAACCCTCAGGCCACCCTCCACG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; MM6; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536127
mod ID: M6ASITE053526		Click to Show/Hide the Full List
mod site	chr20:49988550-49988551:+		[16]
Sequence	GCCTGCGGAGGCGGTGGCAGACTAGAGTCTGAGATGCCCCG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; Jurkat; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536128
mod ID: M6ASITE053527		Click to Show/Hide the Full List
mod site	chr20:49988650-49988651:+		[17]
Sequence	TTAACAATGTCTGAAAAGGGACTGTGAGTAATGGCTGTCAC
Motif Score	4.065041667
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536129
mod ID: M6ASITE053528		Click to Show/Hide the Full List
mod site	chr20:49988722-49988723:+		[17]
Sequence	TGACCGATGTGTCTCCCAGAACTATTCTGGGGGCCCGACAG
Motif Score	3.373380952
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000244050.3
External Link	RMBase: m6A_site_536130

Ref 1	N6-Methyladenosine Regulates the Expression and Secretion of TGFBeta1 to Affect the Epithelial-Mesenchymal Transition of Cancer Cells. Cells. 2020 Jan 25;9(2):296. doi: 10.3390/cells9020296.
Ref 2	The m6A methyltransferase METTL3 aggravates the progression of nasopharyngeal carcinoma through inducing EMT by m6A-modified Snail mRNA. Minerva Med. 2022 Apr;113(2):309-314. doi: 10.23736/S0026-4806.20.06653-7. Epub 2020 Jun 5.
Ref 3	RNA m(6)A methyltransferase METTL3 promotes colorectal cancer cell proliferation and invasion by regulating Snail expression. Oncol Lett. 2021 Oct;22(4):711. doi: 10.3892/ol.2021.12972. Epub 2021 Aug 5.
Ref 4	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.
Ref 5	SUMO1 modification of methyltransferase-like 3 promotes tumor progression via regulating Snail mRNA homeostasis in hepatocellular carcinoma. Theranostics. 2020 Apr 27;10(13):5671-5686. doi: 10.7150/thno.42539. eCollection 2020.
Ref 6	RNA m(6)A Demethylase ALKBH5 Protects Against Pancreatic Ductal Adenocarcinoma via Targeting Regulators of Iron Metabolism. Front Cell Dev Biol. 2021 Oct 18;9:724282. doi: 10.3389/fcell.2021.724282. eCollection 2021.
Ref 7	National Cancer Institute Drug Dictionary (drug name CC 90002).
Ref 8	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 9	HNRNPA2B1, as a m(6)A Reader, Promotes Tumorigenesis and Metastasis of Oral Squamous Cell Carcinoma. Front Oncol. 2021 Sep 23;11:716921. doi: 10.3389/fonc.2021.716921. eCollection 2021.
Ref 10	Pharmacogenomic importance of ABCG2. Pharmacogenomics. 2008 Aug;9(8):1005-9.
Ref 11	L-type calcium channel blockers reverse docetaxel and vincristine-induced multidrug resistance independent of ABCB1 expression in human lung cancer cell lines. Toxicol Lett. 2010 Feb 15;192(3):408-18. doi: 10.1016/j.toxlet.2009.11.018. Epub 2009 Nov 26.
Ref 12	SMC1A regulated by KIAA1429 in m6A-independent manner promotes EMT progress in breast cancer. Mol Ther Nucleic Acids. 2021 Aug 19;27:133-146. doi: 10.1016/j.omtn.2021.08.009. eCollection 2022 Mar 8.
Ref 13	The Sirt1 Activators SRT2183 and SRT3025 Inhibit RANKL-Induced Osteoclastogenesis in Bone Marrow-Derived Macrophages and Down-Regulate Sirt3 in Sirt1 Null Cells. PLoS One. 2015 Jul 30;10(7):e0134391. doi: 10.1371/journal.pone.0134391. eCollection 2015.
Ref 14	Phase 1 Study of CK-301 (Cosibelimab) as a Single Agent in Subjects With Advanced Cancers
Ref 15	The influence of CYP3A5*3 and BCRPC421A genetic polymorphisms on the pharmacokinetics of felodipine in healthy Chinese volunteers. J Clin Pharm Ther. 2017 Jun;42(3):345-349. doi: 10.1111/jcpt.12505. Epub 2017 Feb 28.
Ref 16	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 17	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map