m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00341)
Target Name Myc proto-oncogene protein (MYC)
Synonyms
Class E basic helix-loop-helix protein 39; bHLHe39; Proto-oncogene c-Myc; Transcription factor p64; BHLHE39
    Click to Show/Hide
Gene Name MYC
Chromosomal Location 8q24.21
Function
Transcription factor that binds DNA in a non-specific manner, yet also specifically recognizes the core sequence 5'-CAC[GA]TG-3'. Activates the transcription of growth-related genes. Binds to the VEGFA promoter, promoting VEGFA production and subsequent sprouting angiogenesis. Regulator of somatic reprogramming, controls self-renewal of embryonic stem cells (By similarity). Functions with TAF6L to activate target gene expression through RNA polymerase II pause release (By similarity). Positively regulates transcription of HNRNPA1, HNRNPA2 and PTBP1 which in turn regulate splicing of pyruvate kinase PKM by binding repressively to sequences flanking PKM exon 9, inhibiting exon 9 inclusion and resulting in exon 10 inclusion and production of the PKM M2 isoform.
    Click to Show/Hide
Gene ID 4609
Uniprot ID
MYC_HUMAN
HGNC ID
HGNC:7553
KEGG ID
hsa:4609
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MYC can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LNCaP cell line Homo sapiens
Treatment: shMETTL3 LNCaP cells
Control: shControl LNCaP cells
 GSE147884
Regulation
logFC: -6.39E-01
p-value: 4.30E-103
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MYC and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 1.10E+00 GSE60213
In total 12 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of Myc proto-oncogene protein (MYC), BCL2 and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Cell Process Cell differentiation and apoptosis
Apoptosis (hsa04210)
In-vitro Model HSPC (Human hematopoietic stem cell)
In-vivo Model 500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 level was slightly increased in AML-M5 patients,and its expression was significantly higher in immature cells than in mature monocytes.METTL3 acts as an oncogene in MOLM13 cells by upregulating Myc proto-oncogene protein (MYC) expression.
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Cell Process Cell proliferation
In-vitro Model MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary In oral squamous cell carcinoma, YTH N6-methyladenosine RNA binding protein 1 (YTH domain family, member 1 [YTHDF1]) mediated the m6A-increased stability of Myc proto-oncogene protein (MYC) mRNA catalyzed by METTL3.
Target Regulation Up regulation
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E.0
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
NHOK (Normal oral keratinocytes)
SCC-15 Tongue squamous cell carcinoma Homo sapiens CVCL_1681
SCC-25 Tongue squamous cell carcinoma Homo sapiens CVCL_1682
TSCCa Endocervical adenocarcinoma Homo sapiens CVCL_VL15
In-vivo Model The stable transfection of SCC25 cells (1 × 107 cells in 0.1 mL) with lenti-sh-METTL3 or blank vectors was injected subcutaneously into BALB/c nude mice.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [4]
Response Summary In gastric cancer, several component molecules (e.g., MCM5, MCM6, etc.) of Myc proto-oncogene protein (MYC) target genes were mediated by METTL3 via altered m6A modification.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model GES-1 Normal Homo sapiens CVCL_EQ22
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
MGC-803 Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
pGCC (Primary GC cells)
SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
In-vivo Model A total of 2 × 106 GC cells were injected into the flank of nude mice in a 1:1 suspension of BD Matrigel (BD Biosciences) in phosphate-buffered saline (PBS) solution.
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene [5]
Response Summary METTL3 enhanced Myc proto-oncogene protein (MYC) m6A methylation and increased MYC translation, which could potentiate the proliferation, migration and invasion of gastric cancer cells.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
AZ-521 Duodenal adenocarcinoma Homo sapiens CVCL_2862
GES-1 Normal Homo sapiens CVCL_EQ22
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
In-vivo Model The GC cell line MKN-45 stably infected with lentivirus expressing sh-HBXIP was prepared into 5 × 107 cells/mL cell suspension.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene [5]
Response Summary Expressions of HBXIP, METTL3 and Myc proto-oncogene protein (MYC) were all determined to be upregulated in both GC tissues and cells. HBXIP plays an oncogenic role in GC via METTL3-mediated MYC mRNA m6A modification.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
GES-1 Normal Homo sapiens CVCL_EQ22
AZ-521 Duodenal adenocarcinoma Homo sapiens CVCL_2862
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model The GC cell line MKN-45 stably infected with lentivirus expressing sh-HBXIP was prepared into 5 × 107 cells/mL cell suspension. The cell suspension was injected into the left axilla of nude mice using a 1 mL syringe as the sh-HBXIP group (n = 6). The GC cell line MKN-45 infected with the lentivirus expressing sh-NC was dispersed into the cell suspension, which was injected into nude mice as the sh-NC group (n = 6). Tumor growth was observed and data were recorded after inoculation. On the 26th day, all nude mice were euthanized by cervical dislocation and the tumors were resected and weighed.
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene [6]
Response Summary METTL3 exerted its function through enhancing Myc proto-oncogene protein (MYC) expression, at least partially in an m6A-IGF2BP1-dependent manner. Knockdown of METTL3 suppressed colorectal cancer cell proliferation in vitro and in vivo.
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Cell Process Cell proliferation
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
Caco-2 Colon adenocarcinoma Homo sapiens CVCL_0025
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HT29 Colon cancer Mus musculus CVCL_A8EZ
LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model METTL3 stable knockdown or overexpression HCT116 cells were collected and resuspended at a density of 5 × 106 or 3 × 106 cells per 150 uL PBS.
Experiment 8 Reporting the m6A Methylation Regulator of This Target Gene [7]
Response Summary LCAT3 upregulation is attributable to N6-methyladenosine (m6A) modification mediated by methyltransferase like 3 (METTL3), leading to LCAT3 stabilization. LCAT3 as a novel oncogenic lncRNA in the lung, and validated the LCAT3-FUBP1-Myc proto-oncogene protein (MYC) axis as a potential therapeutic target for lung adenocarcinomas.
Target Regulation Up regulation
Responsed Disease Lung adenocarcinoma ICD-11: 2C25.0
 Disease Info 
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
Calu-1 Lung squamous cell carcinoma Homo sapiens CVCL_0608
HEK293T Normal Homo sapiens CVCL_0063
HOP-62 Lung adenocarcinoma Homo sapiens CVCL_1285
In-vivo Model For the in vivo tumorigenicity assay, female BALB/c nude mice (ages 4-5 weeks) were randomly divided into two groups (n = 6/group). Calu1 cells (4 × 106) that had been stably transfected with sh-LCAT3 or scramble were implanted subcutaneously into the nude mice. Tumor growth was measured after one week, and tumor volumes were calculated with the following formula: Volume (cm3) = (length × width2)/2. After four weeks, the mice were euthanized, and the tumors were collected and weighed. For the in vivo tumor invasion assay, 1.2 × 106 scramble or shLCAT3 cells were injected intravenously into the tail vein of nude mice (n = 6/group). 1.5 mg luciferin (Gold Biotech, St Louis, MO, USA) was administered once a week for 4 weeks, to monitor metastases using an IVIS@ Lumina II system (Caliper Life Sciences, Hopkinton, MA, USA).
Experiment 9 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Experiment 10 Reporting the m6A Methylation Regulator of This Target Gene [9]
Response Summary METTL3 enhanced Myc proto-oncogene protein (MYC) expression by increasing m6A levels of MYC mRNA transcript, leading to oncogenic functions in prostate cancer.
Target Regulation Up regulation
Responsed Disease Prostate cancer ICD-11: 2C82
 Disease Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model LNCaP C4-2 Prostate carcinoma Homo sapiens CVCL_4782
DU145 Prostate carcinoma Homo sapiens CVCL_0105
LNCaP Prostate carcinoma Homo sapiens CVCL_0395
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
Experiment 11 Reporting the m6A Methylation Regulator of This Target Gene [10]
Response Summary AF4/FMR2 family member 4 (AFF4), two key regulators of NF-Kappa-B pathway (IKBKB and RELA) and Myc proto-oncogene protein (MYC) were further identified as direct targets of METTL3-mediated m6A modification.overexpression of METTL3 significantly promoted Bladder cancer cell growth and invasion.
Target Regulation Up regulation
Responsed Disease Bladder cancer ICD-11: 2C94
 Disease Info 
Cell Process Glucose metabolism
Experiment 12 Reporting the m6A Methylation Regulator of This Target Gene [11]
Response Summary Mettl3 activates the cyst-promoting c-Myc and cAMP pathways through enhanced Myc proto-oncogene protein (MYC) and Avpr2 mRNA m6A modification and translation. Thus, Mettl3 promotes Autosomal dominant polycystic kidney disease and links methionine utilization to epitranscriptomic activation of proliferation and cyst growth.
Target Regulation Up regulation
Responsed Disease Polycystic kidney disease ICD-11: GB81
 Disease Info 
In-vitro Model mIMCD-3 Normal Mus musculus CVCL_0429
In-vivo Model The clone, with one wild-type Mettl3 allele and one L1L2_Bact_P cassette inserted allele, was injected into C57BL/6 blastocysts. Mettl3-targeted mouse line was established from a germline-transmitting chimera. The chimeric mouse was crossed to C57BL/6 Flp mice to excise the neomycin resistance system.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line Embryonic stem cells Mus musculus
Treatment: YTHDF1-/- mESCs
Control: Wild type ESCs
 GSE147849
Regulation
logFC: -1.55E+00
p-value: 2.76E-03
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MYC and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.21E+00 GSE63591
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary In oral squamous cell carcinoma, YTH N6-methyladenosine RNA binding protein 1 (YTH domain family, member 1 [YTHDF1]) mediated the m6A-increased stability of Myc proto-oncogene protein (MYC) mRNA catalyzed by METTL3.
Target Regulation Up regulation
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E.0
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
NHOK (Normal oral keratinocytes)
SCC-15 Tongue squamous cell carcinoma Homo sapiens CVCL_1681
SCC-25 Tongue squamous cell carcinoma Homo sapiens CVCL_1682
TSCCa Endocervical adenocarcinoma Homo sapiens CVCL_VL15
In-vivo Model The stable transfection of SCC25 cells (1 × 107 cells in 0.1 mL) with lenti-sh-METTL3 or blank vectors was injected subcutaneously into BALB/c nude mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2
Cell Line GSC11 cell line Homo sapiens
Treatment: siYTHDF2 GSC11 cells
Control: siControl GSC11 cells
 GSE142825
Regulation
logFC: 8.94E-01
p-value: 8.57E-07
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MYC and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.40E+00 GSE49339
In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Target Regulation Up regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Responsed Drug Linsitinib Phase 3
 Drug Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [12]
Response Summary The IGF1/IGF1R inhibitor, linsitinib for further investigation based upon the role of the IGF pathway member, IGFBP3, as a downstream effector of YTHDF2-Myc proto-oncogene protein (MYC) axis in GSCs. Inhibiting glioblastoma stem cells viability without affecting NSCs and impairing in vivo glioblastoma growth.
Target Regulation Up regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
Responsed Drug Linsitinib Phase 3
 Drug Info 
In-vitro Model NSC11 (Pluripotent derived neural progenitor cell)
NHA (Normal human astrocytes)
HNP1 (A human neural progenitor cell)
ENSA (A human embryonic stem derived neural progenitor cell)
In-vivo Model Implanting 5000 human derived GSCs into the right cerebral cortex of NSG mice at a depth of 3.5 mm under a University of California, San Diego Institutional Animal Care and Use Committee (IACUC) approved protocol. Brains were harvested and fixed in 4% formaldehyde, cryopreserved in 30% sucrose, and then cryosectioned. Hematoxylin and eosin (H&E) staining was performed on sections for histological analysis. In parallel survival experiments, mice were observed until the development of neurological signs. For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above. Mice recovered for 7 days were randomly assigned into drug vs. treatment group by a blinded investigator. Mice were then treated daily with either vehicle (25 mM Tartaric acid) or 50 mg/kg linsitinib by oral gavage.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [13]
Response Summary LCAT3 upregulation is attributable to m6A modification mediated by METTL3, leading to LCAT3 stabilization. Treated cells with tamoxifen to induce MYC activity. Highlights the therapeutic potential of RBPs by uncovering a critical role for YTHDF2 in counteracting the global increase of mRNA synthesis in Myc proto-oncogene protein (MYC)-driven breast cancers.
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Responsed Drug Tamoxifen Approved
 Drug Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Epithelial-to-mesenchymal transition
Cell apoptosis
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MBA-MD-231 (Human breast cancer cell)
MYC-ER HMEC (Human mammary epithelial cells expressing a MYC estrogen receptor fusion)
SK-BR-3 Breast adenocarcinoma Homo sapiens CVCL_0033
In-vivo Model To induce recombination at 8 weeks of age both CAG-CreERT;Ythdf2fl/fl and Ythdf2fl/fl littermates were injected with 75mg/kg body weight tamoxifen dissolved in corn oil daily for 5 days.
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line NB4 cell line Homo sapiens
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
 GSE103494
Regulation
logFC: -6.81E-01
p-value: 3.45E-03
More Results Click to View More RNA-seq Results
In total 8 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Target Regulation Down regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Responsed Drug R-2HG Investigative
 Drug Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [15]
Response Summary Wnt/Beta-catenin-mediated FTO downregulation and underscored the role of m6A modifications of Myc proto-oncogene protein (MYC) mRNA in regulating tumor cell glycolysis and growth.
Target Regulation Down regulation
Responsed Disease Solid tumour/cancer ICD-11: 2A00-2F9Z
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
Central carbon metabolism in cancer hsa05230
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glycolysis
In-vitro Model NCI-H322 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1556
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Mice were randomized into several groups. For the subcutaneous implantation model, 1 × 106 cells were injected subcutaneously into the flank regions of female BALB/c nude mice (4-5 weeks). For lung colonization assays, 1 × 106 cells were injected into the tail vein of female NOD/SCID mice (6-7 weeks), and 6 weeks later the lung was removed and fixed with 10% formalin.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Target Regulation Down regulation
Responsed Disease Leukaemia ICD-11: 2B33.4
 Disease Info 
Responsed Drug R-2HG Investigative
 Drug Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [16]
Response Summary MiR-96 antagomir could potentially retard the cancerogenesis in colorectal cancer via AMPK-alpha-2-dependent inhibition of FTO and blocking FTO-mediated m6A modification of Myc proto-oncogene protein (MYC).
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model RC cells SW480 at logarithmic growth phase were prepared into cell suspension with a concentration of about 1 × 107/100 L, which was then injected into the left axilla of nude mice with a 1 ml syringe to establish a subcutaneous mouse xenograft model. Once the tumor volume reached about 50 mm3, the nude mice were injected with miR-96 antagomir or NC antagomir (10 nmol once every 5 days for 5 weeks). After 5 weeks, the mice were euthanized, after which the subcutaneous transplanted tumor was removed, and weighed.
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene [17]
Response Summary GSK3beta inhibited MZF1 expression by mediating FTO-regulated m6A modification of MZF1 and then decreased the proto-oncogene Myc proto-oncogene protein (MYC) expression, thus hampering CRC cell proliferation.
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120
Cell Process Cell proliferation
In-vitro Model SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
In-vivo Model Twenty-four specific pathogen free female BALB/c nude mice (age: 6 weeks, weight: 15 ~ 18 g) were purchased from Slac Laboratory Animal Co., Ltd., and subcutaneously injected with SW620 cells stably transfected with oe-NC, oe-GSK3-Beta + oe-NC, or oe-GSK3-Beta + oe-c-Myc to establish a subcutaneous xenograft tumour model in nude mice.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene [18]
Response Summary FTO has been indicated to interact with Myc proto-oncogene protein (MYC) proto-oncogene, bHLH transcription factor and to enhance its stability by decreasing its m6A level.the aforementioned observations indicate a novel mechanism for the regulation of pancreatic cancer cells by FTO.
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Cell Process Cell proliferation
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
HPDE Normal Homo sapiens CVCL_4376
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
SW1990 Pancreatic adenocarcinoma Homo sapiens CVCL_1723
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Experiment 8 Reporting the m6A Methylation Regulator of This Target Gene [19]
Response Summary FTO interacts with transcripts of E2F1 and Myc proto-oncogene protein (MYC), inhibition of FTO significantly impairs the translation efficiency of E2F1 and Myc.FTO plays important oncogenic role in regulating cervical cancer cells' proliferation.
Target Regulation Up regulation
Responsed Disease Cervical cancer ICD-11: 2C77
 Disease Info 
Cell Process Cell proliferation and migration
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1
Cell Line HepG2 cell line Homo sapiens
Treatment: siIGF2BP1 HepG2 cells
Control: siControl HepG2 cells
 GSE161086
Regulation
logFC: -9.94E-01
p-value: 1.72E-04
More Results Click to View More RNA-seq Results
In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [20]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of Myc proto-oncogene protein (MYC) and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [21]
Response Summary IGF2BP1 upregulated in GC tissue and acted as a predictor of poor prognosis for GC patients. IGF2BP1 directly interacted with Myc proto-oncogene protein (MYC) mRNA via m6A-dependent manner to by stabilize its stability.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Central carbon metabolism in cancer hsa05230
Glycolysis / Gluconeogenesis hsa00010
Cell Process Aerobic glycolysis
In-vitro Model SNU-216 Gastric tubular adenocarcinoma Homo sapiens CVCL_3946
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
GES-1 Normal Homo sapiens CVCL_EQ22
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model A total of 5 × 106 transfected MKN-45 cells, stably transfected with sh-IGF2BP1 vector or empty vector were subcutaneously injected into the flank of the mice. Tumor growth was measured every three days, and calculated using the following equation = a × b2/2 (a for longitudinal diameter; and b for latitudinal diameter). Three weeks after injection, mice were sacrificed.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [22]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including Myc proto-oncogene protein (MYC), FSCN1, TK1, and MARCKSL1, exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [23]
Response Summary Hypoxia-induced lncRNA KB-1980E6.3 is involved in the self-renewal and stemness maintenance of breast cancer stem cells by recruiting IGF2BP1 to regulate Myc proto-oncogene protein (MYC) mRNA stability.
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response Signaling pathways regulating pluripotency of stem cells hsa04550
In-vitro Model BT-474 Invasive breast carcinoma Homo sapiens CVCL_0179
BT-549 Invasive breast carcinoma Homo sapiens CVCL_1092
HEK293T Normal Homo sapiens CVCL_0063
Hs 578T Invasive breast carcinoma Homo sapiens CVCL_0332
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-453 Breast adenocarcinoma Homo sapiens CVCL_0418
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
T-47D Invasive breast carcinoma Homo sapiens CVCL_0553
In-vivo Model The enriched mammosphere cells derived from engineered BT549 and Hs578T with silenced lncRNA KB-1980E6.3 (shKB/vector), BT549, and Hs578T with lncRNA KB-1980E6.3 knockdown combined with ectopic c-Myc (shKB/c-Myc), BT549, and Hs578T with silenced IGF2BP1 (shIGF2BP1/vector), BT549, and Hs578T with knocked down IGF2BP1 combined with ectopic c-Myc (shIGF2BP1/c-Myc), and BT549, and Hs578T/shNC/vector control cells were used in Xenograft experiments. Three doses (1 × 105, 1 × 104 and 1 × 103) of spheres derived from the engineered Hs578T and 1 × 105 of spheres derived from the engineered BT549 were subcutaneously inoculated into 4- to 6-week-old female nude mice (n = 5 per group). Mice were then treated with either bevacizumab (10 mg/kg every 3 days) to form a hypoxic tumor microenvironment or vehicle PBS to form a non-hypoxic condition.
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line MDA-MB-231 Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells
Control: MDA-MB-231 cells
 GSE81164
Regulation
logFC: 1.27E+00
p-value: 6.21E-24
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [24]
Response Summary METTL14 in normal myelopoiesis and AML pathogenesis, as featured by blocking myeloid differentiation and promoting self-renewal of normal HSPCs and LSCs/LICs. METTL14 exerts its oncogenic role by regulating its mRNA targets (e.g., MYB and Myc proto-oncogene protein (MYC)) through m6A modification, while the protein itself is negatively regulated by SPI1.
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Cell Process Cell survival/proliferation
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
HSPC (Human hematopoietic stem cell)
MNC (Cord blood pluripotent stem cells)
OP9 Normal Mus musculus CVCL_4398
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model Lin- HSPCs were purified from BM of wildtype mice and 0.1×106 cells were seeded in 2 mL OP9 medium onto the OP9 cells with the addition of 10 ng/mL mouse IL-3, 10 ng/mL human IL-6, 10 ng/mL mouse IL-7, 10 ng/mL mouse Flt-3L, and 50 ng/mL mouse stem cell factor (SCF).
Methyltransferase-like 5 (METTL5) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL5
Cell Line Mouse liver cells Mus musculus
Treatment: METTL5 knockout liver cells
Control: WT liver cells
 GSE174418
Regulation
logFC: 2.11E+00
p-value: 1.69E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [25]
Response Summary The study revealed important roles for METTL5 in the development of pancreatic cancer and present the METTL5/Myc proto-oncogene protein (MYC) axis as a novel therapeutic strategy for treatment.
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
Wilms tumor 1-associating protein (WTAP) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by WTAP
Cell Line mice hepatocyte Mus musculus
Treatment: Wtap Hknockout mice hepatocyte
Control: Wtap flox/flox mice hepatocyte
 GSE168850
Regulation
logFC: 2.89E+00
p-value: 1.82E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [26]
Response Summary WTAP made acute myeloid leukemia cells resistant to daunorubicin. In further investigations, m6A methylation level was downregulated when knocking down WTAP, and Myc proto-oncogene protein (MYC) was upregulated due to the decreased m6A methylation of MYC mRNA.
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Responsed Drug Daunorubicin Approved
 Drug Info 
Cell Process Cell cycle
Cell proliferation
Cell apoptosis
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
 Regulator Info 
In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [20]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of Myc proto-oncogene protein (MYC) and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [54]
Response Summary LINRIS blocked K139 ubiquitination of IGF2BP2, maintaining its stability. This process prevented the degradation of IGF2BP2 through the autophagy-lysosome pathway (ALP). The LINRIS-IGF2BP2-Myc proto-oncogene protein (MYC) axis promotes the progression of Colorectal cancer and is a promising therapeutic target. MYC-mediated glycolysis was influenced by the interaction between LINRIS and IGF2BP2.
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120
Glycolysis / Gluconeogenesis hsa00010
Cell Process Autophagy-lysosome pathway
Ubiquitination
Glycolysis
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
In-vivo Model For the orthotopic models, 2 × 106 cells with negative control (NC, sh-NC), sh-1 or sh-2 in 0.5 mL of PBS were subcutaneously injected into the dorsal flank of 2 mice respectively. Then 15 mice were separated into 3 groups (sh-NC, sh-1 and sh-2), of which the tumor pieces were tied to the base of the ceca. The growth of the tumors was monitored every 2 weeks after intraperitoneal injection of D-luciferin with a Xenogen IVIS 100 Bioluminescent Imaging System.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [55]
Response Summary LncRNA-PACERR which bound to IGF2BP2 acts as an m6A-dependent manner to enhance the stability of KLF12 and Myc proto-oncogene protein (MYC) in cytoplasm. This study found that LncRNA-PACERR functions as key regulator of TAMs in PDAC microenvironment and revealed the novel mechanisms in cytoplasm and in nucleus.
Target Regulation Up regulation
Responsed Disease Pancreatic ductal adenocarcinoma ICD-11: 2C10.0
 Disease Info 
Pathway Response mRNA surveillance pathway hsa03015
RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
PATU-8988 (Human pancreatic adenocarcinoma cell)
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
HEK293T Normal Homo sapiens CVCL_0063
37 (Pancreatic cancer cell)
In-vivo Model BALB/c nude mice which were co-injected with THP-1 cells and PATU-8988 cells subcutaneously.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [22]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including Myc proto-oncogene protein (MYC), FSCN1, TK1, and MARCKSL1, exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
 Regulator Info 
In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Target Regulation Up regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Responsed Drug Linsitinib Phase 3
 Drug Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [20]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of Myc proto-oncogene protein (MYC) and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [22]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including Myc proto-oncogene protein (MYC), FSCN1, TK1, and MARCKSL1, exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Insulin-like growth factor-binding protein 3 (IGFBP3) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [12]
Response Summary YTHDF2 depletion downregulated IGFBP3 mRNA and protein levels, without affecting its mRNA stability. YTHDF2 regulated IGFBP3 levels via Myc proto-oncogene protein (MYC) in glioblastoma stem cells.
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
In-vitro Model ENSA (A human embryonic stem derived neural progenitor cell)
HNP1 (A human neural progenitor cell)
NSC11 (Pluripotent derived neural progenitor cell)
NHA (Normal human astrocytes)
In-vivo Model Implanting 5000 human derived GSCs into the right cerebral cortex of NSG mice at a depth of 3.5 mm under a University of California, San Diego Institutional Animal Care and Use Committee (IACUC) approved protocol. Brains were harvested and fixed in 4% formaldehyde, cryopreserved in 30% sucrose, and then cryosectioned. Hematoxylin and eosin (H&E) staining was performed on sections for histological analysis. In parallel survival experiments, mice were observed until the development of neurological signs. For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above. Mice recovered for 7 days were randomly assigned into drug vs. treatment group by a blinded investigator. Mice were then treated daily with either vehicle (25 mM Tartaric acid) or 50 mg/kg linsitinib by oral gavage.
Brain cancer [ICD-11: 2A00]
 Disease Info 
In total 5 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Responsed Disease Glioma [ICD-11: 2A00.0]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug R-2HG Investigative
 Drug Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Experiment 2 Reporting the m6A-centered Disease Response [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Responsed Disease Glioma [ICD-11: 2A00.0]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Linsitinib Phase 3
 Drug Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 3 Reporting the m6A-centered Disease Response [12]
Response Summary YTHDF2 depletion downregulated IGFBP3 mRNA and protein levels, without affecting its mRNA stability. YTHDF2 regulated IGFBP3 levels via Myc proto-oncogene protein (MYC) in glioblastoma stem cells.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator Insulin-like growth factor-binding protein 3 (IGFBP3) READER
 Regulator Info 
In-vitro Model ENSA (A human embryonic stem derived neural progenitor cell)
HNP1 (A human neural progenitor cell)
NSC11 (Pluripotent derived neural progenitor cell)
NHA (Normal human astrocytes)
In-vivo Model Implanting 5000 human derived GSCs into the right cerebral cortex of NSG mice at a depth of 3.5 mm under a University of California, San Diego Institutional Animal Care and Use Committee (IACUC) approved protocol. Brains were harvested and fixed in 4% formaldehyde, cryopreserved in 30% sucrose, and then cryosectioned. Hematoxylin and eosin (H&E) staining was performed on sections for histological analysis. In parallel survival experiments, mice were observed until the development of neurological signs. For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above. Mice recovered for 7 days were randomly assigned into drug vs. treatment group by a blinded investigator. Mice were then treated daily with either vehicle (25 mM Tartaric acid) or 50 mg/kg linsitinib by oral gavage.
Experiment 4 Reporting the m6A-centered Disease Response [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Responsed Disease Glioma [ICD-11: 2A00.0]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Linsitinib Phase 3
 Drug Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 5 Reporting the m6A-centered Disease Response [12]
Response Summary The IGF1/IGF1R inhibitor, linsitinib for further investigation based upon the role of the IGF pathway member, IGFBP3, as a downstream effector of YTHDF2-Myc proto-oncogene protein (MYC) axis in GSCs. Inhibiting glioblastoma stem cells viability without affecting NSCs and impairing in vivo glioblastoma growth.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Linsitinib Phase 3
 Drug Info 
In-vitro Model NSC11 (Pluripotent derived neural progenitor cell)
NHA (Normal human astrocytes)
HNP1 (A human neural progenitor cell)
ENSA (A human embryonic stem derived neural progenitor cell)
In-vivo Model Implanting 5000 human derived GSCs into the right cerebral cortex of NSG mice at a depth of 3.5 mm under a University of California, San Diego Institutional Animal Care and Use Committee (IACUC) approved protocol. Brains were harvested and fixed in 4% formaldehyde, cryopreserved in 30% sucrose, and then cryosectioned. Hematoxylin and eosin (H&E) staining was performed on sections for histological analysis. In parallel survival experiments, mice were observed until the development of neurological signs. For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above. Mice recovered for 7 days were randomly assigned into drug vs. treatment group by a blinded investigator. Mice were then treated daily with either vehicle (25 mM Tartaric acid) or 50 mg/kg linsitinib by oral gavage.
Solid tumour/cancer [ICD-11: 2A00-2F9Z]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary In this review, we discuss the specific roles of m6A "writers", "erasers", and "readers" in normal physiology and how their altered expression promotes tumorigenesis. We also describe the potential of exploiting the aberrant expression of these enzymes for cancer diagnosis, prognosis, and the development of novel therapies. The abnormal expression of m6A regulatory enzymes affects m6A abundance and consequently dysregulates the expression of tumor suppressor genes and oncogenes, including Myc proto-oncogene protein (MYC), SOCS2, ADAM19, and PTEN.
Responsed Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Experiment 2 Reporting the m6A-centered Disease Response [15]
Response Summary Wnt/Beta-catenin-mediated FTO downregulation and underscored the role of m6A modifications of Myc proto-oncogene protein (MYC) mRNA in regulating tumor cell glycolysis and growth.
Responsed Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Wnt signaling pathway hsa04310
Central carbon metabolism in cancer hsa05230
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glycolysis
In-vitro Model NCI-H322 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1556
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Mice were randomized into several groups. For the subcutaneous implantation model, 1 × 106 cells were injected subcutaneously into the flank regions of female BALB/c nude mice (4-5 weeks). For lung colonization assays, 1 × 106 cells were injected into the tail vein of female NOD/SCID mice (6-7 weeks), and 6 weeks later the lung was removed and fixed with 10% formalin.
Acute myeloid leukaemia [ICD-11: 2A60]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [24]
Response Summary METTL14 in normal myelopoiesis and AML pathogenesis, as featured by blocking myeloid differentiation and promoting self-renewal of normal HSPCs and LSCs/LICs. METTL14 exerts its oncogenic role by regulating its mRNA targets (e.g., MYB and Myc proto-oncogene protein (MYC)) through m6A modification, while the protein itself is negatively regulated by SPI1.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell survival/proliferation
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
HSPC (Human hematopoietic stem cell)
MNC (Cord blood pluripotent stem cells)
OP9 Normal Mus musculus CVCL_4398
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model Lin- HSPCs were purified from BM of wildtype mice and 0.1×106 cells were seeded in 2 mL OP9 medium onto the OP9 cells with the addition of 10 ng/mL mouse IL-3, 10 ng/mL human IL-6, 10 ng/mL mouse IL-7, 10 ng/mL mouse Flt-3L, and 50 ng/mL mouse stem cell factor (SCF).
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of Myc proto-oncogene protein (MYC), BCL2 and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell differentiation and apoptosis
Apoptosis (hsa04210)
In-vitro Model HSPC (Human hematopoietic stem cell)
In-vivo Model 500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 3 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 level was slightly increased in AML-M5 patients,and its expression was significantly higher in immature cells than in mature monocytes.METTL3 acts as an oncogene in MOLM13 cells by upregulating Myc proto-oncogene protein (MYC) expression.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
In-vitro Model MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
Experiment 4 Reporting the m6A-centered Disease Response [26]
Response Summary WTAP made acute myeloid leukemia cells resistant to daunorubicin. In further investigations, m6A methylation level was downregulated when knocking down WTAP, and Myc proto-oncogene protein (MYC) was upregulated due to the decreased m6A methylation of MYC mRNA.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Daunorubicin Approved
 Drug Info 
Cell Process Cell cycle
Cell proliferation
Cell apoptosis
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
Malignant haematopoietic neoplasm [ICD-11: 2B33]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Responsed Disease Leukaemia [ICD-11: 2B33.4]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug R-2HG Investigative
 Drug Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Experiment 2 Reporting the m6A-centered Disease Response [20]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of Myc proto-oncogene protein (MYC) and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Responsed Disease Myeloid leukaemia [ICD-11: 2B33.1]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Head and neck squamous carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary In oral squamous cell carcinoma, YTH N6-methyladenosine RNA binding protein 1 (YTH domain family, member 1 [YTHDF1]) mediated the m6A-increased stability of Myc proto-oncogene protein (MYC) mRNA catalyzed by METTL3.
Responsed Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
NHOK (Normal oral keratinocytes)
SCC-15 Tongue squamous cell carcinoma Homo sapiens CVCL_1681
SCC-25 Tongue squamous cell carcinoma Homo sapiens CVCL_1682
TSCCa Endocervical adenocarcinoma Homo sapiens CVCL_VL15
In-vivo Model The stable transfection of SCC25 cells (1 × 107 cells in 0.1 mL) with lenti-sh-METTL3 or blank vectors was injected subcutaneously into BALB/c nude mice.
Experiment 2 Reporting the m6A-centered Disease Response [3]
Response Summary In oral squamous cell carcinoma, YTH N6-methyladenosine RNA binding protein 1 (YTH domain family, member 1 [YTHDF1]) mediated the m6A-increased stability of Myc proto-oncogene protein (MYC) mRNA catalyzed by METTL3.
Responsed Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
NHOK (Normal oral keratinocytes)
SCC-15 Tongue squamous cell carcinoma Homo sapiens CVCL_1681
SCC-25 Tongue squamous cell carcinoma Homo sapiens CVCL_1682
TSCCa Endocervical adenocarcinoma Homo sapiens CVCL_VL15
In-vivo Model The stable transfection of SCC25 cells (1 × 107 cells in 0.1 mL) with lenti-sh-METTL3 or blank vectors was injected subcutaneously into BALB/c nude mice.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [21]
Response Summary IGF2BP1 upregulated in GC tissue and acted as a predictor of poor prognosis for GC patients. IGF2BP1 directly interacted with Myc proto-oncogene protein (MYC) mRNA via m6A-dependent manner to by stabilize its stability.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Central carbon metabolism in cancer hsa05230
Glycolysis / Gluconeogenesis hsa00010
Cell Process Aerobic glycolysis
In-vitro Model SNU-216 Gastric tubular adenocarcinoma Homo sapiens CVCL_3946
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
GES-1 Normal Homo sapiens CVCL_EQ22
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model A total of 5 × 106 transfected MKN-45 cells, stably transfected with sh-IGF2BP1 vector or empty vector were subcutaneously injected into the flank of the mice. Tumor growth was measured every three days, and calculated using the following equation = a × b2/2 (a for longitudinal diameter; and b for latitudinal diameter). Three weeks after injection, mice were sacrificed.
Experiment 2 Reporting the m6A-centered Disease Response [4]
Response Summary In gastric cancer, several component molecules (e.g., MCM5, MCM6, etc.) of Myc proto-oncogene protein (MYC) target genes were mediated by METTL3 via altered m6A modification.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model GES-1 Normal Homo sapiens CVCL_EQ22
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
MGC-803 Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
pGCC (Primary GC cells)
SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
In-vivo Model A total of 2 × 106 GC cells were injected into the flank of nude mice in a 1:1 suspension of BD Matrigel (BD Biosciences) in phosphate-buffered saline (PBS) solution.
Experiment 3 Reporting the m6A-centered Disease Response [5]
Response Summary METTL3 enhanced Myc proto-oncogene protein (MYC) m6A methylation and increased MYC translation, which could potentiate the proliferation, migration and invasion of gastric cancer cells.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
AZ-521 Duodenal adenocarcinoma Homo sapiens CVCL_2862
GES-1 Normal Homo sapiens CVCL_EQ22
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
In-vivo Model The GC cell line MKN-45 stably infected with lentivirus expressing sh-HBXIP was prepared into 5 × 107 cells/mL cell suspension.
Experiment 4 Reporting the m6A-centered Disease Response [5]
Response Summary Expressions of HBXIP, METTL3 and Myc proto-oncogene protein (MYC) were all determined to be upregulated in both GC tissues and cells. HBXIP plays an oncogenic role in GC via METTL3-mediated MYC mRNA m6A modification.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
GES-1 Normal Homo sapiens CVCL_EQ22
AZ-521 Duodenal adenocarcinoma Homo sapiens CVCL_2862
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model The GC cell line MKN-45 stably infected with lentivirus expressing sh-HBXIP was prepared into 5 × 107 cells/mL cell suspension. The cell suspension was injected into the left axilla of nude mice using a 1 mL syringe as the sh-HBXIP group (n = 6). The GC cell line MKN-45 infected with the lentivirus expressing sh-NC was dispersed into the cell suspension, which was injected into nude mice as the sh-NC group (n = 6). Tumor growth was observed and data were recorded after inoculation. On the 26th day, all nude mice were euthanized by cervical dislocation and the tumors were resected and weighed.
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [16]
Response Summary MiR-96 antagomir could potentially retard the cancerogenesis in colorectal cancer via AMPK-alpha-2-dependent inhibition of FTO and blocking FTO-mediated m6A modification of Myc proto-oncogene protein (MYC).
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model RC cells SW480 at logarithmic growth phase were prepared into cell suspension with a concentration of about 1 × 107/100 L, which was then injected into the left axilla of nude mice with a 1 ml syringe to establish a subcutaneous mouse xenograft model. Once the tumor volume reached about 50 mm3, the nude mice were injected with miR-96 antagomir or NC antagomir (10 nmol once every 5 days for 5 weeks). After 5 weeks, the mice were euthanized, after which the subcutaneous transplanted tumor was removed, and weighed.
Experiment 2 Reporting the m6A-centered Disease Response [17]
Response Summary GSK3beta inhibited MZF1 expression by mediating FTO-regulated m6A modification of MZF1 and then decreased the proto-oncogene Myc proto-oncogene protein (MYC) expression, thus hampering CRC cell proliferation.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120
Cell Process Cell proliferation
In-vitro Model SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
In-vivo Model Twenty-four specific pathogen free female BALB/c nude mice (age: 6 weeks, weight: 15 ~ 18 g) were purchased from Slac Laboratory Animal Co., Ltd., and subcutaneously injected with SW620 cells stably transfected with oe-NC, oe-GSK3-Beta + oe-NC, or oe-GSK3-Beta + oe-c-Myc to establish a subcutaneous xenograft tumour model in nude mice.
Experiment 3 Reporting the m6A-centered Disease Response [54]
Response Summary LINRIS blocked K139 ubiquitination of IGF2BP2, maintaining its stability. This process prevented the degradation of IGF2BP2 through the autophagy-lysosome pathway (ALP). The LINRIS-IGF2BP2-Myc proto-oncogene protein (MYC) axis promotes the progression of Colorectal cancer and is a promising therapeutic target. MYC-mediated glycolysis was influenced by the interaction between LINRIS and IGF2BP2.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120
Glycolysis / Gluconeogenesis hsa00010
Cell Process Autophagy-lysosome pathway
Ubiquitination
Glycolysis
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
In-vivo Model For the orthotopic models, 2 × 106 cells with negative control (NC, sh-NC), sh-1 or sh-2 in 0.5 mL of PBS were subcutaneously injected into the dorsal flank of 2 mice respectively. Then 15 mice were separated into 3 groups (sh-NC, sh-1 and sh-2), of which the tumor pieces were tied to the base of the ceca. The growth of the tumors was monitored every 2 weeks after intraperitoneal injection of D-luciferin with a Xenogen IVIS 100 Bioluminescent Imaging System.
Experiment 4 Reporting the m6A-centered Disease Response [6]
Response Summary METTL3 exerted its function through enhancing Myc proto-oncogene protein (MYC) expression, at least partially in an m6A-IGF2BP1-dependent manner. Knockdown of METTL3 suppressed colorectal cancer cell proliferation in vitro and in vivo.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
Caco-2 Colon adenocarcinoma Homo sapiens CVCL_0025
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HT29 Colon cancer Mus musculus CVCL_A8EZ
LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model METTL3 stable knockdown or overexpression HCT116 cells were collected and resuspended at a density of 5 × 106 or 3 × 106 cells per 150 uL PBS.
Pancreatic cancer [ICD-11: 2C10]
 Disease Info 
In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [18]
Response Summary FTO has been indicated to interact with Myc proto-oncogene protein (MYC) proto-oncogene, bHLH transcription factor and to enhance its stability by decreasing its m6A level.the aforementioned observations indicate a novel mechanism for the regulation of pancreatic cancer cells by FTO.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
HPDE Normal Homo sapiens CVCL_4376
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
SW1990 Pancreatic adenocarcinoma Homo sapiens CVCL_1723
Experiment 2 Reporting the m6A-centered Disease Response [55]
Response Summary LncRNA-PACERR which bound to IGF2BP2 acts as an m6A-dependent manner to enhance the stability of KLF12 and Myc proto-oncogene protein (MYC) in cytoplasm. This study found that LncRNA-PACERR functions as key regulator of TAMs in PDAC microenvironment and revealed the novel mechanisms in cytoplasm and in nucleus.
Responsed Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response mRNA surveillance pathway hsa03015
RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
PATU-8988 (Human pancreatic adenocarcinoma cell)
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
HEK293T Normal Homo sapiens CVCL_0063
37 (Pancreatic cancer cell)
In-vivo Model BALB/c nude mice which were co-injected with THP-1 cells and PATU-8988 cells subcutaneously.
Experiment 3 Reporting the m6A-centered Disease Response [25]
Response Summary The study revealed important roles for METTL5 in the development of pancreatic cancer and present the METTL5/Myc proto-oncogene protein (MYC) axis as a novel therapeutic strategy for treatment.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Methyltransferase-like 5 (METTL5) WRITER
 Regulator Info 
Cell Process Cell proliferation
Cell migration
Cell invasion
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A-related genes have a prognostic value in liver cancer, and the constructed riskscore can identify patients who are high risk and can enable individualized therapy. Gene set enrichment analysis showed that tumorigenic markers, including DNA repair, E2F targets, G2M checkpoint, and Myc proto-oncogene protein (MYC) targets V1, were enriched in Cluster2.
Responsed Disease Liver cancer [ICD-11: 2C12]
Experiment 2 Reporting the m6A-centered Disease Response [22]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including Myc proto-oncogene protein (MYC), FSCN1, TK1, and MARCKSL1, exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Experiment 2 Reporting the m6A-centered Disease Response [7]
Response Summary LCAT3 upregulation is attributable to N6-methyladenosine (m6A) modification mediated by methyltransferase like 3 (METTL3), leading to LCAT3 stabilization. LCAT3 as a novel oncogenic lncRNA in the lung, and validated the LCAT3-FUBP1-Myc proto-oncogene protein (MYC) axis as a potential therapeutic target for lung adenocarcinomas.
Responsed Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
Calu-1 Lung squamous cell carcinoma Homo sapiens CVCL_0608
HEK293T Normal Homo sapiens CVCL_0063
HOP-62 Lung adenocarcinoma Homo sapiens CVCL_1285
In-vivo Model For the in vivo tumorigenicity assay, female BALB/c nude mice (ages 4-5 weeks) were randomly divided into two groups (n = 6/group). Calu1 cells (4 × 106) that had been stably transfected with sh-LCAT3 or scramble were implanted subcutaneously into the nude mice. Tumor growth was measured after one week, and tumor volumes were calculated with the following formula: Volume (cm3) = (length × width2)/2. After four weeks, the mice were euthanized, and the tumors were collected and weighed. For the in vivo tumor invasion assay, 1.2 × 106 scramble or shLCAT3 cells were injected intravenously into the tail vein of nude mice (n = 6/group). 1.5 mg luciferin (Gold Biotech, St Louis, MO, USA) was administered once a week for 4 weeks, to monitor metastases using an IVIS@ Lumina II system (Caliper Life Sciences, Hopkinton, MA, USA).
Experiment 3 Reporting the m6A-centered Disease Response [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Experiment 4 Reporting the m6A-centered Disease Response [8]
Response Summary This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The Myc proto-oncogene protein (MYC) targets, E2 transcription Factor (E2F) targets were significantly enriched.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Pathway Response p53 signaling pathway hsa04115
Central carbon metabolism in cancer hsa05230
PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Breast cancer [ICD-11: 2C60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [23]
Response Summary Hypoxia-induced lncRNA KB-1980E6.3 is involved in the self-renewal and stemness maintenance of breast cancer stem cells by recruiting IGF2BP1 to regulate Myc proto-oncogene protein (MYC) mRNA stability.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Signaling pathways regulating pluripotency of stem cells hsa04550
In-vitro Model BT-474 Invasive breast carcinoma Homo sapiens CVCL_0179
BT-549 Invasive breast carcinoma Homo sapiens CVCL_1092
HEK293T Normal Homo sapiens CVCL_0063
Hs 578T Invasive breast carcinoma Homo sapiens CVCL_0332
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-453 Breast adenocarcinoma Homo sapiens CVCL_0418
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
T-47D Invasive breast carcinoma Homo sapiens CVCL_0553
In-vivo Model The enriched mammosphere cells derived from engineered BT549 and Hs578T with silenced lncRNA KB-1980E6.3 (shKB/vector), BT549, and Hs578T with lncRNA KB-1980E6.3 knockdown combined with ectopic c-Myc (shKB/c-Myc), BT549, and Hs578T with silenced IGF2BP1 (shIGF2BP1/vector), BT549, and Hs578T with knocked down IGF2BP1 combined with ectopic c-Myc (shIGF2BP1/c-Myc), and BT549, and Hs578T/shNC/vector control cells were used in Xenograft experiments. Three doses (1 × 105, 1 × 104 and 1 × 103) of spheres derived from the engineered Hs578T and 1 × 105 of spheres derived from the engineered BT549 were subcutaneously inoculated into 4- to 6-week-old female nude mice (n = 5 per group). Mice were then treated with either bevacizumab (10 mg/kg every 3 days) to form a hypoxic tumor microenvironment or vehicle PBS to form a non-hypoxic condition.
Experiment 2 Reporting the m6A-centered Disease Response [13]
Response Summary LCAT3 upregulation is attributable to m6A modification mediated by METTL3, leading to LCAT3 stabilization. Treated cells with tamoxifen to induce MYC activity. Highlights the therapeutic potential of RBPs by uncovering a critical role for YTHDF2 in counteracting the global increase of mRNA synthesis in Myc proto-oncogene protein (MYC)-driven breast cancers.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Responsed Drug Tamoxifen Approved
 Drug Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Epithelial-to-mesenchymal transition
Cell apoptosis
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MBA-MD-231 (Human breast cancer cell)
MYC-ER HMEC (Human mammary epithelial cells expressing a MYC estrogen receptor fusion)
SK-BR-3 Breast adenocarcinoma Homo sapiens CVCL_0033
In-vivo Model To induce recombination at 8 weeks of age both CAG-CreERT;Ythdf2fl/fl and Ythdf2fl/fl littermates were injected with 75mg/kg body weight tamoxifen dissolved in corn oil daily for 5 days.
Cervical cancer [ICD-11: 2C77]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [19]
Response Summary FTO interacts with transcripts of E2F1 and Myc proto-oncogene protein (MYC), inhibition of FTO significantly impairs the translation efficiency of E2F1 and Myc.FTO plays important oncogenic role in regulating cervical cancer cells' proliferation.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation and migration
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
Experiment 2 Reporting the m6A-centered Disease Response [22]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including Myc proto-oncogene protein (MYC), FSCN1, TK1, and MARCKSL1, exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Prostate cancer [ICD-11: 2C82]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [9]
Response Summary METTL3 enhanced Myc proto-oncogene protein (MYC) expression by increasing m6A levels of MYC mRNA transcript, leading to oncogenic functions in prostate cancer.
Responsed Disease Prostate cancer [ICD-11: 2C82]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model LNCaP C4-2 Prostate carcinoma Homo sapiens CVCL_4782
DU145 Prostate carcinoma Homo sapiens CVCL_0105
LNCaP Prostate carcinoma Homo sapiens CVCL_0395
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
Bladder cancer [ICD-11: 2C94]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [10]
Response Summary AF4/FMR2 family member 4 (AFF4), two key regulators of NF-Kappa-B pathway (IKBKB and RELA) and Myc proto-oncogene protein (MYC) were further identified as direct targets of METTL3-mediated m6A modification.overexpression of METTL3 significantly promoted Bladder cancer cell growth and invasion.
Responsed Disease Bladder cancer [ICD-11: 2C94]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Glucose metabolism
Polycystic kidney disease [ICD-11: GB81]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [11]
Response Summary Mettl3 activates the cyst-promoting c-Myc and cAMP pathways through enhanced Myc proto-oncogene protein (MYC) and Avpr2 mRNA m6A modification and translation. Thus, Mettl3 promotes Autosomal dominant polycystic kidney disease and links methionine utilization to epitranscriptomic activation of proliferation and cyst growth.
Responsed Disease Polycystic kidney disease [ICD-11: GB81]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model mIMCD-3 Normal Mus musculus CVCL_0429
In-vivo Model The clone, with one wild-type Mettl3 allele and one L1L2_Bact_P cassette inserted allele, was injected into C57BL/6 blastocysts. Mettl3-targeted mouse line was established from a germline-transmitting chimera. The chimeric mouse was crossed to C57BL/6 Flp mice to excise the neomycin resistance system.
Daunorubicin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [26]
Response Summary WTAP made acute myeloid leukemia cells resistant to daunorubicin. In further investigations, m6A methylation level was downregulated when knocking down WTAP, and Myc proto-oncogene protein (MYC) was upregulated due to the decreased m6A methylation of MYC mRNA.
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Cell Process Cell cycle
Cell proliferation
Cell apoptosis
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
Tamoxifen [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [13]
Response Summary LCAT3 upregulation is attributable to m6A modification mediated by METTL3, leading to LCAT3 stabilization. Treated cells with tamoxifen to induce MYC activity. Highlights the therapeutic potential of RBPs by uncovering a critical role for YTHDF2 in counteracting the global increase of mRNA synthesis in Myc proto-oncogene protein (MYC)-driven breast cancers.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Epithelial-to-mesenchymal transition
Cell apoptosis
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MBA-MD-231 (Human breast cancer cell)
MYC-ER HMEC (Human mammary epithelial cells expressing a MYC estrogen receptor fusion)
SK-BR-3 Breast adenocarcinoma Homo sapiens CVCL_0033
In-vivo Model To induce recombination at 8 weeks of age both CAG-CreERT;Ythdf2fl/fl and Ythdf2fl/fl littermates were injected with 75mg/kg body weight tamoxifen dissolved in corn oil daily for 5 days.
Linsitinib [Phase 3]
 Drug Info 
In total 3 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 2 Reporting the m6A-centered Drug Response [12]
Response Summary The m6A reader YTHDF2 stabilized Myc proto-oncogene protein (MYC) mRNA specifically in cancer stem cells. Given the challenge of targeting MYC, YTHDF2 presents a therapeutic target to perturb MYC signaling in glioblastoma. The IGF1/IGF1R inhibitor linsitinib preferentially targeted YTHDF2-expressing cells, inhibiting GSC viability without affecting NSCs and impairing in vivo glioblastoma growth. YTHDF2 links RNA epitranscriptomic modifications and GSC growth, laying the foundation for the YTHDF2-MYC-IGFBP3 axis as a specific and novel therapeutic target in glioblastoma.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vitro Model ()
HNP1 (A human neural progenitor cell)
NHA (Normal human astrocytes)
NSC11 (Pluripotent derived neural progenitor cell)
In-vivo Model For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above.
Experiment 3 Reporting the m6A-centered Drug Response [12]
Response Summary The IGF1/IGF1R inhibitor, linsitinib for further investigation based upon the role of the IGF pathway member, IGFBP3, as a downstream effector of YTHDF2-Myc proto-oncogene protein (MYC) axis in GSCs. Inhibiting glioblastoma stem cells viability without affecting NSCs and impairing in vivo glioblastoma growth.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
In-vitro Model NSC11 (Pluripotent derived neural progenitor cell)
NHA (Normal human astrocytes)
HNP1 (A human neural progenitor cell)
ENSA (A human embryonic stem derived neural progenitor cell)
In-vivo Model Implanting 5000 human derived GSCs into the right cerebral cortex of NSG mice at a depth of 3.5 mm under a University of California, San Diego Institutional Animal Care and Use Committee (IACUC) approved protocol. Brains were harvested and fixed in 4% formaldehyde, cryopreserved in 30% sucrose, and then cryosectioned. Hematoxylin and eosin (H&E) staining was performed on sections for histological analysis. In parallel survival experiments, mice were observed until the development of neurological signs. For in vivo drug treatment studies, intracranial xenografts were generated by implanting 5000 patient-derived GSCs (387 and 4121) into the right cerebral cortex of NSG mice as described above. Mice recovered for 7 days were randomly assigned into drug vs. treatment group by a blinded investigator. Mice were then treated daily with either vehicle (25 mM Tartaric acid) or 50 mg/kg linsitinib by oral gavage.
R-2HG [Investigative]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Glioma ICD-11: 2A00.0
 Disease Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Experiment 2 Reporting the m6A-centered Drug Response [14]
Response Summary This work demonstrates anti-tumor effects of 2HG in inhibiting proliferation/survival of FTO-high cancer cells via targeting FTO/m6A/Myc proto-oncogene protein (MYC)/CEBPA signaling.High levels of FTO sensitize leukemia cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling. R-2HG also displays anti-tumor activity in glioma. High levels of FTO sensitize leukemic cells to R-2HG, whereas hyperactivation of MYC signaling confers resistance that can be reversed by the inhibition of MYC signaling.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Leukaemia ICD-11: 2B33.4
 Disease Info 
Cell Process Glutamine metabolism
Cell apoptosis
In-vitro Model 8-MG-BA Glioblastoma Homo sapiens CVCL_1052
A-172 Glioblastoma Homo sapiens CVCL_0131
DK-MG Glioblastoma Homo sapiens CVCL_1173
GaMG Glioblastoma Homo sapiens CVCL_1226
HEL Erythroleukemia Homo sapiens CVCL_0001
Jurkat T acute lymphoblastic leukemia Homo sapiens CVCL_0065
KOCL-45 B acute lymphoblastic leukemia Homo sapiens CVCL_3993
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
KOCL-50 B acute lymphoblastic leukemia Homo sapiens CVCL_6866
KOCL-51 B acute lymphoblastic leukemia Homo sapiens CVCL_6865
KOCL-69 B acute lymphoblastic leukemia Homo sapiens CVCL_3995
KOPN-1 B acute lymphoblastic leukemia Homo sapiens CVCL_3937
LN-18 Glioblastoma Homo sapiens CVCL_0392
LN-229 Glioblastoma Homo sapiens CVCL_0393
MA9.3 (MA9.3)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
MA9.6 (MLL-AF9)
MA9.6ITD (MLL-AF9 plus FLT3-ITD)
MA9.6RAS (MLL-AF9 plus NRasG12D)
ME-1 [Human leukemia] Adult acute myeloid leukemia Homo sapiens CVCL_2110
ML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1418
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
PL21 Familial adenomatous polyposis Homo sapiens CVCL_JM48
T98G Glioblastoma Homo sapiens CVCL_0556
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For R-2HG injection mouse models, sensitive (NOMO-1 and MA9.3ITD) or resistant (MA9.3RAS) cells were injected into NSGS or NRGS intravenously, and then R-2HG (6mg/kg body weight) or PBS were injected once daily through tail vein for 12 consecutive days starting from day 11 post xeno-transplantation.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Fat mass and obesity-associated protein (FTO)
 Regulator Info 
In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00027
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
Crosstalk ID: M6ACROT00029
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Arg (anticodon CCG) 1-1 (TRR-CCG1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
Crosstalk ID: M6ACROT00031
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Thr (anticodon CGT) 1-1 (TRT-CGT1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
Crosstalk ID: M6ACROT00045
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target Myc proto-oncogene protein (MYC)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00028
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
Crosstalk ID: M6ACROT00030
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Arg (anticodon CCG) 1-1 (TRR-CCG1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
Crosstalk ID: M6ACROT00032
 Crosstalk Info 
Epigenetic Regulator tRNA methyltransferase 10 homolog A (TRMT10A)
Regulated Target tRNA-Thr (anticodon CGT) 1-1 (TRT-CGT1-1)
Crosstalk relationship m1G → m6A
Drug AVI-5126
 Drug Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00228
 Crosstalk Info 
Epigenetic Regulator Y-box-binding protein 1 (YBX1)
Regulated Target Myc proto-oncogene protein (MYC)
Crosstalk relationship m6A → m5C
Drug AVI-5126
 Drug Info 
DNA modification
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02036
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship DNA modification → m6A
Disease Lung cancer
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02039
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship DNA modification → m6A
Disease Lung cancer
 Disease Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
 Regulator Info 
In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02075
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Protein tyrosine phosphatase non-receptor type 13 (PTPN13)
Crosstalk relationship DNA modification → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT02194
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Protein tyrosine phosphatase non-receptor type 13 (PTPN13)
Crosstalk relationship DNA modification → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT05864
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Long intergenic non-protein coding RNA 261 (LINC00261)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT05865
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target Long intergenic non-protein coding RNA 261 (LINC00261)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT05866
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target Long intergenic non-protein coding RNA 261 (LINC00261)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03106
 Crosstalk Info 
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Esophageal Squamous Cell Carcinoma
 Disease Info 
Crosstalk ID: M6ACROT03550
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03595
 Crosstalk Info 
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03648
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
 Disease Info 
Crosstalk ID: M6ACROT03651
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
 Disease Info 
Crosstalk ID: M6ACROT03660
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
 Disease Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
 Regulator Info 
In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03133
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT03476
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT03477
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT06042
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Pancreatic cancer
 Disease Info 
Drug Gemcitabine
 Drug Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03155
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Intrahepatic cholangiocarcinoma
 Disease Info 
Crosstalk ID: M6ACROT05863
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Pancreatic cancer
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03419
 Crosstalk Info 
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT03430
 Crosstalk Info 
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT03539
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Brain cancer
 Disease Info 
m6A Regulator: Fat mass and obesity-associated protein (FTO)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03431
 Crosstalk Info 
Epigenetic Regulator Histone deacetylase 1 (HDAC1)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03447
 Crosstalk Info 
Epigenetic Regulator Histone deacetylase 1 (HDAC1)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
 Regulator Info 
In total 7 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05004
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 261 (LINC00261)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT05008
 Crosstalk Info 
Epigenetic Regulator Neuroblastoma associated transcript 1 (NBAT1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT05058
 Crosstalk Info 
Epigenetic Regulator Septin 14 pseudogene 20 (SEPTIN14P20/LINC00266-1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Crosstalk ID: M6ACROT05172
 Crosstalk Info 
Epigenetic Regulator FERM, ARH/RhoGEF and pleckstrin domain protein 1 (FARP1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Disease Acute myeloid leukaemia
 Disease Info 
Drug Cytarabine
 Drug Info 
Crosstalk ID: M6ACROT05366
 Crosstalk Info 
Epigenetic Regulator KB-1980E6.3
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Disease Breast cancer
 Disease Info 
Crosstalk ID: M6ACROT05867
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 261 (LINC00261)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship m6A → ncRNA
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT05891
 Crosstalk Info 
Epigenetic Regulator Testis associated oncogenic lncRNA (THORLNC)
Regulated Target Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship ncRNA → m6A
Disease Nasopharyngeal carcinoma
 Disease Info 
Drug Triptonide
 Drug Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05012
 Crosstalk Info 
Epigenetic Regulator DARS1 antisense RNA 1 (DARS1-AS1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
 Disease Info 
Crosstalk ID: M6ACROT05216
 Crosstalk Info 
Epigenetic Regulator LOC101929709
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Gastric cancer
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05047
 Crosstalk Info 
Epigenetic Regulator MicroRNA 145 (MIR145)
Regulated Target YTH domain-containing family protein 2 (YTHDF2)
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
 Disease Info 
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05055
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 920 (LINC00920)
Regulated Target Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT05319
 Crosstalk Info 
Epigenetic Regulator PTGS2 antisense RNA 1 (PACERR)
Regulated Target Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship ncRNA → m6A
Disease Pancreatic ductal adenocarcinoma
 Disease Info 
Crosstalk ID: M6ACROT05950
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 901 (LINC00901)
Regulated Target Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship ncRNA → m6A
Disease pancreatic cancer
 Disease Info 
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05103
 Crosstalk Info 
Epigenetic Regulator hsa-miR-493-5p
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05104
 Crosstalk Info 
Epigenetic Regulator Maternally expressed 3 (MEG3)
Regulated Target hsa-miR-493-5p
Crosstalk relationship ncRNA → m6A
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05327
 Crosstalk Info 
Epigenetic Regulator hsa-miR-338-5p
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Lung cancer
 Disease Info 
m6A Regulator: RNA-binding protein Musashi homolog 2 (MSI2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05107
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 942 (LINC00942)
Regulated Target Musashi RNA binding protein 2 (MSI2)
Crosstalk relationship ncRNA → m6A
Disease Gastric cancer
 Disease Info 
Drug Cisplatin
 Drug Info 
m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05115
 Crosstalk Info 
Epigenetic Regulator DLGAP1 antisense RNA 2 (DLGAP1-AS2)
Regulated Target YTH domain-containing family protein 1 (YTHDF1)
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
 Disease Info 
m6A Regulator: Fat mass and obesity-associated protein (FTO)
 Regulator Info 
In total 10 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05127
 Crosstalk Info 
Epigenetic Regulator hsa-let-7b-5p
Regulated Target FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship ncRNA → m6A
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05163
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 858 (LINC00858)
Regulated Target Zinc finger protein 184 (ZNF184)
Crosstalk relationship ncRNA → m6A
Disease Esophageal Squamous Cell Carcinoma
 Disease Info 
Crosstalk ID: M6ACROT05181
 Crosstalk Info 
Epigenetic Regulator hsa-miR-218-5p
Regulated Target FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT05182
 Crosstalk Info 
Epigenetic Regulator hsa_circ_0001739 (Circ_ZNF277)
Regulated Target hsa-miR-218-5p
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT05183
 Crosstalk Info 
Epigenetic Regulator AC159540.1
Regulated Target hsa-miR-218-5p
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT05237
 Crosstalk Info 
Epigenetic Regulator hsa-miR-607
Regulated Target FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
 Disease Info 
Crosstalk ID: M6ACROT05251
 Crosstalk Info 
Epigenetic Regulator hsa_circ_0072309 (Circ_LIFR)
Regulated Target hsa-miR-607
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
 Disease Info 
Crosstalk ID: M6ACROT05320
 Crosstalk Info 
Epigenetic Regulator hsa-miR-96
Regulated Target Protein kinase AMP-activated catalytic subunit alpha 2 (PRKAA2)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT05437
 Crosstalk Info 
Epigenetic Regulator MicroRNA 23a (MIR23A)
Regulated Target Max-interacting protein 1 (MXI1)
Crosstalk relationship m6A → ncRNA
Disease Brain cancer
 Disease Info 
Drug Temozolomide
 Drug Info 
Crosstalk ID: M6ACROT05438
 Crosstalk Info 
Epigenetic Regulator MicroRNA 155 (MIR155)
Regulated Target Max-interacting protein 1 (MXI1)
Crosstalk relationship m6A → ncRNA
Disease Brain cancer
 Disease Info 
Drug Temozolomide
 Drug Info 
m6A Regulator: Protein lin-28 homolog B (LIN28B)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05217
 Crosstalk Info 
Epigenetic Regulator LOC101929709
Regulated Target Protein lin-28 homolog B (LIN28B)
Crosstalk relationship ncRNA → m6A
Disease Gastric cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00341)
Myc proto-oncogene protein (MYC)
2'-O-Methylation (2'-O-Me)
In total 5 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000491 Click to Show/Hide the Full List
mod site chr8:127741082-127741083:+ [73]
Sequence GTCTTGAGACTGAAAGATTTAGCCATAATGTAAACTGCCTC
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000651626.1; ENST00000377970.6; ENST00000524013.1; ENST00000621592.6; ENST00000652288.1
External Link RMBase: Nm_site_6512
mod ID: 2OMSITE000488 Click to Show/Hide the Full List
mod site chr8:127736579-127736580:+ [73]
Sequence TCTCTGAAAGGCTCTCCTTGCAGCTGCTTAGACGCTGGATT
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000517291.1; ENST00000651626.1; ENST00000520751.1; ENST00000377970.6; ENST00000524013.1; ENST00000641036.1; ENST00000621592.6; ENST00000259523.10
External Link RMBase: Nm_site_6509
mod ID: 2OMSITE000487 Click to Show/Hide the Full List
mod site chr8:127736571-127736572:+ [73]
Sequence GACCCGCTTCTCTGAAAGGCTCTCCTTGCAGCTGCTTAGAC
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000641036.1; ENST00000651626.1; ENST00000524013.1; ENST00000621592.6; ENST00000520751.1; ENST00000517291.1; ENST00000259523.10; ENST00000377970.6
External Link RMBase: Nm_site_6508
mod ID: 2OMSITE000489 Click to Show/Hide the Full List
mod site chr8:127740592-127740593:+ [73]
Sequence CTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTC
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000651626.1; ENST00000524013.1; ENST00000621592.6; ENST00000652288.1; ENST00000613283.2; ENST00000652131.1; ENST00000377970.6
External Link RMBase: Nm_site_6510
mod ID: 2OMSITE000490 Click to Show/Hide the Full List
mod site chr8:127741079-127741080:+ [73]
Sequence TGAGTCTTGAGACTGAAAGATTTAGCCATAATGTAAACTGC
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000652288.1; ENST00000377970.6; ENST00000621592.6; ENST00000524013.1; ENST00000651626.1
External Link RMBase: Nm_site_6511
5-methylcytidine (m5C)
In total 11 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004339 Click to Show/Hide the Full List
mod site chr8:127739465-127739466:+
Sequence CTATCTACAAAAATGAGGGGCTGTGTTTAGAGGCTAGGCAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000377970.6; ENST00000259523.10; ENST00000613283.2; ENST00000524013.1; ENST00000652288.1; ENST00000651626.1; ENST00000652131.1; ENST00000621592.6
External Link RMBase: m5C_site_41754
mod ID: M5CSITE004340 Click to Show/Hide the Full List
mod site chr8:127740154-127740155:+
Sequence TTTTAGTAGAGATGGGGTTTCATCGTGTTGGCCAGGATGGT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000651626.1; ENST00000652288.1; ENST00000621592.6; ENST00000524013.1; ENST00000613283.2; ENST00000652131.1; ENST00000259523.10; ENST00000377970.6
External Link RMBase: m5C_site_41755
mod ID: M5CSITE004341 Click to Show/Hide the Full List
mod site chr8:127740157-127740158:+
Sequence TAGTAGAGATGGGGTTTCATCGTGTTGGCCAGGATGGTCTC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000652288.1; ENST00000259523.10; ENST00000621592.6; ENST00000377970.6; ENST00000524013.1; ENST00000651626.1; ENST00000613283.2; ENST00000652131.1
External Link RMBase: m5C_site_41756
mod ID: M5CSITE004342 Click to Show/Hide the Full List
mod site chr8:127740165-127740166:+
Sequence ATGGGGTTTCATCGTGTTGGCCAGGATGGTCTCTCCTGACC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000377970.6; ENST00000652288.1; ENST00000259523.10; ENST00000652131.1; ENST00000621592.6; ENST00000524013.1; ENST00000651626.1; ENST00000613283.2
External Link RMBase: m5C_site_41757
mod ID: M5CSITE004343 Click to Show/Hide the Full List
mod site chr8:127740166-127740167:+
Sequence TGGGGTTTCATCGTGTTGGCCAGGATGGTCTCTCCTGACCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000377970.6; ENST00000259523.10; ENST00000652131.1; ENST00000613283.2; ENST00000652288.1; ENST00000621592.6; ENST00000651626.1; ENST00000524013.1
External Link RMBase: m5C_site_41758
mod ID: M5CSITE004344 Click to Show/Hide the Full List
mod site chr8:127740206-127740207:+
Sequence TCACGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGATTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000259523.10; ENST00000377970.6; ENST00000651626.1; ENST00000524013.1; ENST00000621592.6; ENST00000652288.1; ENST00000652131.1; ENST00000613283.2
External Link RMBase: m5C_site_41759
mod ID: M5CSITE004345 Click to Show/Hide the Full List
mod site chr8:127740207-127740208:+
Sequence CACGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGATTAC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000621592.6; ENST00000652131.1; ENST00000377970.6; ENST00000651626.1; ENST00000652288.1; ENST00000524013.1; ENST00000613283.2; ENST00000259523.10
External Link RMBase: m5C_site_41760
mod ID: M5CSITE004346 Click to Show/Hide the Full List
mod site chr8:127740209-127740210:+
Sequence CGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000621592.6; ENST00000613283.2; ENST00000524013.1; ENST00000259523.10; ENST00000377970.6; ENST00000651626.1; ENST00000652131.1; ENST00000652288.1
External Link RMBase: m5C_site_41761
mod ID: M5CSITE004347 Click to Show/Hide the Full List
mod site chr8:127740210-127740211:+
Sequence GATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000613283.2; ENST00000621592.6; ENST00000652288.1; ENST00000259523.10; ENST00000652131.1; ENST00000524013.1; ENST00000651626.1; ENST00000377970.6
External Link RMBase: m5C_site_41762
mod ID: M5CSITE004348 Click to Show/Hide the Full List
mod site chr8:127740218-127740219:+
Sequence CACCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000621592.6; ENST00000259523.10; ENST00000652288.1; ENST00000651626.1; ENST00000524013.1; ENST00000377970.6; ENST00000652131.1; ENST00000613283.2
External Link RMBase: m5C_site_41763
mod ID: M5CSITE004349 Click to Show/Hide the Full List
mod site chr8:127740974-127740975:+ [74]
Sequence GTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000377970.6; ENST00000524013.1; ENST00000651626.1; ENST00000652288.1; ENST00000621592.6
External Link RMBase: m5C_site_41764
N6-methyladenosine (m6A)
In total 74 m6A sequence/site(s) in this target gene
mod ID: M6ASITE086875 Click to Show/Hide the Full List
mod site chr8:127735610-127735611:+ [75]
Sequence TTTCCTCCACTCTCCCTGGGACTCTTGATCAAAGCGCGGCC
Motif Score 4.065041667
Cell/Tissue List HeLa; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517291.1; ENST00000641252.1; ENST00000259523.10
External Link RMBase: m6A_site_809494
mod ID: M6ASITE086876 Click to Show/Hide the Full List
mod site chr8:127735752-127735753:+ [76]
Sequence CGATGATTTATACTCACAGGACAAGGATGCGGTTTGTCAAA
Motif Score 3.643047619
Cell/Tissue List HeLa; MT4; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517291.1; ENST00000651626.1; ENST00000259523.10; ENST00000641252.1
External Link RMBase: m6A_site_809495
mod ID: M6ASITE086877 Click to Show/Hide the Full List
mod site chr8:127735772-127735773:+ [76]
Sequence ACAAGGATGCGGTTTGTCAAACAGTACTGCTACGGAGGAGC
Motif Score 2.20572619
Cell/Tissue List HeLa; MT4; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000259523.10; ENST00000641252.1; ENST00000517291.1; ENST00000651626.1
External Link RMBase: m6A_site_809496
mod ID: M6ASITE086878 Click to Show/Hide the Full List
mod site chr8:127736069-127736070:+ [76]
Sequence GAGGGTCTGGACGGCTGAGGACCCCCGAGCTGTGCTGCTCG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; MT4; CD4T; peripheral-blood; HEK293T; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517291.1; ENST00000651626.1; ENST00000641036.1; ENST00000621592.6; ENST00000259523.10
External Link RMBase: m6A_site_809497
mod ID: M6ASITE086879 Click to Show/Hide the Full List
mod site chr8:127736427-127736428:+ [76]
Sequence ACCCTTGCCGCATCCACGAAACTTTGCCCATAGCAGCGGGC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000641036.1; ENST00000524013.1; ENST00000621592.6; ENST00000517291.1; ENST00000259523.10; ENST00000651626.1; ENST00000520751.1; ENST00000377970.6
External Link RMBase: m6A_site_809498
mod ID: M6ASITE086880 Click to Show/Hide the Full List
mod site chr8:127736465-127736466:+ [76]
Sequence GGCGGGCACTTTGCACTGGAACTTACAACACCCGAGCAAGG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; CD8T; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000520751.1; ENST00000377970.6; ENST00000641036.1; ENST00000517291.1; ENST00000524013.1; ENST00000651626.1; ENST00000621592.6; ENST00000259523.10
External Link RMBase: m6A_site_809499
mod ID: M6ASITE086882 Click to Show/Hide the Full List
mod site chr8:127736469-127736470:+ [77]
Sequence GGCACTTTGCACTGGAACTTACAACACCCGAGCAAGGACGC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000651626.1; ENST00000377970.6; ENST00000641036.1; ENST00000524013.1; ENST00000259523.10; ENST00000520751.1; ENST00000517291.1; ENST00000621592.6
External Link RMBase: m6A_site_809500
mod ID: M6ASITE086883 Click to Show/Hide the Full List
mod site chr8:127736472-127736473:+ [77]
Sequence ACTTTGCACTGGAACTTACAACACCCGAGCAAGGACGCGAC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000259523.10; ENST00000377970.6; ENST00000517291.1; ENST00000641036.1; ENST00000520751.1; ENST00000621592.6; ENST00000651626.1; ENST00000524013.1
External Link RMBase: m6A_site_809501
mod ID: M6ASITE086884 Click to Show/Hide the Full List
mod site chr8:127736530-127736531:+ [76]
Sequence GCTATTCTGCCCATTTGGGGACACTTCCCCGCCGCTGCCAG
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293; A549; hESC-HEK293T; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; m6A-REF-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000377970.6; ENST00000259523.10; ENST00000621592.6; ENST00000641036.1; ENST00000524013.1; ENST00000520751.1; ENST00000517291.1; ENST00000651626.1
External Link RMBase: m6A_site_809502
mod ID: M6ASITE086885 Click to Show/Hide the Full List
mod site chr8:127736552-127736553:+ [76]
Sequence ACTTCCCCGCCGCTGCCAGGACCCGCTTCTCTGAAAGGCTC
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; HepG2; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651626.1; ENST00000259523.10; ENST00000524013.1; ENST00000621592.6; ENST00000517291.1; ENST00000377970.6; ENST00000520751.1; ENST00000641036.1
External Link RMBase: m6A_site_809503
mod ID: M6ASITE086886 Click to Show/Hide the Full List
mod site chr8:127736618-127736619:+ [76]
Sequence TTTTTTTCGGGTAGTGGAAAACCAGGTAAGCACCGAAGTCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; A549; fibroblasts; Huh7; peripheral-blood; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000520751.1; ENST00000621592.6; ENST00000377970.6; ENST00000259523.10; ENST00000524013.1; ENST00000517291.1; ENST00000613283.2; ENST00000651626.1; ENST00000652131.1
External Link RMBase: m6A_site_809504
mod ID: M6ASITE086887 Click to Show/Hide the Full List
mod site chr8:127738293-127738294:+ [76]
Sequence CGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; fibroblasts; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517291.1; ENST00000613283.2; ENST00000524013.1; ENST00000652288.1; ENST00000652131.1; ENST00000259523.10; ENST00000520751.1; ENST00000377970.6; ENST00000621592.6; ENST00000651626.1
External Link RMBase: m6A_site_809505
mod ID: M6ASITE086888 Click to Show/Hide the Full List
mod site chr8:127738350-127738351:+ [76]
Sequence CTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; fibroblasts; MT4; MM6; Huh7; peripheral-blood; HEK293T; TIME; endometrial; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000377970.6; ENST00000524013.1; ENST00000520751.1; ENST00000259523.10; ENST00000652288.1; ENST00000621592.6; ENST00000517291.1; ENST00000613283.2; ENST00000651626.1; ENST00000652131.1
External Link RMBase: m6A_site_809506
mod ID: M6ASITE086889 Click to Show/Hide the Full List
mod site chr8:127738493-127738494:+ [77]
Sequence CGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000621592.6; ENST00000613283.2; ENST00000524013.1; ENST00000517291.1; ENST00000259523.10; ENST00000652131.1; ENST00000651626.1; ENST00000377970.6; ENST00000652288.1
External Link RMBase: m6A_site_809507
mod ID: M6ASITE086890 Click to Show/Hide the Full List
mod site chr8:127738515-127738516:+ [76]
Sequence ACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; hESC-HEK293T; MT4; H1299; MM6; Huh7; peripheral-blood; MSC; TIME; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000377970.6; ENST00000517291.1; ENST00000524013.1; ENST00000652131.1; ENST00000652288.1; ENST00000613283.2; ENST00000259523.10; ENST00000621592.6; ENST00000651626.1
External Link RMBase: m6A_site_809508
mod ID: M6ASITE086891 Click to Show/Hide the Full List
mod site chr8:127738587-127738588:+ [76]
Sequence GACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000524013.1; ENST00000652288.1; ENST00000621592.6; ENST00000259523.10; ENST00000652131.1; ENST00000613283.2; ENST00000517291.1; ENST00000377970.6; ENST00000651626.1
External Link RMBase: m6A_site_809509
mod ID: M6ASITE086892 Click to Show/Hide the Full List
mod site chr8:127738596-127738597:+ [76]
Sequence GCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACC
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000377970.6; ENST00000621592.6; ENST00000524013.1; ENST00000613283.2; ENST00000517291.1; ENST00000652288.1; ENST00000259523.10; ENST00000651626.1; ENST00000652131.1
External Link RMBase: m6A_site_809510
mod ID: M6ASITE086893 Click to Show/Hide the Full List
mod site chr8:127738620-127738621:+ [78]
Sequence GAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAA
Motif Score 3.616982143
Cell/Tissue List CD8T; A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000621592.6; ENST00000259523.10; ENST00000652288.1; ENST00000524013.1; ENST00000613283.2; ENST00000517291.1; ENST00000377970.6; ENST00000652131.1; ENST00000651626.1
External Link RMBase: m6A_site_809511
mod ID: M6ASITE086894 Click to Show/Hide the Full List
mod site chr8:127738628-127738629:+ [76]
Sequence TCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATC
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000621592.6; ENST00000651626.1; ENST00000259523.10; ENST00000517291.1; ENST00000652288.1; ENST00000613283.2; ENST00000377970.6; ENST00000652131.1; ENST00000524013.1
External Link RMBase: m6A_site_809512
mod ID: M6ASITE086895 Click to Show/Hide the Full List
mod site chr8:127738641-127738642:+ [76]
Sequence CGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTA
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000652131.1; ENST00000259523.10; ENST00000517291.1; ENST00000651626.1; ENST00000613283.2; ENST00000377970.6; ENST00000621592.6; ENST00000652288.1; ENST00000524013.1
External Link RMBase: m6A_site_809513
mod ID: M6ASITE086896 Click to Show/Hide the Full List
mod site chr8:127738656-127738657:+ [76]
Sequence CAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000621592.6; ENST00000377970.6; ENST00000651626.1; ENST00000652288.1; ENST00000517291.1; ENST00000259523.10; ENST00000613283.2; ENST00000652131.1; ENST00000524013.1
External Link RMBase: m6A_site_809514
mod ID: M6ASITE086897 Click to Show/Hide the Full List
mod site chr8:127738734-127738735:+ [76]
Sequence CTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1B; H1A; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000517291.1; ENST00000524013.1; ENST00000259523.10; ENST00000651626.1; ENST00000377970.6; ENST00000652288.1; ENST00000621592.6; ENST00000613283.2; ENST00000652131.1
External Link RMBase: m6A_site_809515
mod ID: M6ASITE086898 Click to Show/Hide the Full List
mod site chr8:127738749-127738750:+ [76]
Sequence CAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCG
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1B; H1A; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517291.1; ENST00000613283.2; ENST00000524013.1; ENST00000651626.1; ENST00000652131.1; ENST00000259523.10; ENST00000652288.1; ENST00000621592.6; ENST00000377970.6
External Link RMBase: m6A_site_809516
mod ID: M6ASITE086899 Click to Show/Hide the Full List
mod site chr8:127738896-127738897:+ [76]
Sequence CAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGT
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; A549; MM6; Huh7; peripheral-blood; HEK293T; MSC; TIME; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652131.1; ENST00000613283.2; ENST00000652288.1; ENST00000651626.1; ENST00000259523.10; ENST00000621592.6; ENST00000524013.1; ENST00000377970.6
External Link RMBase: m6A_site_809517
mod ID: M6ASITE086900 Click to Show/Hide the Full List
mod site chr8:127738991-127738992:+ [76]
Sequence CCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGC
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; hESC-HEK293T; MM6; Huh7; peripheral-blood; iSLK; MSC; endometrial; NB4; AML
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000621592.6; ENST00000259523.10; ENST00000524013.1; ENST00000613283.2; ENST00000377970.6; ENST00000651626.1; ENST00000652288.1; ENST00000652131.1
External Link RMBase: m6A_site_809518
mod ID: M6ASITE086901 Click to Show/Hide the Full List
mod site chr8:127740402-127740403:+ [76]
Sequence TCCTTTCTTAAAGAGGAGGAACAAGAAGATGAGGAAGAAAT
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293; hESC-HEK293T; MM6; Huh7; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; m6A-REF-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000613283.2; rmsk_2646882; ENST00000524013.1; ENST00000652288.1; ENST00000652131.1; ENST00000259523.10; ENST00000377970.6; ENST00000621592.6; ENST00000651626.1
External Link RMBase: m6A_site_809519
mod ID: M6ASITE086902 Click to Show/Hide the Full List
mod site chr8:127740504-127740505:+ [76]
Sequence TCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGT
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; U2OS; MT4; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; GSC-11; MSC; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000621592.6; ENST00000377970.6; ENST00000613283.2; ENST00000651626.1; ENST00000652131.1; ENST00000652288.1; ENST00000524013.1
External Link RMBase: m6A_site_809520
mod ID: M6ASITE086903 Click to Show/Hide the Full List
mod site chr8:127740557-127740558:+ [77]
Sequence CCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCT
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000651626.1; ENST00000652131.1; ENST00000621592.6; ENST00000613283.2; ENST00000377970.6; ENST00000652288.1; ENST00000524013.1
External Link RMBase: m6A_site_809521
mod ID: M6ASITE086904 Click to Show/Hide the Full List
mod site chr8:127740590-127740591:+ [76]
Sequence GCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hESCs; fibroblasts; GM12878; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000613283.2; ENST00000652288.1; ENST00000651626.1; ENST00000621592.6; ENST00000377970.6; ENST00000652131.1; ENST00000524013.1
External Link RMBase: m6A_site_809522
mod ID: M6ASITE086905 Click to Show/Hide the Full List
mod site chr8:127740620-127740621:+ [76]
Sequence TGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGAC
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000652288.1; ENST00000613283.2; ENST00000621592.6; ENST00000651626.1; ENST00000652131.1; ENST00000377970.6; ENST00000524013.1
External Link RMBase: m6A_site_809523
mod ID: M6ASITE086906 Click to Show/Hide the Full List
mod site chr8:127740639-127740640:+ [76]
Sequence GACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000524013.1; ENST00000651626.1; ENST00000377970.6; ENST00000621592.6; ENST00000652288.1; ENST00000613283.2; ENST00000652131.1
External Link RMBase: m6A_site_809524
mod ID: M6ASITE086907 Click to Show/Hide the Full List
mod site chr8:127740650-127740651:+ [77]
Sequence AGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000652131.1; ENST00000377970.6; ENST00000524013.1; ENST00000651626.1; ENST00000621592.6; ENST00000652288.1; ENST00000613283.2
External Link RMBase: m6A_site_809525
mod ID: M6ASITE086908 Click to Show/Hide the Full List
mod site chr8:127740683-127740684:+ [76]
Sequence CACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000652288.1; ENST00000651626.1; ENST00000613283.2; ENST00000524013.1; ENST00000652131.1; ENST00000621592.6; ENST00000377970.6
External Link RMBase: m6A_site_809526
mod ID: M6ASITE086909 Click to Show/Hide the Full List
mod site chr8:127740709-127740710:+ [76]
Sequence AGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGC
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652288.1; ENST00000377970.6; ENST00000524013.1; ENST00000621592.6; ENST00000651626.1; ENST00000613283.2; ENST00000652131.1
External Link RMBase: m6A_site_809527
mod ID: M6ASITE086910 Click to Show/Hide the Full List
mod site chr8:127740713-127740714:+ [77]
Sequence GAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGA
Motif Score 2.084928571
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000652288.1; ENST00000377970.6; ENST00000652131.1; ENST00000524013.1; ENST00000613283.2; ENST00000621592.6; ENST00000651626.1
External Link RMBase: m6A_site_809528
mod ID: M6ASITE086911 Click to Show/Hide the Full List
mod site chr8:127740794-127740795:+ [76]
Sequence CCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGG
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000621592.6; ENST00000652131.1; ENST00000524013.1; ENST00000377970.6; ENST00000613283.2; ENST00000651626.1; ENST00000652288.1
External Link RMBase: m6A_site_809529
mod ID: M6ASITE086912 Click to Show/Hide the Full List
mod site chr8:127740842-127740843:+ [77]
Sequence CCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000377970.6; ENST00000613283.2; ENST00000524013.1; ENST00000621592.6; ENST00000652131.1; ENST00000651626.1; ENST00000652288.1
External Link RMBase: m6A_site_809530
mod ID: M6ASITE086913 Click to Show/Hide the Full List
mod site chr8:127740890-127740891:+ [76]
Sequence AAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000621592.6; ENST00000524013.1; ENST00000652288.1; ENST00000651626.1; ENST00000652131.1; ENST00000377970.6; ENST00000613283.2
External Link RMBase: m6A_site_809531
mod ID: M6ASITE086914 Click to Show/Hide the Full List
mod site chr8:127740912-127740913:+ [76]
Sequence TTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000651626.1; ENST00000377970.6; ENST00000524013.1; ENST00000613283.2; ENST00000652288.1; ENST00000621592.6; ENST00000652131.1
External Link RMBase: m6A_site_809532
mod ID: M6ASITE086915 Click to Show/Hide the Full List
mod site chr8:127740921-127740922:+ [76]
Sequence AAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACG
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000651626.1; ENST00000377970.6; ENST00000621592.6; ENST00000613283.2; ENST00000652131.1; ENST00000524013.1; ENST00000652288.1
External Link RMBase: m6A_site_809533
mod ID: M6ASITE086916 Click to Show/Hide the Full List
mod site chr8:127740927-127740928:+ [76]
Sequence CGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000377970.6; ENST00000621592.6; ENST00000652131.1; ENST00000613283.2; ENST00000651626.1; ENST00000652288.1; ENST00000524013.1
External Link RMBase: m6A_site_809534
mod ID: M6ASITE086917 Click to Show/Hide the Full List
mod site chr8:127740933-127740934:+ [76]
Sequence CAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000651626.1; ENST00000524013.1; ENST00000613283.2; ENST00000652288.1; ENST00000621592.6; ENST00000377970.6; ENST00000652131.1
External Link RMBase: m6A_site_809535
mod ID: M6ASITE086918 Click to Show/Hide the Full List
mod site chr8:127740944-127740945:+ [76]
Sequence CAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000377970.6; ENST00000651626.1; ENST00000621592.6; ENST00000652288.1; ENST00000652131.1; ENST00000524013.1; ENST00000613283.2
External Link RMBase: m6A_site_809536
mod ID: M6ASITE086919 Click to Show/Hide the Full List
mod site chr8:127740973-127740974:+ [79]
Sequence CGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAAT
Motif Score 2.179660714
Cell/Tissue List HEK293T; CD8T
Seq Type List DART-seq; m6A-CLIP/IP
Transcript ID List ENST00000524013.1; ENST00000621592.6; ENST00000377970.6; ENST00000652288.1; ENST00000651626.1
External Link RMBase: m6A_site_809537
mod ID: M6ASITE086920 Click to Show/Hide the Full List
mod site chr8:127740986-127740987:+ [80]
Sequence AAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATC
Motif Score 2.168095238
Cell/Tissue List HEK293; hESC-HEK293T; CD8T
Seq Type List m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000651626.1; ENST00000621592.6; ENST00000377970.6; ENST00000652288.1; ENST00000524013.1
External Link RMBase: m6A_site_809538
mod ID: M6ASITE086921 Click to Show/Hide the Full List
mod site chr8:127741015-127741016:+ [76]
Sequence TCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000621592.6; ENST00000377970.6; ENST00000524013.1; ENST00000651626.1; ENST00000652288.1
External Link RMBase: m6A_site_809539
mod ID: M6ASITE086922 Click to Show/Hide the Full List
mod site chr8:127741043-127741044:+ [78]
Sequence CAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAGT
Motif Score 2.153267857
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000524013.1; ENST00000377970.6; ENST00000651626.1; ENST00000621592.6; ENST00000652288.1
External Link RMBase: m6A_site_809540
mod ID: M6ASITE086923 Click to Show/Hide the Full List
mod site chr8:127741048-127741049:+ [79]
Sequence GCATGATCAAATGCAACCTCACAACCTTGGCTGAGTCTTGA
Motif Score 2.047297619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000524013.1; ENST00000651626.1; ENST00000377970.6; ENST00000652288.1; ENST00000621592.6
External Link RMBase: m6A_site_809541
mod ID: M6ASITE086924 Click to Show/Hide the Full List
mod site chr8:127741051-127741052:+ [78]
Sequence TGATCAAATGCAACCTCACAACCTTGGCTGAGTCTTGAGAC
Motif Score 2.153267857
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000621592.6; ENST00000651626.1; ENST00000377970.6; ENST00000524013.1; ENST00000652288.1
External Link RMBase: m6A_site_809542
mod ID: M6ASITE086925 Click to Show/Hide the Full List
mod site chr8:127741070-127741071:+ [76]
Sequence AACCTTGGCTGAGTCTTGAGACTGAAAGATTTAGCCATAAT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000377970.6; ENST00000652288.1; ENST00000621592.6; ENST00000651626.1; ENST00000524013.1
External Link RMBase: m6A_site_809543
mod ID: M6ASITE086926 Click to Show/Hide the Full List
mod site chr8:127741095-127741096:+ [76]
Sequence AAGATTTAGCCATAATGTAAACTGCCTCAAATTGGACTTTG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000651626.1; ENST00000524013.1; ENST00000377970.6; ENST00000621592.6; ENST00000652288.1
External Link RMBase: m6A_site_809544
mod ID: M6ASITE086927 Click to Show/Hide the Full List
mod site chr8:127741110-127741111:+ [76]
Sequence TGTAAACTGCCTCAAATTGGACTTTGGGCATAAAAGAACTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000652288.1; ENST00000524013.1; ENST00000651626.1; ENST00000377970.6; ENST00000621592.6
External Link RMBase: m6A_site_809545
mod ID: M6ASITE086928 Click to Show/Hide the Full List
mod site chr8:127741127-127741128:+ [76]
Sequence TGGACTTTGGGCATAAAAGAACTTTTTTATGCTTACCATCT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000524013.1; ENST00000621592.6; ENST00000652288.1; ENST00000377970.6; ENST00000651626.1
External Link RMBase: m6A_site_809546
mod ID: M6ASITE086929 Click to Show/Hide the Full List
mod site chr8:127741206-127741207:+ [79]
Sequence TTTAAAAAATTTTAAGATTTACACAATGTTTCTCTGTAAAT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000524013.1; ENST00000651626.1; ENST00000377970.6; ENST00000652288.1; ENST00000621592.6
External Link RMBase: m6A_site_809547
mod ID: M6ASITE086930 Click to Show/Hide the Full List
mod site chr8:127741258-127741259:+ [79]
Sequence ATGTAAATAACTTTAATAAAACGTTTATAGCAGTTACACAG
Motif Score 2.179660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000524013.1; ENST00000651626.1; ENST00000652288.1; ENST00000621592.6; ENST00000377970.6
External Link RMBase: m6A_site_809548
mod ID: M6ASITE086931 Click to Show/Hide the Full List
mod site chr8:127741273-127741274:+ [77]
Sequence ATAAAACGTTTATAGCAGTTACACAGAATTTCAATCCTAGT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000652288.1; ENST00000524013.1; ENST00000651626.1; ENST00000621592.6; ENST00000377970.6
External Link RMBase: m6A_site_809549
mod ID: M6ASITE086932 Click to Show/Hide the Full List
mod site chr8:127741324-127741325:+ [81]
Sequence TAGTATTATAGGTACTATAAACCCTAATTTTTTTTATTTAA
Motif Score 2.185083333
Cell/Tissue List HEK293T; HepG2; GM12878; Huh7; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000524013.1; ENST00000652288.1; ENST00000651626.1; ENST00000621592.6; ENST00000377970.6
External Link RMBase: m6A_site_809550
mod ID: M6ASITE086933 Click to Show/Hide the Full List
mod site chr8:127741347-127741348:+ [79]
Sequence CTAATTTTTTTTATTTAAGTACATTTTGCTTTTTAAAGTTG
Motif Score 2.856142857
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000652288.1; ENST00000621592.6; ENST00000651626.1; ENST00000377970.6; ENST00000524013.1
External Link RMBase: m6A_site_809551
mod ID: M6ASITE086934 Click to Show/Hide the Full List
mod site chr8:127741611-127741612:+ [76]
Sequence TTCTAAGATGCTTCCTGGAGACTATGATAACAGCCAGAGTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809552
mod ID: M6ASITE086935 Click to Show/Hide the Full List
mod site chr8:127741735-127741736:+ [76]
Sequence GTACACAAAGAGGCATAAGGACTGGGGAGTTGGGAGGAAGG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809553
mod ID: M6ASITE086936 Click to Show/Hide the Full List
mod site chr8:127741766-127741767:+ [76]
Sequence GGGAGGAAGGTGAGGAAGAAACTCCTGTTACTTTAGTTAAC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809554
mod ID: M6ASITE086937 Click to Show/Hide the Full List
mod site chr8:127741852-127741853:+ [76]
Sequence TTGATGGGGACACGGTGGGAACCAGCTTCTGCTGCCTTCAC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809555
mod ID: M6ASITE086938 Click to Show/Hide the Full List
mod site chr8:127741910-127741911:+ [76]
Sequence GTCCATGGGTTATCTCGCAAACCCCAGAGGATCTCTGGGAG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809556
mod ID: M6ASITE086939 Click to Show/Hide the Full List
mod site chr8:127741959-127741960:+ [76]
Sequence CTATTAACCCTATTTCACAAACAAGGAAATAGAAGAGCTCA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809557
mod ID: M6ASITE086940 Click to Show/Hide the Full List
mod site chr8:127742035-127742036:+ [82]
Sequence AATACAAAGCAGCAATCTGGACCCATTCTGTTCAAAACACT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809558
mod ID: M6ASITE086941 Click to Show/Hide the Full List
mod site chr8:127742051-127742052:+ [82]
Sequence CTGGACCCATTCTGTTCAAAACACTTAACCCTTCGCTATCA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809559
mod ID: M6ASITE086942 Click to Show/Hide the Full List
mod site chr8:127742120-127742121:+ [82]
Sequence TGAGATCAAGAAGGTTTAGGACCTAATGGACAGACTCAAGT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809560
mod ID: M6ASITE086943 Click to Show/Hide the Full List
mod site chr8:127742129-127742130:+ [82]
Sequence GAAGGTTTAGGACCTAATGGACAGACTCAAGTCATAACAAT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809561
mod ID: M6ASITE086944 Click to Show/Hide the Full List
mod site chr8:127742276-127742277:+ [82]
Sequence GGAAGCTGAGGCACACAAAGACTCATCCACATGCCCAAGAT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809562
mod ID: M6ASITE086945 Click to Show/Hide the Full List
mod site chr8:127742330-127742331:+ [82]
Sequence AAAGTGGAAGCGAGATTTGAACCCAGGCTGTTTACTCCTAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809563
mod ID: M6ASITE086946 Click to Show/Hide the Full List
mod site chr8:127742586-127742587:+ [82]
Sequence TTAGCCATTTGTTGAATCAGACTCATGACGGCTCCTGGGAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809564
mod ID: M6ASITE086947 Click to Show/Hide the Full List
mod site chr8:127742633-127742634:+ [82]
Sequence AGTTCAGATCATAAAATAAAACATATTTATTCTTTGTCATG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809565
mod ID: M6ASITE086948 Click to Show/Hide the Full List
mod site chr8:127742672-127742673:+ [82]
Sequence TGGGAGTCATTATTTTAGAAACTACAAACTCTCCTTGCTTC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809566
mod ID: M6ASITE086949 Click to Show/Hide the Full List
mod site chr8:127742679-127742680:+ [82]
Sequence CATTATTTTAGAAACTACAAACTCTCCTTGCTTCCATCCTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000621592.6
External Link RMBase: m6A_site_809567
Pseudouridine (Pseudo)
In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000266 Click to Show/Hide the Full List
mod site chr8:127736350-127736351:+ [83]
Sequence GAAGGGAGATCCGGAGCGAATAGGGGGCTTCGCCTCTGGCC
Transcript ID List ENST00000377970.6; ENST00000641036.1; ENST00000259523.10; ENST00000520751.1; ENST00000517291.1; ENST00000524013.1; ENST00000621592.6; ENST00000651626.1
External Link RMBase: Pseudo_site_4664