m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00360)

Target Name	Programmed cell death 1 ligand 1 (CD274/PD-L1)
Gene Name	CD274
Chromosomal Location	9p24.1
Family	immunoglobulin superfamily; BTN/MOG family
Function	Plays a critical role in induction and maintenance of immune tolerance to self. As a ligand for the inhibitory receptor PDCD1/PD-1, modulates the activation threshold of T-cells and limits T-cell effector response . Through a yet unknown activating receptor, may costimulate T-cell subsets that predominantly produce interleukin-10 (IL10); The PDCD1-mediated inhibitory pathway is exploited by tumors to attenuate anti-tumor immunity and escape destruction by the immune system, thereby facilitating tumor survival. The interaction with PDCD1/PD-1 inhibits cytotoxic T lymphocytes (CTLs) effector function (By similarity). The blockage of the PDCD1-mediated pathway results in the reversal of the exhausted T-cell phenotype and the normalization of the anti-tumor response, providing a rationale for cancer immunotherapy (By similarity). Click to Show/Hide
Gene ID	29126
Uniprot ID	PD1L1_HUMAN
HGNC ID	HGNC:17635
KEGG ID	hsa:29126

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CD274 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.82E+00 p-value: 4.68E-65
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between CD274 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 7.97E+00	GSE60213

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 intensified the metastasis and proliferation of OSCC by modulating the m6A amounts of PRMT5 and Programmed cell death 1 ligand 1 (CD274/PD-L1).
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma		ICD-11: 2B6E.0	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
In-vivo Model	Six-week-old nude mice were randomly divided into two groups (three mice per group) and cultured with continuous access to sterile food and water in pathogen-free sterile conditions. To establish the OSCC xenograft model, we subcutaneously injected 5 × 10⁶ SCC-9 cells stably transfected with METTL3 shRNA or sh-NC vectors into nude mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Programmed cell death 1 ligand 1 (CD274/PD-L1) was a downstream target of METTL3-mediated m6A modification in breast cancer cells. METTL3-mediated PD-L1 mRNA activation was m6A-IGF2BP3-dependent. PD-L1 expression was also positively correlated with METTL3 and IGF2BP3 expression in breast cancer tissues.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	Tumor immune escape
In-vitro Model	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HCC38	Breast ductal carcinoma	Homo sapiens	CVCL_1267
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For subcutaneous xenograft experiments in B-NDG mice, approximately 1 × 10⁶ MDA-MB-231 and there was subcutaneous injection of the cells that resuspended in 100 uL PBS into the left flank of the mice and were divided into 11 groups randomly (each containing 5 mice). After the treatment Atezolizumab (Selleck, Shanghai, China) or corresponding iso control antibody (Selleck, Shanghai, China) was injected intratumorally on day 3, 6, 9, 12, 15 post-MDA-MB-231 inoculations, and 5 × 10⁶ cytokine-induced killer (CIK) cells were injected in the tail vein on day 7, 14, 21.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3 was essential for bladder cancer cells to resist the cytotoxicity of CD8+ T cells by regulating Programmed cell death 1 ligand 1 (CD274/PD-L1) expression. Additionally, JNK signaling contributed to tumor immune escape in a METTL3-dependent manner both in vitro and in vivo.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
In-vivo Model	Male C57BL/6J mice (6 weeks old) were given drinking water containing 0.05% (w/v) BBN (TCI, catalog no. B0938) for 20 weeks. After the BBN administration, mice were given normal drinking water and injected with 10% DMSO (as a control) or 20 mg/kg SP600125 (Selleck, catalog no. 129-56-6) i.p. every 3 days. After seven injections, mice were euthanized for tissue retrieval. For the bladder cancer cell-derived xenograft mouse model, male C57BL/6J mice (6 weeks old) were injected subcutaneously with 1 × 10⁶ MB49 cells. One week after bladder cancer cell injection, 10% DMSO or 20 mg/kg SP600125 were injected i.p. every 3 days.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 3.22E+00 p-value: 3.45E-05
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[5]
Response Summary	Arecoline-induced FTO promotes the stability and expression levels of Programmed cell death 1 ligand 1 (CD274/PD-L1) transcripts through mediating m6A modification and MYC activity, respectively. PD-L1 upregulation confers superior cell proliferation, migration, and resistance to T-cell killing to OSCC cells.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma	ICD-11: 2B6E.0	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma	ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	143B cell line	Homo sapiens
Treatment: siALKBH5 transfected 143B cells Control: siControl 143B cells		GSE154528
Regulation		logFC: 2.95E+00 p-value: 3.40E-21
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	ALKBH5 as an important m6A demethylase that orchestrates Programmed cell death 1 ligand 1 (CD274/PD-L1) expression in intrahepatic cholangiocarcinoma (ICC).
Target Regulation	Up regulation
Responsed Disease	Intrahepatic cholangiocarcinoma		ICD-11: 2C12.10	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	TFK-1	Cholangiocarcinoma	Homo sapiens	CVCL_2214
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
	LIPF178c (LIPF178c human bile duct cancer cells from China Center for Type Culture Collection (Wuhan, China))
	LIPF155c (LIPF155c human bile duct cancer cells from China Center for Type Culture Collection (Wuhan, China))
	LICCF (LICCF human intrahepatic bile duct cancer cell line from China Center for Type Culture Collection (Wuhan, China))
	HCCC-9810	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_6908
In-vivo Model	ICC tumor cells (LIPF178c-shCtrl/shALKBH5) of 5 × 10⁶ were injected into the right flank of NCG mice. Tumor volume was calculated by the formula: volume = ab2/2 (a, the longer axis; b, the shorter axis). T-cell killing assay in vitro was conducted as previously reported (20). PBMCs from healthy donors were activated and expanded as described above. The day before tumor cell injection, PBMC (i.v. 1 × 10⁷ cells) was adoptively transferred to NCG mice via the tail vein. At the end, the PBMC was isolated and subjected to flow cytometry for detecting T-cell percentage.

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Programmed cell death 1 ligand 1 (CD274/PD-L1) was a downstream target of METTL3-mediated m6A modification in breast cancer cells. METTL3-mediated PD-L1 mRNA activation was m6A-IGF2BP3-dependent. PD-L1 expression was also positively correlated with METTL3 and IGF2BP3 expression in breast cancer tissues.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	Tumor immune escape
In-vitro Model	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HCC38	Breast ductal carcinoma	Homo sapiens	CVCL_1267
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For subcutaneous xenograft experiments in B-NDG mice, approximately 1 × 10⁶ MDA-MB-231 and there was subcutaneous injection of the cells that resuspended in 100 uL PBS into the left flank of the mice and were divided into 11 groups randomly (each containing 5 mice). After the treatment Atezolizumab (Selleck, Shanghai, China) or corresponding iso control antibody (Selleck, Shanghai, China) was injected intratumorally on day 3, 6, 9, 12, 15 post-MDA-MB-231 inoculations, and 5 × 10⁶ cytokine-induced killer (CIK) cells were injected in the tail vein on day 7, 14, 21.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma	ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	Arecoline-induced FTO promotes the stability and expression levels of Programmed cell death 1 ligand 1 (CD274/PD-L1) transcripts through mediating m6A modification and MYC activity, respectively. PD-L1 upregulation confers superior cell proliferation, migration, and resistance to T-cell killing to OSCC cells.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 intensified the metastasis and proliferation of OSCC by modulating the m6A amounts of PRMT5 and Programmed cell death 1 ligand 1 (CD274/PD-L1).
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
In-vivo Model	Six-week-old nude mice were randomly divided into two groups (three mice per group) and cultured with continuous access to sterile food and water in pathogen-free sterile conditions. To establish the OSCC xenograft model, we subcutaneously injected 5 × 10⁶ SCC-9 cells stably transfected with METTL3 shRNA or sh-NC vectors into nude mice.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	WM_Score correlated highly with the regulation of transcription and post-transcriptional events contributing to the development of colorectal cancer. In response to anti-cancer drugs, WM_Score highly negatively correlated (drug sensitive) with drugs which targeted oncogenic related pathways, such as MAPK, EGFR, and mTOR signaling pathways, positively correlated (drug resistance) with drugs which targeted in apoptosis and cell cycle. Importantly, the WM_Score was associated with the therapeutic efficacy of Programmed cell death 1 ligand 1 (CD274/PD-L1) blockade, suggesting that the development of potential drugs targeting these "writers" to aid the clinical benefits of immunotherapy.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Pathway Response	MAPK signaling pathway	hsa04010
	VEGF signaling pathway	hsa04370
	mTOR signaling pathway	hsa04150
	PD-L1 expression and PD-1 checkpoint pathway in cancer	hsa05235
Cell Process	Cell apoptosis

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	ALKBH5 as an important m6A demethylase that orchestrates Programmed cell death 1 ligand 1 (CD274/PD-L1) expression in intrahepatic cholangiocarcinoma (ICC).
Responsed Disease	Intrahepatic cholangiocarcinoma [ICD-11: 2C12.10]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	TFK-1	Cholangiocarcinoma	Homo sapiens	CVCL_2214
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
	LIPF178c (LIPF178c human bile duct cancer cells from China Center for Type Culture Collection (Wuhan, China))
	LIPF155c (LIPF155c human bile duct cancer cells from China Center for Type Culture Collection (Wuhan, China))
	LICCF (LICCF human intrahepatic bile duct cancer cell line from China Center for Type Culture Collection (Wuhan, China))
	HCCC-9810	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_6908
In-vivo Model	ICC tumor cells (LIPF178c-shCtrl/shALKBH5) of 5 × 10⁶ were injected into the right flank of NCG mice. Tumor volume was calculated by the formula: volume = ab2/2 (a, the longer axis; b, the shorter axis). T-cell killing assay in vitro was conducted as previously reported (20). PBMCs from healthy donors were activated and expanded as described above. The day before tumor cell injection, PBMC (i.v. 1 × 10⁷ cells) was adoptively transferred to NCG mice via the tail vein. At the end, the PBMC was isolated and subjected to flow cytometry for detecting T-cell percentage.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235
Experiment 2 Reporting the m6A-centered Disease Response			[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235
Experiment 3 Reporting the m6A-centered Disease Response			[2]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235

Breast cancer [ICD-11: 2C60]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	Programmed cell death 1 ligand 1 (CD274/PD-L1) was a downstream target of METTL3-mediated m6A modification in breast cancer cells. METTL3-mediated PD-L1 mRNA activation was m6A-IGF2BP3-dependent. PD-L1 expression was also positively correlated with METTL3 and IGF2BP3 expression in breast cancer tissues.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	Tumor immune escape
In-vitro Model	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HCC38	Breast ductal carcinoma	Homo sapiens	CVCL_1267
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For subcutaneous xenograft experiments in B-NDG mice, approximately 1 × 10⁶ MDA-MB-231 and there was subcutaneous injection of the cells that resuspended in 100 uL PBS into the left flank of the mice and were divided into 11 groups randomly (each containing 5 mice). After the treatment Atezolizumab (Selleck, Shanghai, China) or corresponding iso control antibody (Selleck, Shanghai, China) was injected intratumorally on day 3, 6, 9, 12, 15 post-MDA-MB-231 inoculations, and 5 × 10⁶ cytokine-induced killer (CIK) cells were injected in the tail vein on day 7, 14, 21.
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	Programmed cell death 1 ligand 1 (CD274/PD-L1) was a downstream target of METTL3-mediated m6A modification in breast cancer cells. METTL3-mediated PD-L1 mRNA activation was m6A-IGF2BP3-dependent. PD-L1 expression was also positively correlated with METTL3 and IGF2BP3 expression in breast cancer tissues.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	Tumor immune escape
In-vitro Model	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HCC38	Breast ductal carcinoma	Homo sapiens	CVCL_1267
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For subcutaneous xenograft experiments in B-NDG mice, approximately 1 × 10⁶ MDA-MB-231 and there was subcutaneous injection of the cells that resuspended in 100 uL PBS into the left flank of the mice and were divided into 11 groups randomly (each containing 5 mice). After the treatment Atezolizumab (Selleck, Shanghai, China) or corresponding iso control antibody (Selleck, Shanghai, China) was injected intratumorally on day 3, 6, 9, 12, 15 post-MDA-MB-231 inoculations, and 5 × 10⁶ cytokine-induced killer (CIK) cells were injected in the tail vein on day 7, 14, 21.

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	m6A-related prognostic lncRNA signature serves as a crucial mediator of the immune microenvironment in bladder cancer, representing promising therapeutic targets for improving immunotherapeutic efficacy. Cluster 1 was significantly correlated with poor prognosis, advanced clinical stage, higher Programmed cell death 1 ligand 1 (CD274/PD-L1) expression, a higher ESTIMATEScore and immuneScore, and distinct immune cell infiltration.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Pathway Response	JAK-STAT signaling pathway			hsa04630
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235

Cell Process	Cell apoptosis
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3 was essential for bladder cancer cells to resist the cytotoxicity of CD8+ T cells by regulating Programmed cell death 1 ligand 1 (CD274/PD-L1) expression. Additionally, JNK signaling contributed to tumor immune escape in a METTL3-dependent manner both in vitro and in vivo.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
In-vitro Model	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
In-vivo Model	Male C57BL/6J mice (6 weeks old) were given drinking water containing 0.05% (w/v) BBN (TCI, catalog no. B0938) for 20 weeks. After the BBN administration, mice were given normal drinking water and injected with 10% DMSO (as a control) or 20 mg/kg SP600125 (Selleck, catalog no. 129-56-6) i.p. every 3 days. After seven injections, mice were euthanized for tissue retrieval. For the bladder cancer cell-derived xenograft mouse model, male C57BL/6J mice (6 weeks old) were injected subcutaneously with 1 × 10⁶ MB49 cells. One week after bladder cancer cell injection, 10% DMSO or 20 mg/kg SP600125 were injected i.p. every 3 days.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03149		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EHMT2 (EHMT2)
Regulated Target	Histone H3 lysine 9 dimethylation (H3K9me2)
Crosstalk relationship	Histone modification → m6A
Disease	Inflammatory response	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03479		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Pancreatic cancer	Disease Info

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05239		Crosstalk Info
Epigenetic Regulator	hsa-miR-607
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05253		Crosstalk Info
Epigenetic Regulator	hsa_circ_0072309 (Circ_LIFR)
Regulated Target	hsa-miR-607
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05923		Crosstalk Info
Epigenetic Regulator	hsa_circ_0058493 (Circ_RHBDD1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00360)

Programmed cell death 1 ligand 1 (CD274/PD-L1)

N6-methyladenosine (m6A)

In total 20 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087596		Click to Show/Hide the Full List
mod site	chr9:5457102-5457103:+		[17]
Sequence	TACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; fibroblasts; LCLs; Huh7; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000498261.1; ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815416
mod ID: M6ASITE087597		Click to Show/Hide the Full List
mod site	chr9:5457163-5457164:+		[17]
Sequence	TGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; fibroblasts; GM12878; LCLs; Huh7; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000498261.1; ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815417
mod ID: M6ASITE087598		Click to Show/Hide the Full List
mod site	chr9:5457171-5457172:+		[17]
Sequence	CCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCT
Motif Score	2.876744048
Cell/Tissue List	HEK293T; fibroblasts; GM12878; LCLs; Huh7; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000498261.1; ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815418
mod ID: M6ASITE087599		Click to Show/Hide the Full List
mod site	chr9:5457213-5457214:+		[17]
Sequence	TTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATG
Motif Score	2.951386905
Cell/Tissue List	fibroblasts; GM12878; LCLs; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381577.4; ENST00000381573.8; ENST00000498261.1
External Link	RMBase: m6A_site_815419
mod ID: M6ASITE087600		Click to Show/Hide the Full List
mod site	chr9:5457243-5457244:+		[17]
Sequence	ATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTA
Motif Score	2.876744048
Cell/Tissue List	fibroblasts; GM12878; LCLs; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498261.1; ENST00000381577.4; ENST00000381573.8
External Link	RMBase: m6A_site_815420
mod ID: M6ASITE087601		Click to Show/Hide the Full List
mod site	chr9:5457271-5457272:+		[17]
Sequence	GTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAA
Motif Score	2.897386905
Cell/Tissue List	fibroblasts; GM12878; LCLs; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381577.4; ENST00000498261.1; ENST00000381573.8
External Link	RMBase: m6A_site_815421
mod ID: M6ASITE087602		Click to Show/Hide the Full List
mod site	chr9:5457294-5457295:+		[18]
Sequence	GAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATG
Motif Score	3.622404762
Cell/Tissue List	GM12878; LCLs; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381573.8; ENST00000498261.1; ENST00000381577.4
External Link	RMBase: m6A_site_815422
mod ID: M6ASITE087603		Click to Show/Hide the Full List
mod site	chr9:5462888-5462889:+		[19]
Sequence	GTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGC
Motif Score	2.951386905
Cell/Tissue List	LCLs; CD4T
Seq Type List	m6A-seq
Transcript ID List	ENST00000381573.8; ENST00000381577.4; ENST00000498261.1; ENST00000474218.1
External Link	RMBase: m6A_site_815423
mod ID: M6ASITE087604		Click to Show/Hide the Full List
mod site	chr9:5462894-5462895:+		[19]
Sequence	CCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGG
Motif Score	3.373380952
Cell/Tissue List	LCLs; CD8T; CD4T
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000381573.8; ENST00000474218.1; ENST00000381577.4; ENST00000498261.1
External Link	RMBase: m6A_site_815424
mod ID: M6ASITE087605		Click to Show/Hide the Full List
mod site	chr9:5462898-5462899:+		[20]
Sequence	TCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000474218.1; ENST00000381573.8; ENST00000498261.1; ENST00000381577.4
External Link	RMBase: m6A_site_815425
mod ID: M6ASITE087606		Click to Show/Hide the Full List
mod site	chr9:5462940-5462941:+		[17]
Sequence	CCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC
Motif Score	3.643047619
Cell/Tissue List	fibroblasts; LCLs; CD4T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000492923.1; ENST00000381577.4; ENST00000381573.8; ENST00000498261.1; ENST00000474218.1
External Link	RMBase: m6A_site_815426
mod ID: M6ASITE087607		Click to Show/Hide the Full List
mod site	chr9:5462973-5462974:+		[17]
Sequence	ATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAG
Motif Score	2.876744048
Cell/Tissue List	fibroblasts; LCLs; CD4T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000492923.1; ENST00000381573.8; ENST00000474218.1; ENST00000381577.4; ENST00000498261.1
External Link	RMBase: m6A_site_815427
mod ID: M6ASITE087608		Click to Show/Hide the Full List
mod site	chr9:5466811-5466812:+		[17]
Sequence	ATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGGTA
Motif Score	2.627720238
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000381573.8; ENST00000381577.4; ENST00000498261.1
External Link	RMBase: m6A_site_815428
mod ID: M6ASITE087609		Click to Show/Hide the Full List
mod site	chr9:5467874-5467875:+		[17]
Sequence	AGACGTAATCCAGCATTGGAACTTCTGATCTTCAAGCAGGG
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; GM12878; LCLs; Huh7; CD4T; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381577.4; ENST00000381573.8
External Link	RMBase: m6A_site_815429
mod ID: M6ASITE087610		Click to Show/Hide the Full List
mod site	chr9:5467979-5467980:+		[21]
Sequence	TGGGATGCAGGCAATGTGGGACTTAAAAGGCCCAAGCACTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; fibroblasts; GM12878; LCLs; CD8T; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815430
mod ID: M6ASITE087611		Click to Show/Hide the Full List
mod site	chr9:5468008-5468009:+		[21]
Sequence	GCCCAAGCACTGAAAATGGAACCTGGCGAAAGCAGAGGAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; A549; fibroblasts; GM12878; LCLs; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815431
mod ID: M6ASITE087612		Click to Show/Hide the Full List
mod site	chr9:5468052-5468053:+		[21]
Sequence	ATGAAGAAAGATGGAGTCAAACAGGGAGCCTGGAGGGAGAC
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; fibroblasts; GM12878; LCLs; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815432
mod ID: M6ASITE087613		Click to Show/Hide the Full List
mod site	chr9:5468071-5468072:+		[21]
Sequence	AACAGGGAGCCTGGAGGGAGACCTTGATACTTTCAAATGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; fibroblasts; GM12878; LCLs; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381577.4; ENST00000381573.8
External Link	RMBase: m6A_site_815433
mod ID: M6ASITE087614		Click to Show/Hide the Full List
mod site	chr9:5468138-5468139:+		[21]
Sequence	GGGAGAAAGGATACTTCTGAACAAGGAGCCTCCAAGCAAAT
Motif Score	2.951386905
Cell/Tissue List	A549; fibroblasts; GM12878; LCLs; CD4T; GSC-11; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381573.8; ENST00000381577.4
External Link	RMBase: m6A_site_815434
mod ID: M6ASITE087615		Click to Show/Hide the Full List
mod site	chr9:5468294-5468295:+		[17]
Sequence	AGTCTCAGTGTTGGAACGGGACAGTATTTATGTATGAGTTT
Motif Score	3.643047619
Cell/Tissue List	fibroblasts; GM12878; LCLs; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381577.4; ENST00000381573.8
External Link	RMBase: m6A_site_815435

Ref 1	METTL3 Intensifies the Progress of Oral Squamous Cell Carcinoma via Modulating the m6A Amount of PRMT5 and PD-L1. J Immunol Res. 2021 Aug 23;2021:6149558. doi: 10.1155/2021/6149558. eCollection 2021.
Ref 2	Correlation of m6A methylation with immune infiltrates and poor prognosis in non-small cell lung cancer via a comprehensive analysis of RNA expression profiles. Ann Transl Med. 2021 Sep;9(18):1465. doi: 10.21037/atm-21-4248.
Ref 3	METTL3/IGF2BP3 axis inhibits tumor immune surveillance by upregulating N(6)-methyladenosine modification of PD-L1 mRNA in breast cancer. Mol Cancer. 2022 Feb 23;21(1):60. doi: 10.1186/s12943-021-01447-y.
Ref 4	JNK Signaling Promotes Bladder Cancer Immune Escape by Regulating METTL3-Mediated m6A Modification of PD-L1 mRNA. Cancer Res. 2022 May 3;82(9):1789-1802. doi: 10.1158/0008-5472.CAN-21-1323.
Ref 5	Fat mass and obesity-associated protein regulates arecoline-exposed oral cancer immune response through programmed cell death-ligand 1. Cancer Sci. 2022 Mar 15. doi: 10.1111/cas.15332. Online ahead of print.
Ref 6	M(6)A Demethylase ALKBH5 Regulates PD-L1 Expression and Tumor Immunoenvironment in Intrahepatic Cholangiocarcinoma. Cancer Res. 2021 Sep 15;81(18):4778-4793. doi: 10.1158/0008-5472.CAN-21-0468. Epub 2021 Jul 23.
Ref 7	HT29-MTX and Caco-2/TC7 monolayers as predictive models for human intestinal absorption: role of the mucus layer. J Pharm Sci. 2001 Oct;90(10):1608-19. doi: 10.1002/jps.1111.
Ref 8	Conversion of highly malignant colon cancer from an aggressive to a controlled disease by oral administration of a metalloproteinase inhibitor. Clin Exp Metastasis. 1997 Mar;15(2):184-95. doi: 10.1023/a:1018461112732.
Ref 9	Metformin/Repaglinide (PrandiMet) for type 2 diabetes. Med Lett Drugs Ther. 2009 Jun 1;51(1313):41-3.
Ref 10	Purification and properties of 5,10-methylenetetrahydrofolate reductase, an iron-sulfur flavoprotein from Clostridium formicoaceticum. J Biol Chem. 1984 Sep 10;259(17):10845-9.
Ref 11	Tarloxotinib Is a Hypoxia-Activated Pan-HER Kinase Inhibitor Active Against a Broad Range of HER-Family Oncogenes. Clin Cancer Res. 2021 Mar 1;27(5):1463-1475. doi: 10.1158/1078-0432.CCR-20-3555. Epub 2020 Dec 22.
Ref 12	A phase 1 open-label trial shows that smad7 antisense oligonucleotide (GED0301) does not increase the risk of small bowel strictures in Crohn's disease. Aliment Pharmacol Ther. 2012 Nov;36(9):850-7. doi: 10.1111/apt.12051.
Ref 13	US patent application no. 6,133,032, Antisense modulation of PI3 kinase p110 beta expression.
Ref 14	Clinical pipeline report, company report or official report of Shionogi (2011).
Ref 15	Contribution of the drug transporter ABCG2 (breast cancer resistance protein) to resistance against anticancer nucleosides. Mol Cancer Ther. 2008 Sep;7(9):3092-102. doi: 10.1158/1535-7163.MCT-08-0427. Epub 2008 Sep 2.
Ref 16	Trusted, scientifically sound profiles of drug programs, clinical trials, safety reports, and company deals, written by scientists. Springer. 2015. Adis Insight (drug id 800032947)
Ref 17	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 18	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 19	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 20	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 21	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map