m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00175)

Target Name	RAC-alpha serine/threonine-protein kinase (AKT1)
Synonyms	Protein kinase B; PKB; Protein kinase B alpha; PKB alpha; Proto-oncogene c-Akt; RAC-PK-alpha; PKB; RAC Click to Show/Hide
Gene Name	AKT1
Chromosomal Location	14q32.33
Family	protein kinase superfamily; AGC Ser/Thr protein kinase family; RAC subfamily
Function	AKT1 is one of 3 closely related serine/threonine-protein kinases (AKT1, AKT2 and AKT3) called the AKT kinase, and which regulate many processes including metabolism, proliferation, cell survival, growth and angiogenesis. This is mediated through serine and/or threonine phosphorylation of a range of downstream substrates. Over 100 substrate candidates have been reported so far, but for most of them, no isoform specificity has been reported. AKT is responsible of the regulation of glucose uptake by mediating insulin-induced translocation of the SLC2A4/GLUT4 glucose transporter to the cell surface (By similarity). Phosphorylation of PTPN1 at 'Ser-50' negatively modulates its phosphatase activity preventing dephosphorylation of the insulin receptor and the attenuation of insulin signaling (By similarity). Phosphorylation of TBC1D4 triggers the binding of this effector to inhibitory 14-3-3 proteins, which is required for insulin-stimulated glucose transport . AKT regulates also the storage of glucose in the form of glycogen by phosphorylating GSK3A at 'Ser-21' and GSK3B at 'Ser-9', resulting in inhibition of its kinase activity (By similarity). Phosphorylation of GSK3 isoforms by AKT is also thought to be one mechanism by which cell proliferation is driven (By similarity). AKT regulates also cell survival via the phosphorylation of MAP3K5 (apoptosis signal-related kinase). Phosphorylation of 'Ser-83' decreases MAP3K5 kinase activity stimulated by oxidative stress and thereby prevents apoptosis. AKT mediates insulin-stimulated protein synthesis by phosphorylating TSC2 at 'Ser-939' and 'Thr-1462', thereby activating mTORC1 signaling and leading to both phosphorylation of 4E-BP1 and in activation of RPS6KB1. AKT is involved in the phosphorylation of members of the FOXO factors (Forkhead family of transcription factors), leading to binding of 14-3-3 proteins and cytoplasmic localization. In particular, FOXO1 is phosphorylated at 'Thr-24', 'Ser-256' and 'Ser-319' . FOXO3 and FOXO4 are phosphorylated on equivalent sites. AKT has an important role in the regulation of NF-kappa-B-dependent gene transcription and positively regulates the activity of CREB1 (cyclic AMP (cAMP)-response element binding protein). The phosphorylation of CREB1 induces the binding of accessory proteins that are necessary for the transcription of pro-survival genes such as BCL2 and MCL1. AKT phosphorylates 'Ser-454' on ATP citrate lyase (ACLY), thereby potentially regulating ACLY activity and fatty acid synthesis (By similarity). Activates the 3B isoform of cyclic nucleotide phosphodiesterase (PDE3B) via phosphorylation of 'Ser-273', resulting in reduced cyclic AMP levels and inhibition of lipolysis (By similarity). Phosphorylates PIKFYVE on 'Ser-318', which results in increased PI(3)P-5 activity (By similarity). The Rho GTPase-activating protein DLC1 is another substrate and its phosphorylation is implicated in the regulation cell proliferation and cell growth. AKT plays a role as key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation (By similarity). Signals downstream of phosphatidylinositol 3-kinase (PI(3)K) to mediate the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). AKT mediates the antiapoptotic effects of IGF-I (By similarity). Essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. May be involved in the regulation of the placental development (By similarity). Phosphorylates STK4/MST1 at 'Thr-120' and 'Thr-387' leading to inhibition of its: kinase activity, nuclear translocation, autophosphorylation and ability to phosphorylate FOXO3. Phosphorylates STK3/MST2 at 'Thr-117' and 'Thr-384' leading to inhibition of its: cleavage, kinase activity, autophosphorylation at Thr-180, binding to RASSF1 and nuclear translocation. Phosphorylates SRPK2 and enhances its kinase activity towards SRSF2 and ACIN1 and promotes its nuclear translocation. Phosphorylates RAF1 at 'Ser-259' and negatively regulates its activity. Phosphorylation of BAD stimulates its pro-apoptotic activity. Phosphorylates KAT6A at 'Thr-369' and this phosphorylation inhibits the interaction of KAT6A with PML and negatively regulates its acetylation activity towards p53/TP53. Phosphorylates palladin (PALLD), modulating cytoskeletal organization and cell motility. Phosphorylates prohibitin (PHB), playing an important role in cell metabolism and proliferation. Phosphorylates CDKN1A, for which phosphorylation at 'Thr-145' induces its release from CDK2 and cytoplasmic relocalization. These recent findings indicate that the AKT1 isoform has a more specific role in cell motility and proliferation. Phosphorylates CLK2 thereby controlling cell survival to ionizing radiation. Phosphorylates PCK1 at 'Ser-90', reducing the binding affinity of PCK1 to oxaloacetate and changing PCK1 into an atypical protein kinase activity using GTP as donor. Also acts as an activator of TMEM175 potassium channel activity in response to growth factors: forms the lysoK(GF) complex together with TMEM175 and acts by promoting TMEM175 channel activation, independently of its protein kinase activity. Click to Show/Hide
Gene ID	207
Uniprot ID	AKT1_HUMAN
HGNC ID	HGNC:391
KEGG ID	hsa:207

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

AKT1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Neural progenitor cell line	Mus musculus
Treatment: METTL14 knockout NPCs Control: Wild type NPCs		GSE158985
Regulation		logFC: 8.08E-01 p-value: 3.19E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathway and the EMT pathway, respectively.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating EGFR/PI3K/RAC-alpha serine/threonine-protein kinase (AKT1) signaling pathway in an m6A-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Liver	Mus musculus
Treatment: Mettl3 knockout liver Control: Wild type liver cells		GSE198512
Regulation		logFC: 1.27E+00 p-value: 1.77E-02
More Results	Click to View More RNA-seq Results

In total 10 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, BCL2 and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1).
Target Regulation	Down regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Pathway Response	Apoptosis			hsa04210
Cell Process	Cell differentiation and apoptosis
In-vitro Model	HSPC (Human hematopoietic stem cell)
In-vivo Model	500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	Downregulated METTL3 expression in AML-MSCs induced an increase in RAC-alpha serine/threonine-protein kinase (AKT1) protein, resulting in enhanced MSC adipogenesis, thereby contributing to chemoresistance in acute myeloid leukaemia (AML) cells.
Target Regulation	Down regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Adipogenesis
In-vitro Model	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	U-937	Adult acute monocytic leukemia	Homo sapiens	CVCL_0007
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	METTL3 plays a carcinogenic role in human EC progression partially through RAC-alpha serine/threonine-protein kinase (AKT1) signaling pathways, suggesting that METTL3 serves as a potential therapeutic target for esophageal cancer therapy. A double-effect inhibitor (BEZ235) inhibited AKT and mTOR phosphorylation and hindered the effect of METTL3 overexpression on the proliferation and migration of Eca-109 and KY-SE150 cells.
Target Regulation	Up regulation
Responsed Disease	Esophageal cancer		ICD-11: 2B70	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	Wnt signaling pathway			hsa04310
	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell proliferation and invasion
	Cell apoptosis
In-vitro Model	Eca-109	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_6898
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	Normal esophageal epithelial cell line (HEEC) (Isolated from the human esophagus)
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of RAC-alpha serine/threonine-protein kinase (AKT1) and expression of down-stream effectors p70S6K and Cyclin D1.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	METTL3 contributes to the progression and chemoresistance of NSCLC by promoting RAC-alpha serine/threonine-protein kinase (AKT1) protein expression through regulating AKT1 mRNA m6A levels, and provides an efficient therapeutic intervention target for overcoming chemoresistance in NSCLC.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene				[8]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathway.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene				[9]
Response Summary	METTL3 knockdown downregulated the phosphorylation levels of RAC-alpha serine/threonine-protein kinase (AKT1) and the expression of the downstream effector Cyclin D1 in ovarian cancer.
Target Regulation	Up regulation
Responsed Disease	Ovarian cancer		ICD-11: 2C73	Disease Info
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell cycle
	Cell apoptosis
In-vitro Model	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
Experiment 8 Reporting the m6A Methylation Regulator of This Target Gene				[10]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and NKX3-1 at both mRNA and protein level with inhibited phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1). YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Experiment 9 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in pI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Target Regulation	Down regulation
Responsed Disease	Renal cell carcinoma		ICD-11: 2C90	Disease Info
Cell Process	Epithelial-to-mesenchymal transition
	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.
Experiment 10 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulation	Up regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	143B cell line	Homo sapiens
Treatment: siALKBH5 transfected 143B cells Control: siControl 143B cells		GSE154528
Regulation		logFC: -9.73E-01 p-value: 3.10E-07
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[13]
Response Summary	ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15-AS1 bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated PTEN transcription to inactivate RAC-alpha serine/threonine-protein kinase (AKT1) pathway.
Responsed Disease	Pancreatic cancer		ICD-11: 2C10	Disease Info
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Epithelial-mesenchymal transition
	Cell apoptosis
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[14]
Response Summary	The overexpression of ALKBH5 led to the activation of RAC-alpha serine/threonine-protein kinase (AKT1), and BMP2 was regulated by ALKBH5 through the AKT signaling pathway. ALKBH5 promoted the osteogenesis of the ligamentum flavum cells through BMP2 demethylation and AKT activation. MK22606 is an AKT inhibitor. Moreover, when ALKBH5 was knocked down in the ligamentum flavum cells, p-AKT was inhibited when compared with that in the overexpressed ALKBH5 and control groups.
Target Regulation	Up regulation
Responsed Disease	Ossification of spinal ligaments		ICD-11: FA83	Disease Info
Responsed Drug	MK22606		Investigative	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Ossification
In-vitro Model	Ligamentum flavum cells (Ligamentum flavum cells)

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shNC AGS		GSE166972
Regulation		logFC: -2.24E+00 p-value: 7.14E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[15]
Response Summary	YTHDF1 contributes to the progression of HCC by activating PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR signaling pathway and inducing EMT.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
	Cell proliferation
In-vitro Model	SNU-398	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0077
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	PLC/PRF/5	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0485
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
In-vivo Model	Ten four-week-old BALB/c male nude mice (GemPharmatech, Jiangsu, China) were subcutaneously injected with control Huh7 cells 2 × 10⁶ (left-back) and stable knockdown of YTHDF1 Huh7 cells 2 × 10⁶ (right-back). These cells were respectively premixed with 50 ul Matrigel (Corning, 354,234) in 100 ul PBS.

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Fulvestrant		Approved	Drug Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Tamoxifen		Approved	Drug Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[20]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, RAC-alpha serine/threonine-protein kinase (AKT1), and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[10]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and NKX3-1 at both mRNA and protein level with inhibited phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1). YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[20]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, RAC-alpha serine/threonine-protein kinase (AKT1), and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[21]
Response Summary	YTHDC2 promotes radiotherapy resistance of NPC cells by activating the IGF1R/RAC-alpha serine/threonine-protein kinase (AKT1)/S6 signaling axis and serves as a potential therapeutic target in radiosensitization of NPC cells.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
In-vitro Model	HK1-IRR (HK1-IRR (HK1-ionizing radiation radioresistent cell line) was derived from HK1 after a prolonged exposure of irradiation.HK1, a generous gift from Prof. Ya Cao (Cancer Research Institute, Central South University), was established from a recurrent nasopharynx carcinoma of a Chinese 17-year-old male patient)
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE2-IRR (CNE2-IRR (CNE2-ionizing radiation radioresistent cell line) was derived from CNE2 after a prolonged exposure of irradiation)
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	2 × 10⁶ cells resuspended in 50 uL of Matrigel (Corning) were subcutaneously injected into 4-6 weeks old male nude mice. When tumor volumes reached 150-200 mm³, animals were divided into control group and radiotherapy group. In the radiotherapy group, tumors were treated with a single irradiation (4 Gy) when tumor volumes reached approximately 150-200 mm³. The tumor stopped growing in the next few days and then restarted growth.

Acute myeloid leukaemia [ICD-11: 2A60]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, BCL2 and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1).
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Apoptosis			hsa04210
Cell Process	Cell differentiation and apoptosis
In-vitro Model	HSPC (Human hematopoietic stem cell)
In-vivo Model	500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	Downregulated METTL3 expression in AML-MSCs induced an increase in RAC-alpha serine/threonine-protein kinase (AKT1) protein, resulting in enhanced MSC adipogenesis, thereby contributing to chemoresistance in acute myeloid leukaemia (AML) cells.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Adipogenesis
In-vitro Model	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	U-937	Adult acute monocytic leukemia	Homo sapiens	CVCL_0007
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[21]
Response Summary	YTHDC2 promotes radiotherapy resistance of NPC cells by activating the IGF1R/RAC-alpha serine/threonine-protein kinase (AKT1)/S6 signaling axis and serves as a potential therapeutic target in radiosensitization of NPC cells.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	HK1-IRR (HK1-IRR (HK1-ionizing radiation radioresistent cell line) was derived from HK1 after a prolonged exposure of irradiation.HK1, a generous gift from Prof. Ya Cao (Cancer Research Institute, Central South University), was established from a recurrent nasopharynx carcinoma of a Chinese 17-year-old male patient)
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE2-IRR (CNE2-IRR (CNE2-ionizing radiation radioresistent cell line) was derived from CNE2 after a prolonged exposure of irradiation)
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	2 × 10⁶ cells resuspended in 50 uL of Matrigel (Corning) were subcutaneously injected into 4-6 weeks old male nude mice. When tumor volumes reached 150-200 mm³, animals were divided into control group and radiotherapy group. In the radiotherapy group, tumors were treated with a single irradiation (4 Gy) when tumor volumes reached approximately 150-200 mm³. The tumor stopped growing in the next few days and then restarted growth.

Esophageal cancer [ICD-11: 2B70]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	METTL3 plays a carcinogenic role in human EC progression partially through RAC-alpha serine/threonine-protein kinase (AKT1) signaling pathways, suggesting that METTL3 serves as a potential therapeutic target for esophageal cancer therapy. A double-effect inhibitor (BEZ235) inhibited AKT and mTOR phosphorylation and hindered the effect of METTL3 overexpression on the proliferation and migration of Eca-109 and KY-SE150 cells.
Responsed Disease	Esophageal cancer [ICD-11: 2B70]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	Wnt signaling pathway			hsa04310
	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell proliferation and invasion
	Cell apoptosis
In-vitro Model	Eca-109	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_6898
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	Normal esophageal epithelial cell line (HEEC) (Isolated from the human esophagus)

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathway and the EMT pathway, respectively.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22
Experiment 2 Reporting the m6A-centered Disease Response				[6]
Response Summary	Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of RAC-alpha serine/threonine-protein kinase (AKT1) and expression of down-stream effectors p70S6K and Cyclin D1.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[13]
Response Summary	ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15-AS1 bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated PTEN transcription to inactivate RAC-alpha serine/threonine-protein kinase (AKT1) pathway.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Epithelial-mesenchymal transition
	Cell apoptosis
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	MIA PaCa-2	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0428
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480

Gastrointestinal cancer [ICD-11: 2C11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	m6A regulators were mostly upregulated in Gastrointestinal cancer and their differential expression significantly influenced the overall survival of patients with GI cancer. The phosphatidylinositol-3-kinase (PI3K)/RAC-alpha serine/threonine-protein kinase (AKT1) and mammalian target of rapamycin (mTOR) signaling pathways were found to be potentially affected by m6A modification in most human cancers, including GI cancer, which was further verified by m6A-Seq and phospho-MAPK array.
Responsed Disease	Gastrointestinal cancer [ICD-11: 2C11]
Pathway Response	PI3K-Akt signaling pathway			hsa04151), mTOR signaling pathway
In-vitro Model	()
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	()

Liver cancer [ICD-11: 2C12]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating EGFR/PI3K/RAC-alpha serine/threonine-protein kinase (AKT1) signaling pathway in an m6A-dependent manner.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.
Experiment 2 Reporting the m6A-centered Disease Response				[15]
Response Summary	YTHDF1 contributes to the progression of HCC by activating PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR signaling pathway and inducing EMT.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
	Cell proliferation
In-vitro Model	SNU-398	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0077
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	PLC/PRF/5	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0485
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
In-vivo Model	Ten four-week-old BALB/c male nude mice (GemPharmatech, Jiangsu, China) were subcutaneously injected with control Huh7 cells 2 × 10⁶ (left-back) and stable knockdown of YTHDF1 Huh7 cells 2 × 10⁶ (right-back). These cells were respectively premixed with 50 ul Matrigel (Corning, 354,234) in 100 ul PBS.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	METTL3 contributes to the progression and chemoresistance of NSCLC by promoting RAC-alpha serine/threonine-protein kinase (AKT1) protein expression through regulating AKT1 mRNA m6A levels, and provides an efficient therapeutic intervention target for overcoming chemoresistance in NSCLC.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Experiment 2 Reporting the m6A-centered Disease Response				[8]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathway.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Fulvestrant		Approved	Drug Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
Experiment 2 Reporting the m6A-centered Disease Response				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Tamoxifen		Approved	Drug Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553

Ovarian cancer [ICD-11: 2C73]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[9]
Response Summary	METTL3 knockdown downregulated the phosphorylation levels of RAC-alpha serine/threonine-protein kinase (AKT1) and the expression of the downstream effector Cyclin D1 in ovarian cancer.
Responsed Disease	Ovarian cancer [ICD-11: 2C73]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell cycle
	Cell apoptosis
In-vitro Model	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[10]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and NKX3-1 at both mRNA and protein level with inhibited phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1). YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Experiment 2 Reporting the m6A-centered Disease Response				[10]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and NKX3-1 at both mRNA and protein level with inhibited phosphorylated RAC-alpha serine/threonine-protein kinase (AKT1). YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[11]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in pI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Responsed Disease	Renal cell carcinoma [ICD-11: 2C90]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Epithelial-to-mesenchymal transition
Cell Process	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.

Retina cancer [ICD-11: 2D02]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[12]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Responsed Disease	Retinoblastoma [ICD-11: 2D02.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

Gangrene or necrosis of lung [ICD-11: CA43]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[20]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, RAC-alpha serine/threonine-protein kinase (AKT1), and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.
Experiment 2 Reporting the m6A-centered Disease Response				[20]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, RAC-alpha serine/threonine-protein kinase (AKT1), and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

Ossification of spinal ligaments [ICD-11: FA83]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[14]
Response Summary	The overexpression of ALKBH5 led to the activation of RAC-alpha serine/threonine-protein kinase (AKT1), and BMP2 was regulated by ALKBH5 through the AKT signaling pathway. ALKBH5 promoted the osteogenesis of the ligamentum flavum cells through BMP2 demethylation and AKT activation. MK22606 is an AKT inhibitor. Moreover, when ALKBH5 was knocked down in the ligamentum flavum cells, p-AKT was inhibited when compared with that in the overexpressed ALKBH5 and control groups.
Responsed Disease	Ossification of spinal ligaments [ICD-11: FA83]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)	ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	MK22606	Investigative	Drug Info
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	Ossification
In-vitro Model	Ligamentum flavum cells (Ligamentum flavum cells)

Fulvestrant [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553

Rapamycin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[12]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/RAC-alpha serine/threonine-protein kinase (AKT1)/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

Tamoxifen [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[17]
Response Summary	In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated RAC-alpha serine/threonine-protein kinase (AKT1) and MAPK that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways.
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell migration and invasion
In-vitro Model	HCC1806	Breast squamous cell carcinoma	Homo sapiens	CVCL_1258
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553

MK22606 [Investigative]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response			[14]
Response Summary	The overexpression of ALKBH5 led to the activation of RAC-alpha serine/threonine-protein kinase (AKT1), and BMP2 was regulated by ALKBH5 through the AKT signaling pathway. ALKBH5 promoted the osteogenesis of the ligamentum flavum cells through BMP2 demethylation and AKT activation. MK22606 is an AKT inhibitor. Moreover, when ALKBH5 was knocked down in the ligamentum flavum cells, p-AKT was inhibited when compared with that in the overexpressed ALKBH5 and control groups.
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)	ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Ossification of spinal ligaments	ICD-11: FA83	Disease Info
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	Ossification
In-vitro Model	Ligamentum flavum cells (Ligamentum flavum cells)

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02150		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02163		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02176		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02189		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03328		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5A (KDM5A)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Prostate cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03386		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03399		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03637		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03499		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05143		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship	ncRNA → m6A
Disease	Breast cancer	Disease Info
Drug	Tamoxifen	Drug Info
Crosstalk ID: M6ACROT05145		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship	ncRNA → m6A
Disease	Breast cancer	Disease Info
Drug	Fulvestrant	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00175)

RAC-alpha serine/threonine-protein kinase (AKT1)

2'-O-Methylation (2'-O-Me)

In total 2 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000095		Click to Show/Hide the Full List
mod site	chr14:104770802-104770803:-		[22]
Sequence	GTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000553506.5; ENST00000555528.5; ENST00000554192.5; ENST00000554585.5; ENST00000544168.5; ENST00000402615.6; ENST00000649815.1; ENST00000610370.1; ENST00000555458.5; ENST00000557552.1; ENST00000554581.5; ENST00000554848.5; ENST00000349310.7; ENST00000407796.6
External Link	RMBase: Nm_site_1824
mod ID: 2OMSITE000096		Click to Show/Hide the Full List
mod site	chr14:104770805-104770806:-		[22]
Sequence	CAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000407796.6; ENST00000553506.5; ENST00000544168.5; ENST00000554581.5; ENST00000610370.1; ENST00000649815.1; ENST00000554192.5; ENST00000554848.5; ENST00000555528.5; ENST00000557552.1; ENST00000402615.6; ENST00000349310.7; ENST00000555458.5; ENST00000554585.5
External Link	RMBase: Nm_site_1825

5-methylcytidine (m5C)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000305		Click to Show/Hide the Full List
mod site	chr14:104772337-104772338:-
Sequence	CTGCTCCCCGCATATTCACGCGCACGCATGCTCCCCACATA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000553506.5; ENST00000554585.5; ENST00000349310.7; ENST00000554192.5; ENST00000554848.5; ENST00000544168.5; ENST00000555458.5; ENST00000402615.6; ENST00000555528.5; ENST00000610370.1; ENST00000649815.1; ENST00000407796.6; ENST00000554581.5; ENST00000557552.1
External Link	RMBase: m5C_site_13470
mod ID: M5CSITE000306		Click to Show/Hide the Full List
mod site	chr14:104782725-104782726:-
Sequence	CCACGTGAGGCCCCTTCACTCACACCCGTCTCCTGGGGTAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555926.1; ENST00000555380.1; ENST00000554581.5; ENST00000349310.7; ENST00000402615.6; ENST00000407796.6; ENST00000554848.5; ENST00000555528.5; ENST00000649815.1
External Link	RMBase: m5C_site_13471
mod ID: M5CSITE000307		Click to Show/Hide the Full List
mod site	chr14:104791110-104791111:-
Sequence	GGGCCTTGACTGCCCAGGGGCCCAGGCCCCAGTTACTGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000402615.6; ENST00000407796.6; ENST00000349310.7; ENST00000649815.1; ENST00000555926.1; ENST00000555528.5; ENST00000554848.5; ENST00000554581.5
External Link	RMBase: m5C_site_13472
mod ID: M5CSITE000308		Click to Show/Hide the Full List
mod site	chr14:104793493-104793494:-
Sequence	GGGCCTGGCAAAACCTGAGACGCCCGGTACATGTTGGCCAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000554581.5; ENST00000349310.7; ENST00000557494.1; ENST00000649815.1; ENST00000555926.1; ENST00000554848.5; rmsk_4276839; ENST00000555528.5; ENST00000407796.6; ENST00000402615.6
External Link	RMBase: m5C_site_13473

N6-methyladenosine (m6A)

In total 104 m6A sequence/site(s) in this target gene
mod ID: M6ASITE021750		Click to Show/Hide the Full List
mod site	chr14:104769422-104769423:-		[23]
Sequence	GCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407796.6; ENST00000555458.5; ENST00000555528.5; ENST00000649815.1; ENST00000554581.5; ENST00000557552.1; ENST00000402615.6; ENST00000349310.7; ENST00000610370.1; ENST00000553506.5
External Link	RMBase: m6A_site_266107
mod ID: M6ASITE021751		Click to Show/Hide the Full List
mod site	chr14:104769432-104769433:-		[24]
Sequence	CTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000349310.7; ENST00000407796.6; ENST00000610370.1; ENST00000649815.1; ENST00000557552.1; ENST00000402615.6; ENST00000553506.5; ENST00000555528.5; ENST00000555458.5; ENST00000554581.5
External Link	RMBase: m6A_site_266108
mod ID: M6ASITE021752		Click to Show/Hide the Full List
mod site	chr14:104769555-104769556:-		[23]
Sequence	GGTAGCACTTGACCTTTTCGACGCTTAACCTTTCCGCTGTC
Motif Score	2.839505952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555528.5; ENST00000402615.6; ENST00000555458.5; ENST00000649815.1; ENST00000610370.1; ENST00000553506.5; ENST00000557552.1; ENST00000349310.7; ENST00000554581.5; ENST00000407796.6
External Link	RMBase: m6A_site_266109
mod ID: M6ASITE021753		Click to Show/Hide the Full List
mod site	chr14:104769629-104769630:-		[25]
Sequence	CCCCCTTCCCCTTCTGTGTCACAGTTCTTGGTGACTGTCCC
Motif Score	2.047297619
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000555528.5; ENST00000554581.5; ENST00000553506.5; ENST00000557552.1; ENST00000555458.5; ENST00000649815.1; ENST00000402615.6; ENST00000349310.7; ENST00000407796.6; ENST00000610370.1
External Link	RMBase: m6A_site_266110
mod ID: M6ASITE021754		Click to Show/Hide the Full List
mod site	chr14:104769662-104769663:-		[23]
Sequence	GGGGGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTC
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000554581.5; ENST00000553506.5; ENST00000402615.6; ENST00000407796.6; ENST00000557552.1; ENST00000555528.5; ENST00000649815.1; ENST00000610370.1; ENST00000555458.5; ENST00000349310.7
External Link	RMBase: m6A_site_266111
mod ID: M6ASITE021755		Click to Show/Hide the Full List
mod site	chr14:104769738-104769739:-		[23]
Sequence	GCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAAT
Motif Score	3.643047619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000610370.1; ENST00000407796.6; ENST00000554581.5; ENST00000555528.5; ENST00000349310.7; ENST00000555458.5; ENST00000553506.5; ENST00000557552.1; ENST00000402615.6; ENST00000649815.1
External Link	RMBase: m6A_site_266112
mod ID: M6ASITE021756		Click to Show/Hide the Full List
mod site	chr14:104769748-104769749:-		[23]
Sequence	TGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCA
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000557552.1; ENST00000555458.5; ENST00000553506.5; ENST00000555528.5; ENST00000407796.6; ENST00000402615.6; ENST00000554581.5; ENST00000610370.1; ENST00000649815.1; ENST00000349310.7
External Link	RMBase: m6A_site_266113
mod ID: M6ASITE021757		Click to Show/Hide the Full List
mod site	chr14:104770054-104770055:-		[26]
Sequence	CACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; CD8T; iSLK
Seq Type List	m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List	ENST00000554192.5; ENST00000555458.5; ENST00000649815.1; ENST00000553506.5; ENST00000557552.1; ENST00000610370.1; ENST00000554581.5; ENST00000402615.6; ENST00000555528.5; ENST00000407796.6; ENST00000349310.7
External Link	RMBase: m6A_site_266118
mod ID: M6ASITE021758		Click to Show/Hide the Full List
mod site	chr14:104770073-104770074:-		[23]
Sequence	CCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGAC
Motif Score	2.021232143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000554581.5; ENST00000649815.1; ENST00000407796.6; ENST00000402615.6; ENST00000610370.1; ENST00000555528.5; ENST00000349310.7; ENST00000555458.5; ENST00000553506.5; ENST00000557552.1; ENST00000554192.5
External Link	RMBase: m6A_site_266119
mod ID: M6ASITE021759		Click to Show/Hide the Full List
mod site	chr14:104770085-104770086:-		[24]
Sequence	GTGTGGCCTCAGCCCTCAGAACAATCCGATTCACGTAGGGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; HeLa; A549; iSLK
Seq Type List	MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000553506.5; ENST00000407796.6; ENST00000555458.5; ENST00000649815.1; ENST00000554192.5; ENST00000402615.6; ENST00000554581.5; ENST00000610370.1; ENST00000555528.5; ENST00000557552.1
External Link	RMBase: m6A_site_266120
mod ID: M6ASITE021760		Click to Show/Hide the Full List
mod site	chr14:104770150-104770151:-		[26]
Sequence	GCAGCGGGGTAGGGAAGAAAACTATCCTGCGGGTTTTAATT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554192.5; ENST00000407796.6; ENST00000554581.5; ENST00000402615.6; ENST00000610370.1; ENST00000649815.1; ENST00000555528.5; ENST00000557552.1; ENST00000553506.5; ENST00000555458.5; ENST00000349310.7
External Link	RMBase: m6A_site_266123
mod ID: M6ASITE021761		Click to Show/Hide the Full List
mod site	chr14:104770202-104770203:-		[27]
Sequence	TCTCGAGCCCAGATGGAAAGACGTTTTTGTGCTGTGGGCAG
Motif Score	2.871321429
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000610370.1; ENST00000553506.5; ENST00000555458.5; ENST00000554192.5; ENST00000554581.5; ENST00000555528.5; ENST00000649815.1; ENST00000554585.5; ENST00000407796.6; ENST00000557552.1; ENST00000544168.5; ENST00000349310.7; ENST00000402615.6
External Link	RMBase: m6A_site_266124
mod ID: M6ASITE021762		Click to Show/Hide the Full List
mod site	chr14:104770328-104770329:-		[28]
Sequence	ACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTG
Motif Score	4.065041667
Cell/Tissue List	HepG2; HEK293T; MM6; peripheral-blood; endometrial
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000554585.5; ENST00000407796.6; ENST00000349310.7; ENST00000402615.6; ENST00000554581.5; ENST00000610370.1; ENST00000544168.5; ENST00000555528.5; ENST00000554192.5; ENST00000553506.5; ENST00000555458.5; ENST00000557552.1; ENST00000649815.1
External Link	RMBase: m6A_site_266127
mod ID: M6ASITE021763		Click to Show/Hide the Full List
mod site	chr14:104770398-104770399:-		[29]
Sequence	TGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000553506.5; ENST00000554192.5; ENST00000554848.5; ENST00000402615.6; ENST00000554581.5; ENST00000544168.5; ENST00000557552.1; ENST00000610370.1; ENST00000649815.1; ENST00000555528.5; ENST00000554585.5; ENST00000555458.5; ENST00000407796.6; ENST00000349310.7
External Link	RMBase: m6A_site_266128
mod ID: M6ASITE021764		Click to Show/Hide the Full List
mod site	chr14:104770759-104770760:-		[25]
Sequence	CGGCCCAGATGATCACCATCACACCACCTGACCAAGGTGAG
Motif Score	2.047297619
Cell/Tissue List	kidney; liver; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000555458.5; ENST00000407796.6; ENST00000610370.1; ENST00000649815.1; ENST00000553506.5; ENST00000554581.5; ENST00000554585.5; ENST00000554848.5; ENST00000554192.5; ENST00000557552.1; ENST00000349310.7; ENST00000555528.5; ENST00000402615.6; ENST00000544168.5
External Link	RMBase: m6A_site_266129
mod ID: M6ASITE021765		Click to Show/Hide the Full List
mod site	chr14:104770806-104770807:-		[24]
Sequence	CCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407796.6; ENST00000554585.5; ENST00000557552.1; ENST00000649815.1; ENST00000554192.5; ENST00000349310.7; ENST00000402615.6; ENST00000554581.5; ENST00000553506.5; ENST00000555458.5; ENST00000554848.5; ENST00000555528.5; ENST00000544168.5; ENST00000610370.1
External Link	RMBase: m6A_site_266130
mod ID: M6ASITE021766		Click to Show/Hide the Full List
mod site	chr14:104770810-104770811:-		[30]
Sequence	AGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGAT
Motif Score	3.319380952
Cell/Tissue List	HepG2; Huh7; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554581.5; ENST00000555528.5; ENST00000555458.5; ENST00000554848.5; ENST00000402615.6; ENST00000554192.5; ENST00000349310.7; ENST00000557552.1; ENST00000407796.6; ENST00000553506.5; ENST00000554585.5; ENST00000610370.1; ENST00000649815.1; ENST00000544168.5
External Link	RMBase: m6A_site_266131
mod ID: M6ASITE021767		Click to Show/Hide the Full List
mod site	chr14:104770949-104770950:-		[31]
Sequence	GACATCAGTCCTGCCTGGAGACCCCTTGGAGATCCAGGTGC
Motif Score	2.876744048
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000553506.5; ENST00000554192.5; ENST00000554848.5; ENST00000554581.5; ENST00000555458.5; ENST00000610370.1; ENST00000554585.5; ENST00000649815.1; ENST00000407796.6; ENST00000402615.6; ENST00000349310.7; ENST00000544168.5; ENST00000557552.1; ENST00000555528.5
External Link	RMBase: m6A_site_266132
mod ID: M6ASITE021768		Click to Show/Hide the Full List
mod site	chr14:104771399-104771400:-		[29]
Sequence	AGGGGGTCCTTGACTGTGGGACCTGAGGGGCTCTCTGGCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; H1A; H1B; GM12878; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557552.1; ENST00000554581.5; ENST00000554585.5; ENST00000544168.5; ENST00000349310.7; ENST00000402615.6; ENST00000555458.5; ENST00000554192.5; ENST00000554848.5; ENST00000555528.5; ENST00000407796.6; ENST00000649815.1; ENST00000553506.5; ENST00000610370.1
External Link	RMBase: m6A_site_266133
mod ID: M6ASITE021769		Click to Show/Hide the Full List
mod site	chr14:104771442-104771443:-		[29]
Sequence	AATGCTGGTGCCCAGCCCAGACTCTGGGGTGGGGCAGTGCT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; H1A; H1B; GM12878; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000407796.6; ENST00000544168.5; ENST00000555458.5; ENST00000554581.5; ENST00000554192.5; ENST00000610370.1; ENST00000553506.5; ENST00000555528.5; ENST00000554585.5; ENST00000554848.5; ENST00000649815.1; ENST00000557552.1; ENST00000402615.6
External Link	RMBase: m6A_site_266134
mod ID: M6ASITE021770		Click to Show/Hide the Full List
mod site	chr14:104771464-104771465:-		[29]
Sequence	ACCTTGCTAATTGACAATGGACAATGCTGGTGCCCAGCCCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; HepG2; H1A; H1B; GM12878; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553506.5; ENST00000402615.6; ENST00000554848.5; ENST00000555528.5; ENST00000544168.5; ENST00000649815.1; ENST00000555458.5; ENST00000557552.1; ENST00000554192.5; ENST00000407796.6; ENST00000554585.5; ENST00000554581.5; ENST00000349310.7; ENST00000610370.1
External Link	RMBase: m6A_site_266135
mod ID: M6ASITE021771		Click to Show/Hide the Full List
mod site	chr14:104771484-104771485:-		[29]
Sequence	CTGCCCAGCCTTGACCAGAGACCTTGCTAATTGACAATGGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; H1A; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000554585.5; ENST00000649815.1; ENST00000544168.5; ENST00000610370.1; ENST00000555528.5; ENST00000554581.5; ENST00000554192.5; ENST00000554848.5; ENST00000555458.5; ENST00000402615.6; ENST00000407796.6; ENST00000553506.5; ENST00000557552.1
External Link	RMBase: m6A_site_266136
mod ID: M6ASITE021772		Click to Show/Hide the Full List
mod site	chr14:104771633-104771634:-		[29]
Sequence	TCGGGCTGGGCAGCCCTGGGACCCAGCTGGGCACCTGTTCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000544168.5; ENST00000554581.5; ENST00000557552.1; ENST00000407796.6; ENST00000349310.7; ENST00000554848.5; ENST00000402615.6; ENST00000555528.5; ENST00000554585.5; ENST00000555458.5; ENST00000553506.5; ENST00000554192.5; ENST00000610370.1; ENST00000649815.1
External Link	RMBase: m6A_site_266137
mod ID: M6ASITE021773		Click to Show/Hide the Full List
mod site	chr14:104771813-104771814:-		[32]
Sequence	TGGGTGCTCATCTTTCAGGGACCCTAGGAGCCCTGGCCATC
Motif Score	3.622404762
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000544168.5; ENST00000555528.5; ENST00000349310.7; ENST00000554581.5; ENST00000554585.5; ENST00000553506.5; ENST00000402615.6; ENST00000649815.1; ENST00000555458.5; ENST00000407796.6; ENST00000557552.1; ENST00000554192.5; ENST00000554848.5; ENST00000610370.1
External Link	RMBase: m6A_site_266138
mod ID: M6ASITE021774		Click to Show/Hide the Full List
mod site	chr14:104771908-104771909:-		[29]
Sequence	CTGGCTGTGCAGGGACAGGGACAGCACCTACTTTTCTGGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000555458.5; ENST00000554585.5; ENST00000544168.5; ENST00000554192.5; ENST00000553506.5; ENST00000402615.6; ENST00000554581.5; ENST00000610370.1; ENST00000555528.5; ENST00000557552.1; ENST00000407796.6; ENST00000554848.5; ENST00000349310.7
External Link	RMBase: m6A_site_266139
mod ID: M6ASITE021775		Click to Show/Hide the Full List
mod site	chr14:104771914-104771915:-		[29]
Sequence	CTATTTCTGGCTGTGCAGGGACAGGGACAGCACCTACTTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000554581.5; ENST00000553506.5; ENST00000554848.5; ENST00000544168.5; ENST00000557552.1; ENST00000555528.5; ENST00000610370.1; ENST00000554192.5; ENST00000407796.6; ENST00000649815.1; ENST00000402615.6; ENST00000555458.5; ENST00000554585.5
External Link	RMBase: m6A_site_266140
mod ID: M6ASITE021776		Click to Show/Hide the Full List
mod site	chr14:104772013-104772014:-		[29]
Sequence	TGAAGGCTGGCTGGTGGTGGACCAGGGGTGCTGCCCCTTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000554581.5; ENST00000349310.7; ENST00000555528.5; ENST00000553506.5; ENST00000407796.6; ENST00000557552.1; ENST00000544168.5; ENST00000555458.5; ENST00000649815.1; ENST00000554848.5; ENST00000402615.6; ENST00000610370.1; ENST00000554192.5; ENST00000554585.5
External Link	RMBase: m6A_site_266141
mod ID: M6ASITE021777		Click to Show/Hide the Full List
mod site	chr14:104772889-104772890:-		[29]
Sequence	TTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGTGAGGGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; peripheral-blood; HEK293T; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554585.5; ENST00000553506.5; ENST00000554192.5; ENST00000554581.5; ENST00000610370.1; ENST00000649815.1; ENST00000544168.5; ENST00000555458.5; ENST00000402615.6; ENST00000554848.5; ENST00000349310.7; ENST00000407796.6; ENST00000555528.5; ENST00000557552.1
External Link	RMBase: m6A_site_266142
mod ID: M6ASITE021778		Click to Show/Hide the Full List
mod site	chr14:104772991-104772992:-		[29]
Sequence	CCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; LCLs; A549; H1299; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554848.5; ENST00000553506.5; ENST00000544168.5; ENST00000557552.1; ENST00000349310.7; ENST00000554192.5; ENST00000554581.5; ENST00000402615.6; ENST00000555458.5; ENST00000407796.6; ENST00000649815.1; ENST00000554585.5; ENST00000555528.5
External Link	RMBase: m6A_site_266143
mod ID: M6ASITE021779		Click to Show/Hide the Full List
mod site	chr14:104773000-104773001:-		[24]
Sequence	GTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000554848.5; ENST00000553506.5; ENST00000554581.5; ENST00000554192.5; ENST00000349310.7; ENST00000555458.5; ENST00000407796.6; ENST00000554585.5; ENST00000557552.1; ENST00000402615.6; ENST00000544168.5; ENST00000555528.5; ENST00000649815.1
External Link	RMBase: m6A_site_266144
mod ID: M6ASITE021780		Click to Show/Hide the Full List
mod site	chr14:104773057-104773058:-		[29]
Sequence	TGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293T; A549; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553506.5; ENST00000407796.6; ENST00000554848.5; ENST00000555528.5; ENST00000554192.5; ENST00000349310.7; ENST00000555458.5; ENST00000649815.1; ENST00000554585.5; ENST00000544168.5; ENST00000557552.1; ENST00000402615.6; ENST00000554581.5
External Link	RMBase: m6A_site_266145
mod ID: M6ASITE021781		Click to Show/Hide the Full List
mod site	chr14:104773081-104773082:-		[29]
Sequence	ACCCGTGCAGGTGCTGGAGGACAATGACTACGGCCGTGCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; H1A; H1B; A549; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000555528.5; ENST00000553506.5; ENST00000554192.5; ENST00000557552.1; ENST00000407796.6; ENST00000402615.6; ENST00000554585.5; ENST00000554848.5; ENST00000544168.5; ENST00000649815.1; ENST00000554581.5; ENST00000349310.7; ENST00000555458.5
External Link	RMBase: m6A_site_266146
mod ID: M6ASITE021782		Click to Show/Hide the Full List
mod site	chr14:104773134-104773135:-		[29]
Sequence	CTCCCCCGGCAGTGTCCCGGACACCCCTTGATGCCGAGTCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293T; A549; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555458.5; ENST00000554581.5; ENST00000349310.7; ENST00000554848.5; ENST00000553506.5; ENST00000554585.5; ENST00000402615.6; ENST00000554192.5; ENST00000557552.1; ENST00000649815.1; ENST00000555528.5; ENST00000544168.5; ENST00000407796.6
External Link	RMBase: m6A_site_266147
mod ID: M6ASITE021783		Click to Show/Hide the Full List
mod site	chr14:104773273-104773274:-		[24]
Sequence	CCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000349310.7; ENST00000554848.5; ENST00000544168.5; ENST00000555528.5; ENST00000557552.1; ENST00000649815.1; ENST00000555458.5; ENST00000554585.5; ENST00000407796.6; ENST00000553506.5; ENST00000554192.5; ENST00000554581.5; ENST00000402615.6
External Link	RMBase: m6A_site_266148
mod ID: M6ASITE021784		Click to Show/Hide the Full List
mod site	chr14:104773285-104773286:-		[30]
Sequence	AGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAG
Motif Score	2.876744048
Cell/Tissue List	HepG2; Huh7; peripheral-blood; HEK293A-TOA; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000554581.5; ENST00000544168.5; ENST00000553506.5; ENST00000349310.7; ENST00000554848.5; ENST00000557552.1; ENST00000554585.5; ENST00000407796.6; ENST00000554192.5; ENST00000402615.6; ENST00000649815.1; ENST00000555528.5; ENST00000555458.5
External Link	RMBase: m6A_site_266149
mod ID: M6ASITE021785		Click to Show/Hide the Full List
mod site	chr14:104773332-104773333:-		[30]
Sequence	CGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGG
Motif Score	3.319380952
Cell/Tissue List	HepG2; Huh7; peripheral-blood; HEK293A-TOA; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000553506.5; ENST00000407796.6; ENST00000554848.5; ENST00000544168.5; ENST00000557552.1; ENST00000554585.5; ENST00000649815.1; ENST00000402615.6; ENST00000554192.5; ENST00000555528.5; ENST00000554581.5
External Link	RMBase: m6A_site_266150
mod ID: M6ASITE021786		Click to Show/Hide the Full List
mod site	chr14:104773359-104773360:-		[28]
Sequence	GCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTAAGA
Motif Score	3.643047619
Cell/Tissue List	HepG2; hESC-HEK293T; Huh7; peripheral-blood; HEK293A-TOA; endometrial; AML
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000555528.5; ENST00000349310.7; ENST00000407796.6; ENST00000554848.5; ENST00000557552.1; ENST00000402615.6; ENST00000554192.5; ENST00000544168.5; ENST00000554581.5; ENST00000649815.1; ENST00000554585.5; ENST00000553506.5
External Link	RMBase: m6A_site_266151
mod ID: M6ASITE021787		Click to Show/Hide the Full List
mod site	chr14:104773371-104773372:-		[30]
Sequence	ACCTTTCCCCTAGCTGGAGAACCTCATGCTGGACAAGGACG
Motif Score	2.930744048
Cell/Tissue List	HepG2; Huh7; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000402615.6; ENST00000555528.5; ENST00000407796.6; ENST00000557552.1; ENST00000554848.5; ENST00000553506.5; ENST00000554585.5; ENST00000649815.1; ENST00000554581.5; ENST00000554192.5; ENST00000544168.5
External Link	RMBase: m6A_site_266152
mod ID: M6ASITE021788		Click to Show/Hide the Full List
mod site	chr14:104773461-104773462:-		[30]
Sequence	GAAGAACGTGGTGTACCGGGACCTCAAGGTGCGCTGGCGGG
Motif Score	3.622404762
Cell/Tissue List	HepG2; Huh7; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554192.5; ENST00000554581.5; ENST00000557552.1; ENST00000555528.5; ENST00000554848.5; ENST00000349310.7; ENST00000553506.5; ENST00000407796.6; ENST00000649815.1; ENST00000402615.6; ENST00000544168.5
External Link	RMBase: m6A_site_266153
mod ID: M6ASITE021789		Click to Show/Hide the Full List
mod site	chr14:104773497-104773498:-		[30]
Sequence	TGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGA
Motif Score	4.065041667
Cell/Tissue List	HepG2; Huh7; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553506.5; ENST00000349310.7; ENST00000557552.1; ENST00000649815.1; ENST00000554848.5; ENST00000544168.5; ENST00000407796.6; ENST00000555528.5; ENST00000402615.6; ENST00000554581.5
External Link	RMBase: m6A_site_266154
mod ID: M6ASITE021790		Click to Show/Hide the Full List
mod site	chr14:104773539-104773540:-		[30]
Sequence	GGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCG
Motif Score	3.622404762
Cell/Tissue List	HepG2; peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000553506.5; ENST00000554848.5; ENST00000349310.7; ENST00000649815.1; ENST00000554581.5; ENST00000407796.6; ENST00000557552.1; ENST00000402615.6; ENST00000555528.5; ENST00000544168.5
External Link	RMBase: m6A_site_266155
mod ID: M6ASITE021791		Click to Show/Hide the Full List
mod site	chr14:104773649-104773650:-		[29]
Sequence	GCCGAGACCCGGTCTGAGAAACCCCAGCCCTGCAGGCCATG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000555528.5; ENST00000349310.7; ENST00000554848.5; ENST00000554581.5; ENST00000553506.5; ENST00000402615.6; ENST00000544168.5; ENST00000649815.1; ENST00000407796.6
External Link	RMBase: m6A_site_266156
mod ID: M6ASITE021792		Click to Show/Hide the Full List
mod site	chr14:104773663-104773664:-		[29]
Sequence	CTTCCCTGTGCAATGCCGAGACCCGGTCTGAGAAACCCCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000349310.7; ENST00000649815.1; ENST00000554581.5; ENST00000544168.5; ENST00000553506.5; ENST00000407796.6; ENST00000555528.5; ENST00000402615.6; ENST00000554848.5
External Link	RMBase: m6A_site_266157
mod ID: M6ASITE021793		Click to Show/Hide the Full List
mod site	chr14:104773719-104773720:-		[29]
Sequence	GCTGAGTTAGGGCTTCTGAGACTTTCCAGGCCCCCGTGCCC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000349310.7; ENST00000402615.6; ENST00000544168.5; ENST00000553506.5; ENST00000554581.5; ENST00000554848.5; ENST00000407796.6; ENST00000555528.5; ENST00000557552.1
External Link	RMBase: m6A_site_266158
mod ID: M6ASITE021794		Click to Show/Hide the Full List
mod site	chr14:104773884-104773885:-		[29]
Sequence	GCTGGGGCTGCGGGGGATGGACTTCGCGGCCTGTGGGCCGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; MT4; CD4T; peripheral-blood; GSC-11; endometrial; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554848.5; ENST00000544168.5; ENST00000554581.5; ENST00000349310.7; ENST00000554826.1; ENST00000402615.6; ENST00000557552.1; ENST00000555528.5; ENST00000553506.5; ENST00000407796.6; ENST00000649815.1
External Link	RMBase: m6A_site_266159
mod ID: M6ASITE021795		Click to Show/Hide the Full List
mod site	chr14:104773958-104773959:-		[29]
Sequence	CCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; MT4; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554848.5; ENST00000544168.5; ENST00000557552.1; ENST00000402615.6; ENST00000649815.1; ENST00000554826.1; ENST00000407796.6; ENST00000555528.5; ENST00000553506.5; ENST00000349310.7; ENST00000554581.5
External Link	RMBase: m6A_site_266160
mod ID: M6ASITE021796		Click to Show/Hide the Full List
mod site	chr14:104774804-104774805:-		[29]
Sequence	TGGACTCCGCCGCTGGTGAGACAGGCCTGCCCTGGAGGGTC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000544168.5; ENST00000557552.1; ENST00000649815.1; ENST00000407796.6; ENST00000555528.5; ENST00000554581.5; ENST00000554848.5; ENST00000349310.7; ENST00000554826.1; ENST00000556836.1; ENST00000402615.6
External Link	RMBase: m6A_site_266161
mod ID: M6ASITE021797		Click to Show/Hide the Full List
mod site	chr14:104774821-104774822:-		[29]
Sequence	GAGGGCTTTACACACCGTGGACTCCGCCGCTGGTGAGACAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000555528.5; ENST00000649815.1; ENST00000556836.1; ENST00000349310.7; ENST00000557552.1; ENST00000554581.5; ENST00000544168.5; ENST00000407796.6; ENST00000554826.1; ENST00000554848.5; ENST00000402615.6
External Link	RMBase: m6A_site_266162
mod ID: M6ASITE021798		Click to Show/Hide the Full List
mod site	chr14:104774939-104774940:-		[25]
Sequence	ACTCCAGGCACCCCTTCCTCACAGTGAGTGGGAGCCCAGAT
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000557552.1; ENST00000349310.7; ENST00000407796.6; ENST00000402615.6; ENST00000554581.5; ENST00000556836.1; ENST00000554826.1; ENST00000544168.5; ENST00000555528.5; ENST00000649815.1; ENST00000554848.5
External Link	RMBase: m6A_site_266163
mod ID: M6ASITE021799		Click to Show/Hide the Full List
mod site	chr14:104774959-104774960:-		[29]
Sequence	CGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; A549; MM6; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000555528.5; ENST00000554581.5; ENST00000349310.7; ENST00000649815.1; ENST00000407796.6; ENST00000402615.6; ENST00000557552.1; ENST00000554848.5; ENST00000556836.1; ENST00000544168.5; ENST00000554826.1
External Link	RMBase: m6A_site_266164
mod ID: M6ASITE021800		Click to Show/Hide the Full List
mod site	chr14:104774974-104774975:-		[29]
Sequence	GGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; MM6; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000554581.5; ENST00000554848.5; ENST00000407796.6; ENST00000649815.1; ENST00000349310.7; ENST00000402615.6; ENST00000544168.5; ENST00000554826.1; ENST00000555528.5; ENST00000556836.1; ENST00000557552.1
External Link	RMBase: m6A_site_266165
mod ID: M6ASITE021801		Click to Show/Hide the Full List
mod site	chr14:104774989-104774990:-		[24]
Sequence	TTTACAGGACGAGGTGGCCCACACACTCACCGAGAACCGCG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000557552.1; ENST00000544168.5; ENST00000556836.1; ENST00000555528.5; ENST00000402615.6; ENST00000554848.5; ENST00000554581.5; ENST00000349310.7; ENST00000407796.6; ENST00000649815.1; ENST00000554826.1
External Link	RMBase: m6A_site_266166
mod ID: M6ASITE021802		Click to Show/Hide the Full List
mod site	chr14:104775206-104775207:-		[29]
Sequence	ACCCTGGTGCCTGCCCATAGACCATGAACGAGTTTGAGTAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000402615.6; ENST00000554581.5; ENST00000557552.1; ENST00000349310.7; ENST00000554848.5; ENST00000555528.5; ENST00000407796.6; ENST00000555380.1; ENST00000544168.5; ENST00000556836.1; ENST00000649815.1; ENST00000554826.1
External Link	RMBase: m6A_site_266167
mod ID: M6ASITE021803		Click to Show/Hide the Full List
mod site	chr14:104775359-104775360:-		[29]
Sequence	TGTGTTCCCTGTAAGCCTGGACTCCCCGCTGAGCCCAGTAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000554581.5; ENST00000555380.1; ENST00000555528.5; ENST00000554826.1; ENST00000407796.6; ENST00000402615.6; ENST00000544168.5; ENST00000349310.7; ENST00000554848.5; ENST00000556836.1; ENST00000557552.1
External Link	RMBase: m6A_site_266168
mod ID: M6ASITE021804		Click to Show/Hide the Full List
mod site	chr14:104775559-104775560:-		[33]
Sequence	GTCCCAGCTCGGCCCAGGAGACACTCAGCACTCCACGGCAT
Motif Score	2.897386905
Cell/Tissue List	Jurkat; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000554826.1; ENST00000407796.6; ENST00000402615.6; ENST00000554848.5; ENST00000349310.7; ENST00000555380.1; ENST00000557552.1; ENST00000544168.5; ENST00000555528.5; ENST00000554581.5
External Link	RMBase: m6A_site_266169
mod ID: M6ASITE021805		Click to Show/Hide the Full List
mod site	chr14:104775606-104775607:-		[29]
Sequence	TGTGCCTGGGGCTGCCTTGGACTGTGGAGGGCTGGGTGGGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1A; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000402615.6; ENST00000649815.1; ENST00000555380.1; ENST00000407796.6; ENST00000349310.7; ENST00000554848.5; ENST00000554581.5; ENST00000555528.5; ENST00000554826.1; ENST00000557552.1; ENST00000544168.5
External Link	RMBase: m6A_site_266170
mod ID: M6ASITE021806		Click to Show/Hide the Full List
mod site	chr14:104775706-104775707:-		[24]
Sequence	CCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000544168.5; ENST00000555528.5; ENST00000554848.5; ENST00000554581.5; ENST00000554826.1; ENST00000407796.6; ENST00000402615.6; ENST00000557552.1; ENST00000649815.1; ENST00000555380.1; ENST00000349310.7
External Link	RMBase: m6A_site_266171
mod ID: M6ASITE021807		Click to Show/Hide the Full List
mod site	chr14:104775730-104775731:-		[29]
Sequence	GCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000349310.7; ENST00000554581.5; ENST00000407796.6; ENST00000555528.5; ENST00000544168.5; ENST00000554826.1; ENST00000649815.1; ENST00000554848.5; ENST00000402615.6; ENST00000555380.1
External Link	RMBase: m6A_site_266172
mod ID: M6ASITE021808		Click to Show/Hide the Full List
mod site	chr14:104775773-104775774:-		[29]
Sequence	AGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000555528.5; ENST00000349310.7; ENST00000554848.5; ENST00000649815.1; ENST00000402615.6; ENST00000554581.5; ENST00000407796.6; ENST00000544168.5; ENST00000555380.1; ENST00000557552.1; ENST00000554826.1
External Link	RMBase: m6A_site_266173
mod ID: M6ASITE021809		Click to Show/Hide the Full List
mod site	chr14:104775788-104775789:-		[29]
Sequence	CCTCCTGCAGGGAGGAGTGGACAACCGCCATCCAGACTGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; MM6; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000544168.5; ENST00000555528.5; ENST00000555380.1; ENST00000554581.5; ENST00000349310.7; ENST00000554848.5; ENST00000402615.6; ENST00000557552.1; ENST00000554826.1; ENST00000649815.1; ENST00000407796.6
External Link	RMBase: m6A_site_266174
mod ID: M6ASITE021810		Click to Show/Hide the Full List
mod site	chr14:104775889-104775890:-		[29]
Sequence	GGAACCCCGACAGCTGTGGAACCACGCTTGTGAGGCTGGCG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000554581.5; ENST00000649815.1; ENST00000402615.6; ENST00000557552.1; ENST00000555528.5; ENST00000554848.5; ENST00000349310.7; ENST00000555380.1; ENST00000407796.6; ENST00000554826.1; ENST00000544168.5
External Link	RMBase: m6A_site_266175
mod ID: M6ASITE021811		Click to Show/Hide the Full List
mod site	chr14:104775906-104775907:-		[29]
Sequence	CCTCAGGGCTGTCTCTGGGAACCCCGACAGCTGTGGAACCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000554581.5; ENST00000402615.6; ENST00000544168.5; ENST00000554848.5; ENST00000555380.1; ENST00000407796.6; ENST00000349310.7; ENST00000557552.1; ENST00000554826.1; ENST00000555528.5; ENST00000649815.1
External Link	RMBase: m6A_site_266176
mod ID: M6ASITE021812		Click to Show/Hide the Full List
mod site	chr14:104775946-104775947:-		[29]
Sequence	CCCTGAGTGTATGTGGCCAGACCAGGTCAAGTGGTGGCCTC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000407796.6; ENST00000649815.1; ENST00000402615.6; ENST00000555380.1; ENST00000349310.7; ENST00000554826.1; ENST00000544168.5; ENST00000554581.5; ENST00000555528.5; ENST00000554848.5
External Link	RMBase: m6A_site_266177
mod ID: M6ASITE021813		Click to Show/Hide the Full List
mod site	chr14:104776025-104776026:-		[32]
Sequence	GTTGGAGTCCGGTTGTGGGGACAGAGTCCTGCTGGGGGGCT
Motif Score	3.643047619
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000554826.1; ENST00000555528.5; ENST00000554581.5; ENST00000407796.6; ENST00000649815.1; ENST00000554848.5; ENST00000402615.6; ENST00000544168.5; ENST00000557552.1; ENST00000555380.1
External Link	RMBase: m6A_site_266178
mod ID: M6ASITE021814		Click to Show/Hide the Full List
mod site	chr14:104776152-104776153:-		[29]
Sequence	TCCGTCTCAAAAAAAGAAAAACCCGGTGGAGAGGGCCAGTC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000554848.5; ENST00000555528.5; ENST00000402615.6; ENST00000544168.5; ENST00000554826.1; ENST00000649815.1; ENST00000557552.1; ENST00000349310.7; ENST00000555380.1; rmsk_4276828; ENST00000554581.5
External Link	RMBase: m6A_site_266179
mod ID: M6ASITE021815		Click to Show/Hide the Full List
mod site	chr14:104776174-104776175:-		[29]
Sequence	AGCCAGGGCGATAGAGCAAGACTCCGTCTCAAAAAAAGAAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; rmsk_4276828; ENST00000555380.1; ENST00000555528.5; ENST00000554581.5; ENST00000402615.6; ENST00000649815.1; ENST00000407796.6; ENST00000554848.5; ENST00000544168.5; ENST00000554826.1; ENST00000557552.1
External Link	RMBase: m6A_site_266180
mod ID: M6ASITE021816		Click to Show/Hide the Full List
mod site	chr14:104776242-104776243:-		[29]
Sequence	GAGGCACAAGAATCGCTTGAACCCGAGAGGCAGAGGCTGCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000554581.5; ENST00000554826.1; ENST00000555528.5; ENST00000555380.1; ENST00000349310.7; ENST00000407796.6; rmsk_4276828; ENST00000544168.5; ENST00000554848.5; ENST00000649815.1; ENST00000402615.6
External Link	RMBase: m6A_site_266181
mod ID: M6ASITE021817		Click to Show/Hide the Full List
mod site	chr14:104776444-104776445:-		[29]
Sequence	GAGATAAAAACTGGCTAGGGACCGGGTGCAGTGGCTCACGT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000544168.5; ENST00000402615.6; ENST00000557552.1; rmsk_4276828; ENST00000407796.6; ENST00000554848.5; ENST00000554826.1; ENST00000554581.5; ENST00000555528.5; ENST00000649815.1; ENST00000349310.7; ENST00000555380.1
External Link	RMBase: m6A_site_266182
mod ID: M6ASITE021818		Click to Show/Hide the Full List
mod site	chr14:104776455-104776456:-		[29]
Sequence	AACTGAGGCTGGAGATAAAAACTGGCTAGGGACCGGGTGCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000544168.5; ENST00000649815.1; ENST00000349310.7; ENST00000555528.5; ENST00000554826.1; ENST00000554581.5; ENST00000555380.1; ENST00000557552.1; ENST00000402615.6; ENST00000554848.5; ENST00000407796.6
External Link	RMBase: m6A_site_266183
mod ID: M6ASITE021819		Click to Show/Hide the Full List
mod site	chr14:104776474-104776475:-		[29]
Sequence	TGTGGGGTTTGGGTGGGGAAACTGAGGCTGGAGATAAAAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000554581.5; ENST00000555528.5; ENST00000402615.6; ENST00000649815.1; ENST00000349310.7; ENST00000557552.1; ENST00000555380.1; ENST00000544168.5; ENST00000554826.1; ENST00000554848.5
External Link	RMBase: m6A_site_266184
mod ID: M6ASITE021820		Click to Show/Hide the Full List
mod site	chr14:104776511-104776512:-		[29]
Sequence	CCTCAGAGCCCAGTTTGGAAACTGGCCCAGTCCTGCCTGTG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000555380.1; ENST00000544168.5; ENST00000555528.5; ENST00000349310.7; ENST00000554848.5; ENST00000554581.5; ENST00000402615.6; ENST00000554826.1; ENST00000407796.6; ENST00000557552.1
External Link	RMBase: m6A_site_266185
mod ID: M6ASITE021821		Click to Show/Hide the Full List
mod site	chr14:104776600-104776601:-		[29]
Sequence	AGCCCCAGCGCTTAGGAGGGACACGGGGATGGCGGGGTGCT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000554826.1; ENST00000544168.5; ENST00000349310.7; ENST00000555528.5; ENST00000555380.1; ENST00000554581.5; ENST00000554848.5; ENST00000649815.1; ENST00000402615.6; ENST00000407796.6; ENST00000557552.1
External Link	RMBase: m6A_site_266186
mod ID: M6ASITE021822		Click to Show/Hide the Full List
mod site	chr14:104776671-104776672:-		[29]
Sequence	AACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGTACGTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000544168.5; ENST00000402615.6; ENST00000555380.1; ENST00000557552.1; ENST00000649815.1; ENST00000554581.5; ENST00000555528.5; ENST00000554826.1; ENST00000554848.5; ENST00000555926.1; ENST00000349310.7
External Link	RMBase: m6A_site_266187
mod ID: M6ASITE021823		Click to Show/Hide the Full List
mod site	chr14:104776704-104776705:-		[29]
Sequence	TCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000402615.6; ENST00000544168.5; ENST00000555528.5; ENST00000557552.1; ENST00000407796.6; ENST00000649815.1; ENST00000349310.7; ENST00000555926.1; ENST00000554848.5; ENST00000555380.1; ENST00000554581.5
External Link	RMBase: m6A_site_266188
mod ID: M6ASITE021824		Click to Show/Hide the Full List
mod site	chr14:104776733-104776734:-		[24]
Sequence	GACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407796.6; ENST00000349310.7; ENST00000555380.1; ENST00000555528.5; ENST00000649815.1; ENST00000555926.1; ENST00000544168.5; ENST00000554848.5; ENST00000557552.1; ENST00000402615.6; ENST00000554581.5
External Link	RMBase: m6A_site_266189
mod ID: M6ASITE021825		Click to Show/Hide the Full List
mod site	chr14:104776792-104776793:-		[29]
Sequence	GGGCAGGGGGATGCACGCAGACAGAGGCTCTGCCTGCCCGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000554581.5; ENST00000554848.5; ENST00000649815.1; ENST00000544168.5; ENST00000349310.7; ENST00000407796.6; ENST00000555926.1; ENST00000555528.5; ENST00000402615.6; ENST00000555380.1
External Link	RMBase: m6A_site_266190
mod ID: M6ASITE021826		Click to Show/Hide the Full List
mod site	chr14:104776878-104776879:-		[29]
Sequence	AAGAGATGGGGCTTCCCAGGACCTGGTGGGTGGTATGCAAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000402615.6; ENST00000554581.5; ENST00000555528.5; ENST00000544168.5; ENST00000557552.1; ENST00000555380.1; ENST00000407796.6; ENST00000649815.1; ENST00000555926.1; ENST00000554848.5
External Link	RMBase: m6A_site_266191
mod ID: M6ASITE021827		Click to Show/Hide the Full List
mod site	chr14:104777154-104777155:-		[29]
Sequence	ACATTTCTACACTAGGTGGGACAAGCAGGTTTCTGGGGTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000649815.1; ENST00000555926.1; ENST00000555380.1; ENST00000554848.5; ENST00000554581.5; ENST00000349310.7; ENST00000544168.5; ENST00000557552.1; ENST00000555528.5; ENST00000402615.6
External Link	RMBase: m6A_site_266192
mod ID: M6ASITE021828		Click to Show/Hide the Full List
mod site	chr14:104777174-104777175:-		[29]
Sequence	GAGGTTGGGAAAAAAGCAGGACATTTCTACACTAGGTGGGA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000544168.5; ENST00000649815.1; ENST00000402615.6; ENST00000555926.1; ENST00000554581.5; ENST00000555528.5; ENST00000349310.7; ENST00000555380.1; ENST00000407796.6; ENST00000554848.5; ENST00000557552.1
External Link	RMBase: m6A_site_266193
mod ID: M6ASITE021829		Click to Show/Hide the Full List
mod site	chr14:104778244-104778245:-		[29]
Sequence	CGTGCCTGGTGGCACCTGGGACAGGGCCTTGCTGGGGGTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557552.1; ENST00000554581.5; ENST00000555528.5; ENST00000555926.1; ENST00000349310.7; ENST00000402615.6; ENST00000555380.1; ENST00000649815.1; ENST00000407796.6; ENST00000554848.5
External Link	RMBase: m6A_site_266194
mod ID: M6ASITE021830		Click to Show/Hide the Full List
mod site	chr14:104780104-104780105:-		[24]
Sequence	CCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCGTA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555926.1; ENST00000407796.6; ENST00000555380.1; ENST00000649815.1; ENST00000554581.5; ENST00000554848.5; ENST00000555528.5; ENST00000349310.7; ENST00000402615.6
External Link	RMBase: m6A_site_266195
mod ID: M6ASITE021831		Click to Show/Hide the Full List
mod site	chr14:104780125-104780126:-		[29]
Sequence	GGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554581.5; ENST00000349310.7; ENST00000649815.1; ENST00000402615.6; ENST00000554848.5; ENST00000555528.5; ENST00000555926.1; ENST00000407796.6; ENST00000555380.1
External Link	RMBase: m6A_site_266196
mod ID: M6ASITE021832		Click to Show/Hide the Full List
mod site	chr14:104780149-104780150:-		[24]
Sequence	TGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000349310.7; ENST00000555528.5; ENST00000555380.1; ENST00000554581.5; ENST00000554848.5; ENST00000649815.1; ENST00000407796.6; ENST00000402615.6; ENST00000555926.1
External Link	RMBase: m6A_site_266197
mod ID: M6ASITE021833		Click to Show/Hide the Full List
mod site	chr14:104780201-104780202:-		[29]
Sequence	CTGTAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000402615.6; ENST00000555380.1; ENST00000554581.5; ENST00000349310.7; ENST00000554848.5; ENST00000407796.6; ENST00000555926.1; ENST00000555528.5; ENST00000649815.1
External Link	RMBase: m6A_site_266198
mod ID: M6ASITE021834		Click to Show/Hide the Full List
mod site	chr14:104780209-104780210:-		[24]
Sequence	CCGCACGTCTGTAGGGGAGTACATCAAGACCTGGCGGCCAC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555380.1; ENST00000649815.1; ENST00000555528.5; ENST00000402615.6; ENST00000554581.5; ENST00000407796.6; ENST00000554848.5; ENST00000349310.7; ENST00000555926.1
External Link	RMBase: m6A_site_266199
mod ID: M6ASITE021835		Click to Show/Hide the Full List
mod site	chr14:104792951-104792952:-		[29]
Sequence	GAGAGGCCCAGGTCCAGGGAACTGTGTTCAATTACATGGAT
Motif Score	3.373380952
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554848.5; ENST00000402615.6; ENST00000349310.7; ENST00000649815.1; ENST00000555926.1; ENST00000554581.5; ENST00000555528.5; ENST00000407796.6
External Link	RMBase: m6A_site_266200
mod ID: M6ASITE021836		Click to Show/Hide the Full List
mod site	chr14:104793242-104793243:-		[29]
Sequence	CATGGGTAGGAACACCATGGACAGGGAGAGCAAACGGGGCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000554848.5; ENST00000554581.5; ENST00000349310.7; ENST00000557494.1; ENST00000555528.5; ENST00000402615.6; ENST00000555926.1; ENST00000407796.6; ENST00000649815.1
External Link	RMBase: m6A_site_266201
mod ID: M6ASITE021837		Click to Show/Hide the Full List
mod site	chr14:104793251-104793252:-		[29]
Sequence	CCCAGGATCCATGGGTAGGAACACCATGGACAGGGAGAGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557494.1; ENST00000554581.5; ENST00000402615.6; ENST00000555528.5; ENST00000407796.6; ENST00000554848.5; ENST00000555926.1; ENST00000349310.7; ENST00000649815.1
External Link	RMBase: m6A_site_266202
mod ID: M6ASITE021838		Click to Show/Hide the Full List
mod site	chr14:104793374-104793375:-		[29]
Sequence	CTTGCGCTGGAGGGCTCTGGACTCCCGTTTGCGCCAGTGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000402615.6; ENST00000407796.6; ENST00000557494.1; ENST00000555528.5; ENST00000554581.5; ENST00000555926.1; ENST00000349310.7; ENST00000649815.1; ENST00000554848.5
External Link	RMBase: m6A_site_266203
mod ID: M6ASITE021839		Click to Show/Hide the Full List
mod site	chr14:104793453-104793454:-		[29]
Sequence	AATGAATGAACCAGATTCAGACCGGCAGGGGCGCTGTGGTT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000555528.5; ENST00000407796.6; ENST00000557494.1; ENST00000554848.5; ENST00000649815.1; ENST00000554581.5; ENST00000555926.1; ENST00000402615.6
External Link	RMBase: m6A_site_266204
mod ID: M6ASITE021840		Click to Show/Hide the Full List
mod site	chr14:104793464-104793465:-		[29]
Sequence	CATGTTGGCCAAATGAATGAACCAGATTCAGACCGGCAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000554848.5; ENST00000557494.1; ENST00000402615.6; rmsk_4276839; ENST00000349310.7; ENST00000649815.1; ENST00000554581.5; ENST00000555926.1; ENST00000555528.5
External Link	RMBase: m6A_site_266205
mod ID: M6ASITE021841		Click to Show/Hide the Full List
mod site	chr14:104793501-104793502:-		[29]
Sequence	CCAGCACTGGGCCTGGCAAAACCTGAGACGCCCGGTACATG
Motif Score	2.185083333
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555926.1; ENST00000554848.5; ENST00000649815.1; ENST00000557494.1; ENST00000349310.7; ENST00000555528.5; ENST00000407796.6; ENST00000402615.6; ENST00000554581.5; rmsk_4276839
External Link	RMBase: m6A_site_266206
mod ID: M6ASITE021842		Click to Show/Hide the Full List
mod site	chr14:104793542-104793543:-		[29]
Sequence	TCACTGACGGACTTGTCTGAACCTCTCTTTGTCTCCAGCGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_4276839; ENST00000557494.1; ENST00000407796.6; ENST00000555926.1; ENST00000553797.1; ENST00000555528.5; ENST00000402615.6; ENST00000349310.7; ENST00000649815.1; ENST00000554581.5; ENST00000554848.5
External Link	RMBase: m6A_site_266207
mod ID: M6ASITE021843		Click to Show/Hide the Full List
mod site	chr14:104793552-104793553:-		[29]
Sequence	TGGGTGCTCCTCACTGACGGACTTGTCTGAACCTCTCTTTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555528.5; ENST00000554848.5; ENST00000402615.6; ENST00000407796.6; ENST00000555926.1; ENST00000554581.5; ENST00000553797.1; ENST00000557494.1; ENST00000349310.7; ENST00000649815.1; rmsk_4276839
External Link	RMBase: m6A_site_266208
mod ID: M6ASITE021844		Click to Show/Hide the Full List
mod site	chr14:104793574-104793575:-		[29]
Sequence	TGGGTCTGTAACCACCCTGGACTGGGTGCTCCTCACTGACG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; iSLK; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555528.5; ENST00000649815.1; ENST00000407796.6; ENST00000402615.6; ENST00000554848.5; ENST00000555926.1; rmsk_4276839; ENST00000557494.1; ENST00000553797.1; ENST00000554581.5; ENST00000349310.7
External Link	RMBase: m6A_site_266209
mod ID: M6ASITE021845		Click to Show/Hide the Full List
mod site	chr14:104793766-104793767:-		[29]
Sequence	CTGTAGTTGGTGATGTGGGAACTGGGTTTTGAGGGATGCCT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000553797.1; ENST00000649815.1; ENST00000555926.1; ENST00000557494.1; ENST00000554848.5; ENST00000407796.6; ENST00000402615.6; ENST00000349310.7; ENST00000554581.5
External Link	RMBase: m6A_site_266210
mod ID: M6ASITE021846		Click to Show/Hide the Full List
mod site	chr14:104793830-104793831:-		[29]
Sequence	ATCTGGAAGGGTAGCAGAGGACTGCTCACAGGAAGAGCATG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407796.6; ENST00000554581.5; ENST00000555926.1; ENST00000557494.1; ENST00000402615.6; ENST00000349310.7; ENST00000553797.1; ENST00000554848.5; ENST00000649815.1
External Link	RMBase: m6A_site_266211
mod ID: M6ASITE021847		Click to Show/Hide the Full List
mod site	chr14:104793874-104793875:-		[29]
Sequence	GCCTGGAGGTCCCAGAGAGGACCCTCCTCCCCTCAGGAAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000557494.1; ENST00000402615.6; ENST00000649815.1; ENST00000554581.5; ENST00000407796.6; ENST00000553797.1; ENST00000554848.5; ENST00000555926.1
External Link	RMBase: m6A_site_266212
mod ID: M6ASITE021848		Click to Show/Hide the Full List
mod site	chr14:104793942-104793943:-		[29]
Sequence	TCTAAGCTGGCTGTGGAAAGACCCATGTTGGGATCCATTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000554848.5; ENST00000554581.5; ENST00000407796.6; ENST00000402615.6; ENST00000557494.1; ENST00000555926.1; ENST00000553797.1; ENST00000649815.1
External Link	RMBase: m6A_site_266213
mod ID: M6ASITE021849		Click to Show/Hide the Full List
mod site	chr14:104794085-104794086:-		[29]
Sequence	CTTCCCTGTCCTGGCATTAGACACAAGGCAGTGGGCCTTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000649815.1; ENST00000555926.1; ENST00000554581.5; ENST00000402615.6; ENST00000554848.5; ENST00000553797.1; ENST00000407796.6; ENST00000349310.7; ENST00000557494.1
External Link	RMBase: m6A_site_266214
mod ID: M6ASITE021850		Click to Show/Hide the Full List
mod site	chr14:104794298-104794299:-		[29]
Sequence	GCCCGTGTGGGGGTGGGGGGACATCCAGAGGTCTTTGAGTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000349310.7; ENST00000649815.1; ENST00000407796.6; ENST00000555926.1; ENST00000553797.1; ENST00000557494.1; ENST00000402615.6
External Link	RMBase: m6A_site_266215
mod ID: M6ASITE021851		Click to Show/Hide the Full List
mod site	chr14:104794362-104794363:-		[29]
Sequence	ATTTTTACACATGGCTCTGGACAGCTGTCTGACTCTGTCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557494.1; ENST00000555926.1; ENST00000349310.7; ENST00000649815.1; ENST00000553797.1; ENST00000407796.6; ENST00000402615.6
External Link	RMBase: m6A_site_266216
mod ID: M6ASITE021852		Click to Show/Hide the Full List
mod site	chr14:104795035-104795036:-		[29]
Sequence	TGGGAGGGCCCCGGAAGGAGACTTCGTTTCCCACGGACGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000557494.1; ENST00000407796.6; ENST00000649815.1; ENST00000553797.1; ENST00000555926.1
External Link	RMBase: m6A_site_266217
mod ID: M6ASITE021853		Click to Show/Hide the Full List
mod site	chr14:104795735-104795736:-		[29]
Sequence	GGGCCGGCGGCGGCGGCAGGACCGAGCGCGGCAGGCGGCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; GSC-11; HEK293T; HEK293A-TOA; MSC; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000349310.7; ENST00000557494.1
External Link	RMBase: m6A_site_266218

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000054		Click to Show/Hide the Full List
mod site	chr14:104770043-104770044:-		[34]
Sequence	ATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGG
Transcript ID List	ENST00000610370.1; ENST00000555528.5; ENST00000407796.6; ENST00000349310.7; ENST00000554581.5; ENST00000402615.6; ENST00000554192.5; ENST00000555458.5; ENST00000557552.1; ENST00000649815.1; ENST00000553506.5
External Link	RMBase: Pseudo_site_1550

Ref 1	The m6A methyltransferase METTL14 inhibits the proliferation, migration, and invasion of gastric cancer by regulating the PI3K/AKT/mTOR signaling pathway. J Clin Lab Anal. 2021 Mar;35(3):e23655. doi: 10.1002/jcla.23655. Epub 2020 Dec 12.
Ref 2	METTL14 Inhibits Hepatocellular Carcinoma Metastasis Through Regulating EGFR/PI3K/AKT Signaling Pathway in an m6A-Dependent Manner. Cancer Manag Res. 2020 Dec 23;12:13173-13184. doi: 10.2147/CMAR.S286275. eCollection 2020.
Ref 3	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 4	METTL3 mediates bone marrow mesenchymal stem cell adipogenesis to promote chemoresistance in acute myeloid leukaemia. FEBS Open Bio. 2021 Jun;11(6):1659-1672. doi: 10.1002/2211-5463.13165. Epub 2021 May 20.
Ref 5	METTL3 promotes the proliferation and invasion of esophageal cancer cells partly through AKT signaling pathway. Pathol Res Pract. 2020 Sep;216(9):153087. doi: 10.1016/j.prp.2020.153087. Epub 2020 Jun 27.
Ref 6	METTL3 Promotes the Proliferation and Mobility of Gastric Cancer Cells. Open Med (Wars). 2019 Mar 2;14:25-31. doi: 10.1515/med-2019-0005. eCollection 2019.
Ref 7	Methyltransferase-like 3 upregulation is involved in the chemoresistance of non-small cell lung cancer. Ann Transl Med. 2022 Feb;10(3):139. doi: 10.21037/atm-21-6608.
Ref 8	Methyltransferase-like 3 promotes the progression of lung cancer via activating PI3K/AKT/mTOR pathway. Clin Exp Pharmacol Physiol. 2022 Jul;49(7):748-758. doi: 10.1111/1440-1681.13647. Epub 2022 May 23.
Ref 9	METTL3 serves an oncogenic role in human ovarian cancer cells partially via the AKT signaling pathway. Oncol Lett. 2020 Apr;19(4):3197-3204. doi: 10.3892/ol.2020.11425. Epub 2020 Mar 3.
Ref 10	YTHDF2 mediates the mRNA degradation of the tumor suppressors to induce AKT phosphorylation in N6-methyladenosine-dependent way in prostate cancer. Mol Cancer. 2020 Oct 29;19(1):152. doi: 10.1186/s12943-020-01267-6.
Ref 11	The M6A methyltransferase METTL3: acting as a tumor suppressor in renal cell carcinoma. Oncotarget. 2017 Oct 10;8(56):96103-96116. doi: 10.18632/oncotarget.21726. eCollection 2017 Nov 10.
Ref 12	m(6)A methyltransferase METTL3 promotes retinoblastoma progression via PI3K/AKT/mTOR pathway. J Cell Mol Med. 2020 Oct 8;24(21):12368-78. doi: 10.1111/jcmm.15736. Online ahead of print.
Ref 13	ALKBH5-mediated m(6)A demethylation of KCNK15-AS1 inhibits pancreatic cancer progression via regulating KCNK15 and PTEN/AKT signaling. Cell Death Dis. 2021 Dec 1;12(12):1121. doi: 10.1038/s41419-021-04401-4.
Ref 14	BMP2 Modified by the m(6)A Demethylation Enzyme ALKBH5 in the Ossification of the Ligamentum Flavum Through the AKT Signaling Pathway. Calcif Tissue Int. 2020 May;106(5):486-493. doi: 10.1007/s00223-019-00654-6. Epub 2020 Jan 2.
Ref 15	YTHDF1 promotes hepatocellular carcinoma progression via activating PI3K/AKT/mTOR signaling pathway and inducing epithelial-mesenchymal transition. Exp Hematol Oncol. 2021 Jun 4;10(1):35. doi: 10.1186/s40164-021-00227-0.
Ref 16	Trusted, scientifically sound profiles of drug programs, clinical trials, safety reports, and company deals, written by scientists. Springer. 2015. Adis Insight (drug id 800006840)
Ref 17	HNRNPA2B1 regulates tamoxifen- and fulvestrant-sensitivity and hallmarks of endocrine resistance in breast cancer cells. Cancer Lett. 2021 Oct 10;518:152-168. doi: 10.1016/j.canlet.2021.07.015. Epub 2021 Jul 14.
Ref 18	Predicting P-glycoprotein effects on oral absorption: correlation of transport in Caco-2 with drug pharmacokinetics in wild-type and mdr1a(-/-) mice in vivo. Pharm Res. 2004 May;21(5):819-26. doi: 10.1023/b:pham.0000026434.82855.69.
Ref 19	Interaction of gatifloxacin with efflux transporters: a possible mechanism for drug resistance. Int J Pharm. 2010 Aug 16;395(1-2):114-21. doi: 10.1016/j.ijpharm.2010.05.027. Epub 2010 May 24.
Ref 20	N6-methyladenosine reader YTH N6-methyladenosine RNA binding protein 3 or insulin like growth factor 2 mRNA binding protein 2 knockdown protects human bronchial epithelial cells from hypoxia/reoxygenation injury by inactivating p38 MAPK, AKT, ERK1/2, and NF-KappaB pathways. Bioengineered. 2022 May;13(5):11973-11986. doi: 10.1080/21655979.2021.1999550.
Ref 21	m(6)A Reader YTHDC2 Promotes Radiotherapy Resistance of Nasopharyngeal Carcinoma via Activating IGF1R/AKT/S6 Signaling Axis. Front Oncol. 2020 Jul 31;10:1166. doi: 10.3389/fonc.2020.01166. eCollection 2020.
Ref 22	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 23	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 24	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 25	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 26	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 27	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 28	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 29	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 30	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 31	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 32	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 33	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 34	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map