m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00339)

Target Name	Serine/threonine-protein kinase mTOR (MTOR)
Synonyms	FK506-binding protein 12-rapamycin complex-associated protein 1; FKBP12-rapamycin complex-associated protein; Mammalian target of rapamycin; mTOR; Mechanistic target of rapamycin; Rapamycin and FKBP12 target 1; Rapamycin target protein 1; FRAP; FRAP1; FRAP2; RAFT1; RAPT1 Click to Show/Hide
Gene Name	MTOR
Chromosomal Location	1p36.22
Family	PI3/PI4-kinase family
Function	Serine/threonine protein kinase which is a central regulator of cellular metabolism, growth and survival in response to hormones, growth factors, nutrients, energy and stress signals. MTOR directly or indirectly regulates the phosphorylation of at least 800 proteins. Functions as part of 2 structurally and functionally distinct signaling complexes mTORC1 and mTORC2 (mTOR complex 1 and 2). Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis. This includes phosphorylation of EIF4EBP1 and release of its inhibition toward the elongation initiation factor 4E (eiF4E) (By similarity). Moreover, phosphorylates and activates RPS6KB1 and RPS6KB2 that promote protein synthesis by modulating the activity of their downstream targets including ribosomal protein S6, eukaryotic translation initiation factor EIF4B, and the inhibitor of translation initiation PDCD4. This also includes mTORC1 signaling cascade controlling the MiT/TFE factors TFEB and TFE3: in the presence of nutrients, mediates phosphorylation of TFEB and TFE3, promoting their cytosolic retention and inactivation. Upon starvation or lysosomal stress, inhibition of mTORC1 induces dephosphorylation and nuclear translocation of TFEB and TFE3, promoting their transcription factor activity. Stimulates the pyrimidine biosynthesis pathway, both by acute regulation through RPS6KB1-mediated phosphorylation of the biosynthetic enzyme CAD, and delayed regulation, through transcriptional enhancement of the pentose phosphate pathway which produces 5-phosphoribosyl-1-pyrophosphate (PRPP), an allosteric activator of CAD at a later step in synthesis, this function is dependent on the mTORC1 complex . Regulates ribosome synthesis by activating RNA polymerase III-dependent transcription through phosphorylation and inhibition of MAF1 an RNA polymerase III-repressor . In parallel to protein synthesis, also regulates lipid synthesis through SREBF1/SREBP1 and LPIN1 (By similarity). To maintain energy homeostasis mTORC1 may also regulate mitochondrial biogenesis through regulation of PPARGC1A (By similarity). mTORC1 also negatively regulates autophagy through phosphorylation of ULK1 (By similarity). Under nutrient sufficiency, phosphorylates ULK1 at 'Ser-758', disrupting the interaction with AMPK and preventing activation of ULK1 (By similarity). Also prevents autophagy through phosphorylation of the autophagy inhibitor DAP. Also prevents autophagy by phosphorylating RUBCNL/Pacer under nutrient-rich conditions. Prevents autophagy by mediating phosphorylation of AMBRA1, thereby inhibiting AMBRA1 ability to mediate ubiquitination of ULK1 and interaction between AMBRA1 and PPP2CA . mTORC1 exerts a feedback control on upstream growth factor signaling that includes phosphorylation and activation of GRB10 a INSR-dependent signaling suppressor. Among other potential targets mTORC1 may phosphorylate CLIP1 and regulate microtubules. As part of the mTORC2 complex MTOR may regulate other cellular processes including survival and organization of the cytoskeleton. Plays a critical role in the phosphorylation at 'Ser-473' of AKT1, a pro-survival effector of phosphoinositide 3-kinase, facilitating its activation by PDK1. mTORC2 may regulate the actin cytoskeleton, through phosphorylation of PRKCA, PXN and activation of the Rho-type guanine nucleotide exchange factors RHOA and RAC1A or RAC1B. mTORC2 also regulates the phosphorylation of SGK1 at 'Ser-422'. Regulates osteoclastogenesis by adjusting the expression of CEBPB isoforms (By similarity). Plays an important regulatory role in the circadian clock function; regulates period length and rhythm amplitude of the suprachiasmatic nucleus (SCN) and liver clocks (By similarity). Phosphorylates SQSTM1, promoting interaction between SQSTM1 and KEAP1 and subsequent inactivation of the BCR(KEAP1) complex (By similarity). Click to Show/Hide
Gene ID	2475
Uniprot ID	MTOR_HUMAN
HGNC ID	HGNC:3942
KEGG ID	hsa:2475

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MTOR can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Liver	Mus musculus
Treatment: Mettl3 knockout liver Control: Wild type liver cells		GSE198512
Regulation		logFC: 8.34E-01 p-value: 1.58E-02
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between MTOR and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.47E+00	GSE60213

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathway.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in pI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Target Regulation	Down regulation
Responsed Disease	Renal cell carcinoma		ICD-11: 2C90	Disease Info
Cell Process	Epithelial-to-mesenchymal transition
	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulation	Up regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	The contribution of METTL3-mediated m6A modification of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of Serine/threonine-protein kinase mTOR (MTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Target Regulation	Up regulation
Responsed Disease	Non-alcoholic fatty liver disease		ICD-11: DB92	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	HIF-1 signaling pathway			hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between MTOR and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.73E+00	GSE63591

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	YTHDF1 contributes to the progression of HCC by activating PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) signaling pathway and inducing EMT.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151), mTOR signaling pathway
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
	Cell proliferation
In-vitro Model	SNU-398	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0077
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	PLC/PRF/5	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0485
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
In-vivo Model	Ten four-week-old BALB/c male nude mice (GemPharmatech, Jiangsu, China) were subcutaneously injected with control Huh7 cells 2 × 10⁶ (left-back) and stable knockdown of YTHDF1 Huh7 cells 2 × 10⁶ (right-back). These cells were respectively premixed with 50 ul Matrigel (Corning, 354,234) in 100 ul PBS.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathway and the EMT pathway, respectively.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathway and the EMT pathway, respectively.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 5 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	WM_Score correlated highly with the regulation of transcription and post-transcriptional events contributing to the development of colorectal cancer. In response to anti-cancer drugs, WM_Score highly negatively correlated (drug sensitive) with drugs which targeted oncogenic related pathways, such as MAPK, EGFR, and Serine/threonine-protein kinase mTOR (MTOR) signaling pathways, positively correlated (drug resistance) with drugs which targeted in apoptosis and cell cycle. Importantly, the WM_Score was associated with the therapeutic efficacy of PD-L1 blockade, suggesting that the development of potential drugs targeting these "writers" to aid the clinical benefits of immunotherapy.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Pathway Response	MAPK signaling pathway			hsa04010
	VEGF signaling pathway			hsa04370
	mTOR signaling pathway			hsa04150
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	Cell apoptosis
Experiment 2 Reporting the m6A-centered Disease Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A-centered Disease Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A-centered Disease Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 5 Reporting the m6A-centered Disease Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Gastrointestinal cancer [ICD-11: 2C11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	m6A regulators were mostly upregulated in Gastrointestinal cancer and their differential expression significantly influenced the overall survival of patients with GI cancer. The phosphatidylinositol-3-kinase (PI3K)/Akt and mammalian target of rapamycin Serine/threonine-protein kinase mTOR (MTOR) signaling pathways were found to be potentially affected by m6A modification in most human cancers, including GI cancer, which was further verified by m6A-Seq and phospho-MAPK array.
Responsed Disease	Gastrointestinal cancer [ICD-11: 2C11]
Pathway Response	PI3K-Akt signaling pathway			hsa04151), mTOR signaling pathway
In-vitro Model	()
	()
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	YTHDF1 contributes to the progression of HCC by activating PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) signaling pathway and inducing EMT.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151), mTOR signaling pathway
Cell Process	Epithelial-mesenchymal transition
	Cell migration
	Cell invasion
	Cell proliferation
In-vitro Model	SNU-398	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0077
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	PLC/PRF/5	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0485
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
In-vivo Model	Ten four-week-old BALB/c male nude mice (GemPharmatech, Jiangsu, China) were subcutaneously injected with control Huh7 cells 2 × 10⁶ (left-back) and stable knockdown of YTHDF1 Huh7 cells 2 × 10⁶ (right-back). These cells were respectively premixed with 50 ul Matrigel (Corning, 354,234) in 100 ul PBS.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathway.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in pI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Responsed Disease	Renal cell carcinoma [ICD-11: 2C90]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Epithelial-to-mesenchymal transition
Cell Process	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.

Retina cancer [ICD-11: 2D02]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Responsed Disease	Retinoblastoma [ICD-11: 2D02.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

Non-alcoholic fatty liver disease [ICD-11: DB92]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[4]
Response Summary	The contribution of METTL3-mediated m6A modification of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of Serine/threonine-protein kinase mTOR (MTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Responsed Disease	Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.

Asparagine inhibitor [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Chloroquine [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Meclofenamate sodium [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Rapamycin [Approved]

Drug Info

In total 3 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/Serine/threonine-protein kinase mTOR (MTOR) pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).
Experiment 3 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

CB-839 [Phase 2]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Serine/threonine-protein kinase mTOR (MTOR) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

GLS-IN-968 [Investigative]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[6]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Serine/threonine-protein kinase mTOR (MTOR), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02151		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02164		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02177		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02190		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03340		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Rapamycin	Drug Info
Crosstalk ID: M6ACROT03341		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	GLS-IN-968	Drug Info
Crosstalk ID: M6ACROT03342		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	CB-839	Drug Info
Crosstalk ID: M6ACROT03343		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Meclofenamate sodium	Drug Info
Crosstalk ID: M6ACROT03344		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Chloroquine	Drug Info
Crosstalk ID: M6ACROT03345		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Asparagine inhibitor	Drug Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03387		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03400		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03438		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Rapamycin	Drug Info
Crosstalk ID: M6ACROT03439		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	GLS-IN-968	Drug Info
Crosstalk ID: M6ACROT03440		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	CB-839	Drug Info
Crosstalk ID: M6ACROT03441		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Meclofenamate sodium	Drug Info
Crosstalk ID: M6ACROT03442		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Chloroquine	Drug Info
Crosstalk ID: M6ACROT03443		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Asparagine inhibitor	Drug Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03500		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00339)

Serine/threonine-protein kinase mTOR (MTOR)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002482		Click to Show/Hide the Full List
mod site	chr1:11120405-11120406:-		[8]
Sequence	AGCTGGGATTACAGGCACGTACCACCATGTGGGTTAATTTT
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: RNA-editing_site_1299
mod ID: A2ISITE002511		Click to Show/Hide the Full List
mod site	chr1:11142255-11142256:-		[8]
Sequence	TCCCAAAGTTCTGGGATTACAGGCATGAGCCACCATGCCTG
Transcript ID List	ENST00000495435.1; ENST00000361445.8
External Link	RMBase: RNA-editing_site_1300
mod ID: A2ISITE002515		Click to Show/Hide the Full List
mod site	chr1:11235859-11235860:-		[8]
Sequence	CCTCCTGAGTAGCTGGGACTACAGGCGCCCGCCACCACGCC
Transcript ID List	ENST00000361445.8
External Link	RMBase: RNA-editing_site_1301
mod ID: A2ISITE002516		Click to Show/Hide the Full List
mod site	chr1:11236316-11236317:-		[8]
Sequence	ATGACAAACCACGTCTCTACAAAATATACGAAAGTTAGCTG
Transcript ID List	ENST00000361445.8; rmsk_21463
External Link	RMBase: RNA-editing_site_1302

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000219		Click to Show/Hide the Full List
mod site	chr1:11247410-11247411:-		[9]
Sequence	ACAGAGAGGCAATTCTATGGCCAAGCAAATTTTCATGTATG
Cell/Tissue List	HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: Nm_site_30

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005321		Click to Show/Hide the Full List
mod site	chr1:11212374-11212375:-
Sequence	GTTCGAACACTGGACCAGAGCCCAGAACTGCGCTCCACAGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m5C_site_855

N6-methyladenosine (m6A)

In total 205 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074317		Click to Show/Hide the Full List
mod site	chr1:11106538-11106539:-		[10]
Sequence	AAATGACATCAGAATTTTAAACATATGTATATGAGTGGCGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7120
mod ID: M6ASITE074346		Click to Show/Hide the Full List
mod site	chr1:11106553-11106554:-		[11]
Sequence	AATTTTTGTGCCAATAAATGACATCAGAATTTTAAACATAT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7121
mod ID: M6ASITE074431		Click to Show/Hide the Full List
mod site	chr1:11106593-11106594:-		[10]
Sequence	TAAAGTGTAGCCATGTCTAGACACCATGTTGTATCAGAATA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7122
mod ID: M6ASITE074432		Click to Show/Hide the Full List
mod site	chr1:11106635-11106636:-		[11]
Sequence	AAATTATGAGCAGAACAAATACTCAACTAAATGCACAAAGT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7123
mod ID: M6ASITE074499		Click to Show/Hide the Full List
mod site	chr1:11106641-11106642:-		[10]
Sequence	TATTGGAAATTATGAGCAGAACAAATACTCAACTAAATGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESCs; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7124
mod ID: M6ASITE074528		Click to Show/Hide the Full List
mod site	chr1:11106682-11106683:-		[10]
Sequence	TACTGTCATGGAGGTGCTGAACACAGGGAAGGTCTGGTACA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; hESCs; Huh7
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7125
mod ID: M6ASITE074529		Click to Show/Hide the Full List
mod site	chr1:11106709-11106710:-		[10]
Sequence	TTAGAGCAAGGGCTCAGAAAACAGAAATACTGTCATGGAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESCs; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7126
mod ID: M6ASITE074534		Click to Show/Hide the Full List
mod site	chr1:11106792-11106793:-		[10]
Sequence	GGGGATCACTGTGCAGTGGGACCACCCTCACTGGCCTTCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7127
mod ID: M6ASITE074535		Click to Show/Hide the Full List
mod site	chr1:11106876-11106877:-		[10]
Sequence	CTCACACGCTTCAATTCAAGACCTGACCGCTAGTAGGGAGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; Huh7; peripheral-blood; HEK293A-TOA; iSLK; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7128
mod ID: M6ASITE074623		Click to Show/Hide the Full List
mod site	chr1:11106893-11106894:-		[12]
Sequence	ACCCAGTGATGCTGCGACTCACACGCTTCAATTCAAGACCT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7129
mod ID: M6ASITE074624		Click to Show/Hide the Full List
mod site	chr1:11106913-11106914:-		[10]
Sequence	AAAGGTCTGTCTTCCATCAGACCCAGTGATGCTGCGACTCA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7130
mod ID: M6ASITE074625		Click to Show/Hide the Full List
mod site	chr1:11106936-11106937:-		[11]
Sequence	CAAGATAGGCCAAAATGAGTACAAAAGGTCTGTCTTCCATC
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7131
mod ID: M6ASITE074650		Click to Show/Hide the Full List
mod site	chr1:11106975-11106976:-		[10]
Sequence	AAGACCTCACTGGTCTGTGGACAGCAGCAGAAATGTTTGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7132
mod ID: M6ASITE074651		Click to Show/Hide the Full List
mod site	chr1:11106992-11106993:-		[10]
Sequence	CCCCTGCCACCTATCCCAAGACCTCACTGGTCTGTGGACAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7133
mod ID: M6ASITE074652		Click to Show/Hide the Full List
mod site	chr1:11107031-11107032:-		[11]
Sequence	GGATCCTAGACTGTAAAGACACAGAAGATGCTGACCTCACC
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7134
mod ID: M6ASITE074655		Click to Show/Hide the Full List
mod site	chr1:11107033-11107034:-		[10]
Sequence	TAGGATCCTAGACTGTAAAGACACAGAAGATGCTGACCTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7135
mod ID: M6ASITE074689		Click to Show/Hide the Full List
mod site	chr1:11107042-11107043:-		[10]
Sequence	AACATGGATTAGGATCCTAGACTGTAAAGACACAGAAGATG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7136
mod ID: M6ASITE074690		Click to Show/Hide the Full List
mod site	chr1:11107061-11107062:-		[10]
Sequence	GAAGCCTCAGGTCGTGGAGAACATGGATTAGGATCCTAGAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7137
mod ID: M6ASITE074691		Click to Show/Hide the Full List
mod site	chr1:11107089-11107090:-		[13]
Sequence	ATGGGTACAGCAAACTCAGCACAGCCAAGAAGCCTCAGGTC
Motif Score	2.830589286
Cell/Tissue List	HEK293; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7138
mod ID: M6ASITE074692		Click to Show/Hide the Full List
mod site	chr1:11107096-11107097:-		[10]
Sequence	TCTCAACATGGGTACAGCAAACTCAGCACAGCCAAGAAGCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7139
mod ID: M6ASITE074693		Click to Show/Hide the Full List
mod site	chr1:11107111-11107112:-		[13]
Sequence	TGACCTAGTTGCTCCTCTCAACATGGGTACAGCAAACTCAG
Motif Score	2.173910714
Cell/Tissue List	brain; liver; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7140
mod ID: M6ASITE074694		Click to Show/Hide the Full List
mod site	chr1:11107129-11107130:-		[11]
Sequence	TACTTGCTGATGGAAGAATGACCTAGTTGCTCCTCTCAACA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7141
mod ID: M6ASITE074695		Click to Show/Hide the Full List
mod site	chr1:11107161-11107162:-		[10]
Sequence	TTGACTTAACTCACAAGAGAACTCATCATAAGTACTTGCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7142
mod ID: M6ASITE074696		Click to Show/Hide the Full List
mod site	chr1:11107169-11107170:-		[11]
Sequence	TACGGGTTTTGACTTAACTCACAAGAGAACTCATCATAAGT
Motif Score	2.047297619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7143
mod ID: M6ASITE074697		Click to Show/Hide the Full List
mod site	chr1:11107173-11107174:-		[11]
Sequence	GAAATACGGGTTTTGACTTAACTCACAAGAGAACTCATCAT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7144
mod ID: M6ASITE074698		Click to Show/Hide the Full List
mod site	chr1:11107178-11107179:-		[11]
Sequence	CTTTAGAAATACGGGTTTTGACTTAACTCACAAGAGAACTC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7145
mod ID: M6ASITE074699		Click to Show/Hide the Full List
mod site	chr1:11107199-11107200:-		[11]
Sequence	TGGGGAACAGAAGATCCATAACTTTAGAAATACGGGTTTTG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7146
mod ID: M6ASITE074733		Click to Show/Hide the Full List
mod site	chr1:11107213-11107214:-		[10]
Sequence	CAAGCCATTCATTTTGGGGAACAGAAGATCCATAACTTTAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7147
mod ID: M6ASITE074802		Click to Show/Hide the Full List
mod site	chr1:11107241-11107242:-		[11]
Sequence	CAGTGAAACATAGTAATACCACGTAAATCAAGCCATTCATT
Motif Score	2.027047619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7148
mod ID: M6ASITE074803		Click to Show/Hide the Full List
mod site	chr1:11107254-11107255:-		[10]
Sequence	TTGGTTCCCAGGACAGTGAAACATAGTAATACCACGTAAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; hESC-HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7149
mod ID: M6ASITE074804		Click to Show/Hide the Full List
mod site	chr1:11107262-11107263:-		[10]
Sequence	GGCTTGATTTGGTTCCCAGGACAGTGAAACATAGTAATACC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; hESC-HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7150
mod ID: M6ASITE074833		Click to Show/Hide the Full List
mod site	chr1:11107286-11107287:-		[11]
Sequence	AAGAATATATTGTCAGAAACACAAGGCTTGATTTGGTTCCC
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5; ENST00000473471.5
External Link	RMBase: m6A_site_7151
mod ID: M6ASITE074909		Click to Show/Hide the Full List
mod site	chr1:11107288-11107289:-		[10]
Sequence	TGAAGAATATATTGTCAGAAACACAAGGCTTGATTTGGTTC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; hESC-HEK293T; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5; ENST00000473471.5
External Link	RMBase: m6A_site_7152
mod ID: M6ASITE074926		Click to Show/Hide the Full List
mod site	chr1:11107328-11107329:-		[10]
Sequence	TATATTAAAAGTTGGTTTGAACCAACTTTCTAGCTGCTGTT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; HepG2; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000490931.1; ENST00000473471.5; ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7153
mod ID: M6ASITE074927		Click to Show/Hide the Full List
mod site	chr1:11107355-11107356:-		[10]
Sequence	TTGAAATGTAAATGAAAAGAACTACTGTATATTAAAAGTTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; hNPCs; fibroblasts; A549; GM12878; CD8T; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000361445.8; ENST00000473471.5; ENST00000376838.5; ENST00000490931.1
External Link	RMBase: m6A_site_7154
mod ID: M6ASITE074944		Click to Show/Hide the Full List
mod site	chr1:11107390-11107391:-		[11]
Sequence	AACCATGGTGAGAAAGTTTGACTTTGTTAAATATTTTGAAA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000473471.5; ENST00000376838.5; ENST00000490931.1
External Link	RMBase: m6A_site_7155
mod ID: M6ASITE074962		Click to Show/Hide the Full List
mod site	chr1:11107409-11107410:-		[11]
Sequence	AATGCTTCCACTAAACTGAAACCATGGTGAGAAAGTTTGAC
Motif Score	2.185083333
Cell/Tissue List	HEK293T; HepG2; HeLa; A549
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000490931.1; ENST00000376838.5; ENST00000473471.5; ENST00000361445.8
External Link	RMBase: m6A_site_7156
mod ID: M6ASITE074963		Click to Show/Hide the Full List
mod site	chr1:11107415-11107416:-		[14]
Sequence	TTAGTAAATGCTTCCACTAAACTGAAACCATGGTGAGAAAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HepG2; HeLa; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000490931.1; ENST00000376838.5; ENST00000473471.5
External Link	RMBase: m6A_site_7157
mod ID: M6ASITE074964		Click to Show/Hide the Full List
mod site	chr1:11107438-11107439:-		[11]
Sequence	GTTTTTTCTGAGGCTTTTGTACTTTAGTAAATGCTTCCACT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376838.5; ENST00000490931.1; ENST00000361445.8; ENST00000473471.5
External Link	RMBase: m6A_site_7158
mod ID: M6ASITE074965		Click to Show/Hide the Full List
mod site	chr1:11108264-11108265:-		[11]
Sequence	TCGGGACTTCTCTCATGATGACACTTTGGATGTTCCAACGC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000490931.1; ENST00000376838.5; ENST00000361445.8; ENST00000473471.5
External Link	RMBase: m6A_site_7159
mod ID: M6ASITE074966		Click to Show/Hide the Full List
mod site	chr1:11111575-11111576:-		[15]
Sequence	AAAAGGGGACTTCACTGTGAACCGTAGCTGCGAAGAGAGCA
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000490931.1; ENST00000473471.5; ENST00000455339.1; ENST00000376838.5
External Link	RMBase: m6A_site_7160
mod ID: M6ASITE074967		Click to Show/Hide the Full List
mod site	chr1:11111587-11111588:-		[15]
Sequence	GTGGAGATTCAGAAAAGGGGACTTCACTGTGAACCGTAGCT
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000455339.1; ENST00000376838.5; ENST00000473471.5; ENST00000490931.1; ENST00000361445.8
External Link	RMBase: m6A_site_7161
mod ID: M6ASITE074968		Click to Show/Hide the Full List
mod site	chr1:11112901-11112902:-		[12]
Sequence	CCTAGCAAATACCAAAGGCAACAAGCGATCCCGAACGAGGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000473471.5; ENST00000490931.1; ENST00000455339.1; ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7162
mod ID: M6ASITE075011		Click to Show/Hide the Full List
mod site	chr1:11114319-11114320:-		[12]
Sequence	GCTGAACTGGAGGCTGATGGACAGTGAGTATCATCAAGTGC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000473471.5; ENST00000361445.8; ENST00000455339.1; ENST00000376838.5; ENST00000490931.1
External Link	RMBase: m6A_site_7163
mod ID: M6ASITE075049		Click to Show/Hide the Full List
mod site	chr1:11114334-11114335:-		[11]
Sequence	TGTCTATGACCCCTTGCTGAACTGGAGGCTGATGGACAGTG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000455339.1; ENST00000490931.1; ENST00000376838.5; ENST00000473471.5
External Link	RMBase: m6A_site_7164
mod ID: M6ASITE075050		Click to Show/Hide the Full List
mod site	chr1:11114838-11114839:-		[12]
Sequence	AGAAGATTCCATTTAGACTAACAAGAATGTTGACCAATGCT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000455339.1; ENST00000361445.8; ENST00000490931.1
External Link	RMBase: m6A_site_7165
mod ID: M6ASITE075075		Click to Show/Hide the Full List
mod site	chr1:11115414-11115415:-		[11]
Sequence	TGGGAAGATCCTGCACATTGACTTTGGGGACTGCTTTGAGG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361445.8; ENST00000490931.1; ENST00000455339.1; ENST00000376838.5
External Link	RMBase: m6A_site_7166
mod ID: M6ASITE075076		Click to Show/Hide the Full List
mod site	chr1:11115420-11115421:-		[12]
Sequence	TCTGAGTGGGAAGATCCTGCACATTGACTTTGGGGACTGCT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000455339.1; ENST00000361445.8; ENST00000376838.5; ENST00000490931.1
External Link	RMBase: m6A_site_7167
mod ID: M6ASITE075077		Click to Show/Hide the Full List
mod site	chr1:11115467-11115468:-		[12]
Sequence	CTGTCTTCTGTTTCTCAAAGACACCCATCCAACCTGATGCT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000455339.1; ENST00000490931.1; ENST00000376838.5
External Link	RMBase: m6A_site_7168
mod ID: M6ASITE075092		Click to Show/Hide the Full List
mod site	chr1:11121357-11121358:-		[10]
Sequence	CCTGATGCAGATGGCTCCGGACTATGACCACTTGACTCTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7169
mod ID: M6ASITE075140		Click to Show/Hide the Full List
mod site	chr1:11122003-11122004:-		[12]
Sequence	GAAGAAGAAGATCCTTCTCAACATCGAGCATCGCATCATGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7170
mod ID: M6ASITE075141		Click to Show/Hide the Full List
mod site	chr1:11122033-11122034:-		[10]
Sequence	ACTGCACGCCCTCATCCGGGACTACAGGGAGAAGAAGAAGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7171
mod ID: M6ASITE075142		Click to Show/Hide the Full List
mod site	chr1:11122057-11122058:-		[12]
Sequence	TGGCTGGGTTCCCCACTGTGACACACTGCACGCCCTCATCC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7172
mod ID: M6ASITE075143		Click to Show/Hide the Full List
mod site	chr1:11124503-11124504:-		[10]
Sequence	CCCAACATCTCTTCGGAAAAACCTCAGGTATTCAGAAACCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7173
mod ID: M6ASITE075144		Click to Show/Hide the Full List
mod site	chr1:11124519-11124520:-		[12]
Sequence	CCCTTCTGGCCAATGACCCAACATCTCTTCGGAAAAACCTC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7174
mod ID: M6ASITE075145		Click to Show/Hide the Full List
mod site	chr1:11124542-11124543:-		[12]
Sequence	GCAGCTCTTCGGCCTGGTTAACACCCTTCTGGCCAATGACC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7175
mod ID: M6ASITE075146		Click to Show/Hide the Full List
mod site	chr1:11124622-11124623:-		[10]
Sequence	TTCCTTACAGGCAGCAACGGACATGAGTTTGTTTTCCTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7176
mod ID: M6ASITE075147		Click to Show/Hide the Full List
mod site	chr1:11126657-11126658:-		[12]
Sequence	CACCGTCTTTGCAAGTCATCACATCCAAGCAGAGGCCCCGG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7177
mod ID: M6ASITE075148		Click to Show/Hide the Full List
mod site	chr1:11126720-11126721:-		[10]
Sequence	TTGAATTGGCTGTGCCAGGAACATATGACCCCAACCAGCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7178
mod ID: M6ASITE075149		Click to Show/Hide the Full List
mod site	chr1:11126743-11126744:-		[10]
Sequence	AAAACTTCTGATGTGCCGGGACCTTGAATTGGCTGTGCCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7179
mod ID: M6ASITE075175		Click to Show/Hide the Full List
mod site	chr1:11126760-11126761:-		[10]
Sequence	CTGCAATATGTTTCCCCAAAACTTCTGATGTGCCGGGACCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7180
mod ID: M6ASITE075209		Click to Show/Hide the Full List
mod site	chr1:11126792-11126793:-		[12]
Sequence	TTGGTAATTATTTACAGCTCACATCCTTAGAGCTGCAATAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7181
mod ID: M6ASITE075210		Click to Show/Hide the Full List
mod site	chr1:11127055-11127056:-		[10]
Sequence	GGACCTCACCCAAGCCTGGGACCTCTATTATCATGTGTTCC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7182
mod ID: M6ASITE075211		Click to Show/Hide the Full List
mod site	chr1:11127073-11127074:-		[10]
Sequence	GAAATCAGGGAATGTCAAGGACCTCACCCAAGCCTGGGACC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7183
mod ID: M6ASITE075263		Click to Show/Hide the Full List
mod site	chr1:11127097-11127098:-		[12]
Sequence	CCAAGAGTGGTGCAGGAAGTACATGAAATCAGGGAATGTCA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7184
mod ID: M6ASITE075264		Click to Show/Hide the Full List
mod site	chr1:11127637-11127638:-		[10]
Sequence	GCCCCCAGACTCTGAAGGAAACATCCTTTAATCAGGTATGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7185
mod ID: M6ASITE075265		Click to Show/Hide the Full List
mod site	chr1:11127649-11127650:-		[10]
Sequence	TGATGGAACGGGGCCCCCAGACTCTGAAGGAAACATCCTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7186
mod ID: M6ASITE075266		Click to Show/Hide the Full List
mod site	chr1:11128028-11128029:-		[12]
Sequence	GAACATGTGTGAGCACAGCAACACCCTGGTCCAGCAGGCCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7187
mod ID: M6ASITE075267		Click to Show/Hide the Full List
mod site	chr1:11128046-11128047:-		[10]
Sequence	AGCCAACAAGATTCTGAAGAACATGTGTGAGCACAGCAACA
Motif Score	2.951386905
Cell/Tissue List	HeLa; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7188
mod ID: M6ASITE075306		Click to Show/Hide the Full List
mod site	chr1:11128475-11128476:-		[10]
Sequence	CATTCACCAGCTTCTCACAGACATTGGTCGGTACCACCCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7189
mod ID: M6ASITE075384		Click to Show/Hide the Full List
mod site	chr1:11128513-11128514:-		[10]
Sequence	GCAAGAATTGATACGCCCAGACCCTTGGTGGGACGTCTCAT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7190
mod ID: M6ASITE075385		Click to Show/Hide the Full List
mod site	chr1:11129744-11129745:-		[12]
Sequence	GAGGCAACAACCTCCAGGATACACTCAGGTATCAGAGAAGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7191
mod ID: M6ASITE075386		Click to Show/Hide the Full List
mod site	chr1:11129758-11129759:-		[12]
Sequence	CATCTCCTTGTCACGAGGCAACAACCTCCAGGATACACTCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7192
mod ID: M6ASITE075387		Click to Show/Hide the Full List
mod site	chr1:11129812-11129813:-		[12]
Sequence	GTCCAAAACCCTCCTGATGTACACGGTGCCTGCCGTCCAGG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7193
mod ID: M6ASITE075388		Click to Show/Hide the Full List
mod site	chr1:11129825-11129826:-		[10]
Sequence	TCCAACAGGATCTGTCCAAAACCCTCCTGATGTACACGGTG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; CD4T; HEK293T; HEC-1-A; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7194
mod ID: M6ASITE075389		Click to Show/Hide the Full List
mod site	chr1:11130568-11130569:-		[10]
Sequence	CGAGGCCGAGAGCACCGAGAACAGCCCCACCCCATCGCCGC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; MT4; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7195
mod ID: M6ASITE075390		Click to Show/Hide the Full List
mod site	chr1:11130670-11130671:-		[12]
Sequence	GCGTCATGCCAGCGGGGCCAACATCACCAACGCCACCACTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7196
mod ID: M6ASITE075391		Click to Show/Hide the Full List
mod site	chr1:11130693-11130694:-		[10]
Sequence	GCCCGCGATGAGAAGAAGAAACTGCGTCATGCCAGCGGGGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; Huh7; Jurkat; HEK293T; endometrial; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7197
mod ID: M6ASITE075392		Click to Show/Hide the Full List
mod site	chr1:11130718-11130719:-		[10]
Sequence	GCTACACTACAAACATCAGAACCAAGCCCGCGATGAGAAGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7198
mod ID: M6ASITE075393		Click to Show/Hide the Full List
mod site	chr1:11130726-11130727:-		[10]
Sequence	GAAGCTGTGCTACACTACAAACATCAGAACCAAGCCCGCGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7199
mod ID: M6ASITE075394		Click to Show/Hide the Full List
mod site	chr1:11130735-11130736:-		[12]
Sequence	ATGAACTTCGAAGCTGTGCTACACTACAAACATCAGAACCA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7200
mod ID: M6ASITE075395		Click to Show/Hide the Full List
mod site	chr1:11130751-11130752:-		[10]
Sequence	GCATGCGTGGGCAGTGATGAACTTCGAAGCTGTGCTACACT
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7201
mod ID: M6ASITE075396		Click to Show/Hide the Full List
mod site	chr1:11130877-11130878:-		[10]
Sequence	TTGCTTTATGGACACACAGAACAGGCAGGAGCAGCTGTTCC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376838.5; ENST00000361445.8
External Link	RMBase: m6A_site_7202
mod ID: M6ASITE075424		Click to Show/Hide the Full List
mod site	chr1:11130886-11130887:-		[10]
Sequence	TTGAAGTGTTTGCTTTATGGACACACAGAACAGGCAGGAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7203
mod ID: M6ASITE075455		Click to Show/Hide the Full List
mod site	chr1:11131492-11131493:-		[10]
Sequence	CTATCTGGTGACCTGTCAAAACTTTGCTCCCTTGAAATATT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: m6A_site_7204
mod ID: M6ASITE075519		Click to Show/Hide the Full List
mod site	chr1:11133083-11133084:-		[12]
Sequence	AGAGCACGACCGCAGCTGGTACAAGGTGATCAGAAGCAGGC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7205
mod ID: M6ASITE075523		Click to Show/Hide the Full List
mod site	chr1:11133184-11133185:-		[10]
Sequence	GCTTCCAGATGCTTCCTGAAACTTGGAGAGTGGCAGCTGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000495435.1; ENST00000361445.8
External Link	RMBase: m6A_site_7206
mod ID: M6ASITE075529		Click to Show/Hide the Full List
mod site	chr1:11134365-11134366:-		[12]
Sequence	GCAGCATAAGCAGGAACTGCACAAGCTCATGGCCCGGTGAG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7207
mod ID: M6ASITE075530		Click to Show/Hide the Full List
mod site	chr1:11134370-11134371:-		[10]
Sequence	GACCAGCAGCATAAGCAGGAACTGCACAAGCTCATGGCCCG
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7208
mod ID: M6ASITE075531		Click to Show/Hide the Full List
mod site	chr1:11134389-11134390:-		[10]
Sequence	GCATGCCATCGCTACTGAGGACCAGCAGCATAAGCAGGAAC
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7209
mod ID: M6ASITE075532		Click to Show/Hide the Full List
mod site	chr1:11134429-11134430:-		[10]
Sequence	ACATGCAGCATTTTGTCCAGACCATGCAGCAACAGGCCCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000495435.1; ENST00000361445.8
External Link	RMBase: m6A_site_7210
mod ID: M6ASITE075533		Click to Show/Hide the Full List
mod site	chr1:11138957-11138958:-		[10]
Sequence	TTGTAAATACACAGACTAGAACTTTCACAAGACCAATTTGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8; ENST00000476768.1; ENST00000495435.1
External Link	RMBase: m6A_site_7211
mod ID: M6ASITE075534		Click to Show/Hide the Full List
mod site	chr1:11138963-11138964:-		[10]
Sequence	GCAGATTTGTAAATACACAGACTAGAACTTTCACAAGACCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000495435.1; ENST00000361445.8; ENST00000476768.1
External Link	RMBase: m6A_site_7212
mod ID: M6ASITE075535		Click to Show/Hide the Full List
mod site	chr1:11139003-11139004:-		[10]
Sequence	CTACCCCTAAGAGAAGATGGACTGTTTGGTACAAAAAAGAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476768.1; ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7213
mod ID: M6ASITE075536		Click to Show/Hide the Full List
mod site	chr1:11139043-11139044:-		[10]
Sequence	TGTATCTAGAAAGTGCTGGGACATAGAAAGGGCACACTTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1; ENST00000476768.1
External Link	RMBase: m6A_site_7214
mod ID: M6ASITE075537		Click to Show/Hide the Full List
mod site	chr1:11139094-11139095:-		[10]
Sequence	GTGTGTATACCATTGATCAAACCAATGAATGTGATCACAGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000476768.1; ENST00000495435.1
External Link	RMBase: m6A_site_7215
mod ID: M6ASITE075538		Click to Show/Hide the Full List
mod site	chr1:11139362-11139363:-		[13]
Sequence	AACTTGACCATCCTCTGCCAACAGTTCACCCTCAGGTGACC
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000476768.1; ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7216
mod ID: M6ASITE075539		Click to Show/Hide the Full List
mod site	chr1:11139419-11139420:-		[10]
Sequence	TTAAGGCTCTTGCTCATAAAACTTTAGTGTTGCTCCTGGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476768.1; ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7217
mod ID: M6ASITE075540		Click to Show/Hide the Full List
mod site	chr1:11139576-11139577:-		[10]
Sequence	GCCCTCATGAAGACATGAGAACCTGGCTCAAGTATGCAAGC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476768.1; ENST00000495435.1; ENST00000361445.8
External Link	RMBase: m6A_site_7218
mod ID: M6ASITE075541		Click to Show/Hide the Full List
mod site	chr1:11139584-11139585:-		[10]
Sequence	TGTGGTCAGCCCTCATGAAGACATGAGAACCTGGCTCAAGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000476768.1; ENST00000495435.1; ENST00000361445.8
External Link	RMBase: m6A_site_7219
mod ID: M6ASITE075546		Click to Show/Hide the Full List
mod site	chr1:11139635-11139636:-		[10]
Sequence	CTGCCAGCGTATCGTAGAGGACTGGCAGAAAATCCTTATGG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1; ENST00000476768.1
External Link	RMBase: m6A_site_7220
mod ID: M6ASITE075581		Click to Show/Hide the Full List
mod site	chr1:11144653-11144654:-		[10]
Sequence	CGCCAGATCTGGTGGGAGAGACTGCAGGTGAGCTTGGTAGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7221
mod ID: M6ASITE075582		Click to Show/Hide the Full List
mod site	chr1:11144701-11144702:-		[10]
Sequence	GAGGAGGTTATCCAGTACAAACTTGTCCCCGAGCGACGAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7223
mod ID: M6ASITE075583		Click to Show/Hide the Full List
mod site	chr1:11144705-11144706:-		[12]
Sequence	GCTGGAGGAGGTTATCCAGTACAAACTTGTCCCCGAGCGAC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8; ENST00000495435.1
External Link	RMBase: m6A_site_7224
mod ID: M6ASITE075584		Click to Show/Hide the Full List
mod site	chr1:11145025-11145026:-		[10]
Sequence	GTGCATTGACAAGGCCAGGGACCTGCTGGATGCTGAATTAA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7231
mod ID: M6ASITE075585		Click to Show/Hide the Full List
mod site	chr1:11145037-11145038:-		[12]
Sequence	GTTTCTCTTCTAGTGCATTGACAAGGCCAGGGACCTGCTGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7232
mod ID: M6ASITE075586		Click to Show/Hide the Full List
mod site	chr1:11146681-11146682:-		[12]
Sequence	CAGGACCTCTTCTCCTTGGCACAACAGGTAAAAACCTACAT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7233
mod ID: M6ASITE075591		Click to Show/Hide the Full List
mod site	chr1:11146697-11146698:-		[10]
Sequence	TGTGCTGGCACTGCATCAGGACCTCTTCTCCTTGGCACAAC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7234
mod ID: M6ASITE075692		Click to Show/Hide the Full List
mod site	chr1:11146745-11146746:-		[10]
Sequence	CACCTGTATGATCCCTCGGGACACCCATGATGGGGCATTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7235
mod ID: M6ASITE075792		Click to Show/Hide the Full List
mod site	chr1:11146781-11146782:-		[10]
Sequence	TGTGTGTATAGGTCAGTGGGACAGCATGGAAGAATACACCT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7236
mod ID: M6ASITE075799		Click to Show/Hide the Full List
mod site	chr1:11150173-11150174:-		[10]
Sequence	GGACCCTGGTTAATGATGAGACCCAAGCCAAGATGGCCCGG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7237
mod ID: M6ASITE075807		Click to Show/Hide the Full List
mod site	chr1:11150191-11150192:-		[10]
Sequence	AGCAGTGCTGTGAAAAGTGGACCCTGGTTAATGATGAGACC
Motif Score	3.622404762
Cell/Tissue List	HeLa; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7238
mod ID: M6ASITE075818		Click to Show/Hide the Full List
mod site	chr1:11157211-11157212:-		[12]
Sequence	TGACAAGAAAATGGACACCAACAAGGACGACCCAGAGCTGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7239
mod ID: M6ASITE075829		Click to Show/Hide the Full List
mod site	chr1:11157217-11157218:-		[10]
Sequence	GGCCTATGACAAGAAAATGGACACCAACAAGGACGACCCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7240
mod ID: M6ASITE075840		Click to Show/Hide the Full List
mod site	chr1:11157229-11157230:-		[12]
Sequence	GGATGCCCTTGTGGCCTATGACAAGAAAATGGACACCAACA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7241
mod ID: M6ASITE075851		Click to Show/Hide the Full List
mod site	chr1:11157264-11157265:-		[10]
Sequence	CAGGCTACCTGGTATGAGAAACTGCACGAGTGGGAGGATGC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7242
mod ID: M6ASITE075862		Click to Show/Hide the Full List
mod site	chr1:11167456-11167457:-		[10]
Sequence	GTGTTAGAATATGCCATGAAACACTTTGGAGAGCTGGTAAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7243
mod ID: M6ASITE075873		Click to Show/Hide the Full List
mod site	chr1:11199307-11199308:-		[10]
Sequence	AAAGCACTACACTACAAAGAACTGGAGTTCCAGAAAGGCCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7244
mod ID: M6ASITE075876		Click to Show/Hide the Full List
mod site	chr1:11199314-11199315:-		[12]
Sequence	ATATGCCAAAGCACTACACTACAAAGAACTGGAGTTCCAGA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7245
mod ID: M6ASITE075877		Click to Show/Hide the Full List
mod site	chr1:11199319-11199320:-		[12]
Sequence	CGAGCATATGCCAAAGCACTACACTACAAAGAACTGGAGTT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7246
mod ID: M6ASITE075878		Click to Show/Hide the Full List
mod site	chr1:11199380-11199381:-		[12]
Sequence	CCCCCTGCCACTGAGAGATGACAATGGCATTGTTCTGCTGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7247
mod ID: M6ASITE075879		Click to Show/Hide the Full List
mod site	chr1:11199552-11199553:-		[10]
Sequence	AACTTGGCTGAATTCATGGAACACAGTGACAAGGTGAGACT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7248
mod ID: M6ASITE075880		Click to Show/Hide the Full List
mod site	chr1:11199571-11199572:-		[10]
Sequence	AGTCACACAGACCCTCTTAAACTTGGCTGAATTCATGGAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7249
mod ID: M6ASITE075881		Click to Show/Hide the Full List
mod site	chr1:11199581-11199582:-		[10]
Sequence	ACATCGCTGAAGTCACACAGACCCTCTTAAACTTGGCTGAA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7250
mod ID: M6ASITE075937		Click to Show/Hide the Full List
mod site	chr1:11199601-11199602:-		[10]
Sequence	GTTGGCCCTCACCTCACAAGACATCGCTGAAGTCACACAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7251
mod ID: M6ASITE075943		Click to Show/Hide the Full List
mod site	chr1:11199606-11199607:-		[12]
Sequence	ATCGAGTTGGCCCTCACCTCACAAGACATCGCTGAAGTCAC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7252
mod ID: M6ASITE075944		Click to Show/Hide the Full List
mod site	chr1:11199663-11199664:-		[10]
Sequence	TTTGTGTCCTGCTGGTCTGAACTGAATGAAGATCAACAGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7253
mod ID: M6ASITE075945		Click to Show/Hide the Full List
mod site	chr1:11204575-11204576:-		[12]
Sequence	CTGGGCCCTGGCACAGGCCTACAACCCGATGGCCAGGTATA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7254
mod ID: M6ASITE075959		Click to Show/Hide the Full List
mod site	chr1:11204623-11204624:-		[10]
Sequence	GAGCCTGGAGCTGCTGAAGGACTCATCATCGCCCTCCCTGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7255
mod ID: M6ASITE076060		Click to Show/Hide the Full List
mod site	chr1:11209341-11209342:-		[10]
Sequence	GAAACAGGACCCATGAAGAAACTGCACGTCAGCACCATCAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7256
mod ID: M6ASITE076118		Click to Show/Hide the Full List
mod site	chr1:11209353-11209354:-		[10]
Sequence	AGTGGACCAGTGGAAACAGGACCCATGAAGAAACTGCACGT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7257
mod ID: M6ASITE076119		Click to Show/Hide the Full List
mod site	chr1:11209358-11209359:-		[10]
Sequence	TGGCTAGTGGACCAGTGGAAACAGGACCCATGAAGAAACTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7258
mod ID: M6ASITE076120		Click to Show/Hide the Full List
mod site	chr1:11209368-11209369:-		[10]
Sequence	GGGGATGCATTGGCTAGTGGACCAGTGGAAACAGGACCCAT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7259
mod ID: M6ASITE076121		Click to Show/Hide the Full List
mod site	chr1:11209453-11209454:-		[12]
Sequence	AAATCTTTGGTTGTAGGGATACACACTTGCTGATGAAGAGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7260
mod ID: M6ASITE076122		Click to Show/Hide the Full List
mod site	chr1:11210864-11210865:-		[12]
Sequence	GTGAATAAAGTTCTGGTGCGACACCGAATCAATCATCAGCG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7261
mod ID: M6ASITE076123		Click to Show/Hide the Full List
mod site	chr1:11212348-11212349:-		[10]
Sequence	ACTGCGCTCCACAGCCATGGACACGCTGTCTTCACTTGTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7262
mod ID: M6ASITE076124		Click to Show/Hide the Full List
mod site	chr1:11212368-11212369:-		[10]
Sequence	ACACTGGACCAGAGCCCAGAACTGCGCTCCACAGCCATGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7263
mod ID: M6ASITE076125		Click to Show/Hide the Full List
mod site	chr1:11212381-11212382:-		[10]
Sequence	CCCTATTGTTCGAACACTGGACCAGAGCCCAGAACTGCGCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7264
mod ID: M6ASITE076126		Click to Show/Hide the Full List
mod site	chr1:11212388-11212389:-		[10]
Sequence	TCATTCACCCTATTGTTCGAACACTGGACCAGAGCCCAGAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7265
mod ID: M6ASITE076127		Click to Show/Hide the Full List
mod site	chr1:11212453-11212454:-		[10]
Sequence	GGCAGCGCTAGAGACTGTGGACCGCCTGACGGAGTCCCTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7266
mod ID: M6ASITE076128		Click to Show/Hide the Full List
mod site	chr1:11212460-11212461:-		[10]
Sequence	GTTGTAGGGCAGCGCTAGAGACTGTGGACCGCCTGACGGAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7267
mod ID: M6ASITE076129		Click to Show/Hide the Full List
mod site	chr1:11213455-11213456:-		[12]
Sequence	TACCTGCCCCAGCTGATCCCACACATGCTGCGTGTCTTCAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7268
mod ID: M6ASITE076130		Click to Show/Hide the Full List
mod site	chr1:11213549-11213550:-		[10]
Sequence	GTAGGAATTCTGGGTCATGAACACCTCAATTCAGAGCACGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7269
mod ID: M6ASITE076131		Click to Show/Hide the Full List
mod site	chr1:11216180-11216181:-		[10]
Sequence	TTTGTGAAGAGCCACATCAGACCTTATATGGATGAAATAGT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7270
mod ID: M6ASITE076132		Click to Show/Hide the Full List
mod site	chr1:11216187-11216188:-		[12]
Sequence	GGTGTCCTTTGTGAAGAGCCACATCAGACCTTATATGGATG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7271
mod ID: M6ASITE076133		Click to Show/Hide the Full List
mod site	chr1:11228748-11228749:-		[10]
Sequence	TTCATCTTCAAGTCCCTGGGACTCAAATGTGTGCAGTTCCT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7272
mod ID: M6ASITE076134		Click to Show/Hide the Full List
mod site	chr1:11228794-11228795:-		[12]
Sequence	CCAGTCACTCTCTCATCATCACACCATGGTTGTCCAGGCCA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7273
mod ID: M6ASITE076135		Click to Show/Hide the Full List
mod site	chr1:11228815-11228816:-		[10]
Sequence	CCTGATGCGGATCTTCCGAGACCAGTCACTCTCTCATCATC
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7274
mod ID: M6ASITE076136		Click to Show/Hide the Full List
mod site	chr1:11228878-11228879:-		[10]
Sequence	AATGCTGGTCAACATGGGAAACTTGCCTCTGGATGAGTTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7275
mod ID: M6ASITE076137		Click to Show/Hide the Full List
mod site	chr1:11228887-11228888:-		[12]
Sequence	CACTAGTGAAATGCTGGTCAACATGGGAAACTTGCCTCTGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7276
mod ID: M6ASITE076147		Click to Show/Hide the Full List
mod site	chr1:11230983-11230984:-		[10]
Sequence	AGTGAACATTGGCATGATAGACCAGTCCCGGGATGCCTCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7277
mod ID: M6ASITE076158		Click to Show/Hide the Full List
mod site	chr1:11230998-11230999:-		[10]
Sequence	TCCTTACAAGCACAAAGTGAACATTGGCATGATAGACCAGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7278
mod ID: M6ASITE076169		Click to Show/Hide the Full List
mod site	chr1:11231013-11231014:-		[12]
Sequence	TTTAGGGGCTTTGGATCCTTACAAGCACAAAGTGAACATTG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7279
mod ID: M6ASITE076180		Click to Show/Hide the Full List
mod site	chr1:11231310-11231311:-		[12]
Sequence	AGACTGAGCAGAACCAGGGTACACGCAGAGAGGTAGGGGAC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7280
mod ID: M6ASITE076191		Click to Show/Hide the Full List
mod site	chr1:11231318-11231319:-		[10]
Sequence	TTTTCTGAAGACTGAGCAGAACCAGGGTACACGCAGAGAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7281
mod ID: M6ASITE076202		Click to Show/Hide the Full List
mod site	chr1:11231328-11231329:-		[10]
Sequence	TGCTACTGAATTTTCTGAAGACTGAGCAGAACCAGGGTACA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7282
mod ID: M6ASITE076213		Click to Show/Hide the Full List
mod site	chr1:11231375-11231376:-		[13]
Sequence	TGGCTATGTAGTAGAGCCCTACAGGAAGTACCCTACTTTGC
Motif Score	2.078666667
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7283
mod ID: M6ASITE076224		Click to Show/Hide the Full List
mod site	chr1:11231413-11231414:-		[10]
Sequence	GTGGCTCTGTGGACCCTGGGACAGTTGGTGGCCAGCACTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7284
mod ID: M6ASITE076235		Click to Show/Hide the Full List
mod site	chr1:11231421-11231422:-		[10]
Sequence	CTATCCAGGTGGCTCTGTGGACCCTGGGACAGTTGGTGGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7285
mod ID: M6ASITE076258		Click to Show/Hide the Full List
mod site	chr1:11232472-11232473:-		[10]
Sequence	ACTTTTTATTATCATCATGGACATGCTCCAGGATTCCTCTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7286
mod ID: M6ASITE076323		Click to Show/Hide the Full List
mod site	chr1:11232492-11232493:-		[10]
Sequence	ATGAGGAAATGGGTTGATGAACTTTTTATTATCATCATGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7287
mod ID: M6ASITE076345		Click to Show/Hide the Full List
mod site	chr1:11233417-11233418:-		[12]
Sequence	TGATCAATAATGTCCTGGCAACAATAGGAGAATTGGCACAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7288
mod ID: M6ASITE076381		Click to Show/Hide the Full List
mod site	chr1:11233446-11233447:-		[10]
Sequence	AGATCCAGACCCTGATCCAAACCCAGGTGTGATCAATAATG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7289
mod ID: M6ASITE076423		Click to Show/Hide the Full List
mod site	chr1:11233458-11233459:-		[10]
Sequence	TTTGAAACTGAAAGATCCAGACCCTGATCCAAACCCAGGTG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7290
mod ID: M6ASITE076438		Click to Show/Hide the Full List
mod site	chr1:11233472-11233473:-		[10]
Sequence	CTCTAGGCATTAATTTTGAAACTGAAAGATCCAGACCCTGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7291
mod ID: M6ASITE076468		Click to Show/Hide the Full List
mod site	chr1:11234161-11234162:-		[12]
Sequence	CCCCCGACTCATCCGCCCCTACATGGAGCCTATTCTGAAGG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7292
mod ID: M6ASITE076477		Click to Show/Hide the Full List
mod site	chr1:11237885-11237886:-		[10]
Sequence	GGGCCGACTCAGTAGCATGAACCCTGCCTTTGTCATGCCTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7293
mod ID: M6ASITE076478		Click to Show/Hide the Full List
mod site	chr1:11237975-11237976:-		[10]
Sequence	ACACCTGGCCCAGGCGGAGAACTTGCAGGCCTTGTTTGTGG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7294
mod ID: M6ASITE076479		Click to Show/Hide the Full List
mod site	chr1:11237995-11237996:-		[12]
Sequence	CTGGACGAGCGCTTTGATGCACACCTGGCCCAGGCGGAGAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7295
mod ID: M6ASITE076506		Click to Show/Hide the Full List
mod site	chr1:11238041-11238042:-		[12]
Sequence	CATTGCTCTTGCAGACCCTGACATTCGCTACTGTGTCTTGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7296
mod ID: M6ASITE076591		Click to Show/Hide the Full List
mod site	chr1:11238429-11238430:-		[10]
Sequence	GTGGCAGATGTGCTTAGCAAACTGCTCGTAGTTGGGATAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7297
mod ID: M6ASITE076633		Click to Show/Hide the Full List
mod site	chr1:11238464-11238465:-		[10]
Sequence	ATGCTCATGTGGTTAGCCAGACCGCAGTGCAAGTGGTGGCA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7298
mod ID: M6ASITE076634		Click to Show/Hide the Full List
mod site	chr1:11238512-11238513:-		[12]
Sequence	GCACCTGCTCCCGCCTGCTCACACCCTCCATCCACCTCATC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7299
mod ID: M6ASITE076635		Click to Show/Hide the Full List
mod site	chr1:11238559-11238560:-		[13]
Sequence	TCATTTCCTGAACAGTGAGCACAAGGAGATCCGCATGGAGG
Motif Score	2.830589286
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7300
mod ID: M6ASITE076636		Click to Show/Hide the Full List
mod site	chr1:11238568-11238569:-		[10]
Sequence	CTGTGCGGATCATTTCCTGAACAGTGAGCACAAGGAGATCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; brain
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7301
mod ID: M6ASITE076637		Click to Show/Hide the Full List
mod site	chr1:11240438-11240439:-		[10]
Sequence	TCCCTGGTCCTTATGCACAAACCCCTTCGCCACCCAGGCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7302
mod ID: M6ASITE076638		Click to Show/Hide the Full List
mod site	chr1:11240442-11240443:-		[12]
Sequence	GCTGTCCCTGGTCCTTATGCACAAACCCCTTCGCCACCCAG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7303
mod ID: M6ASITE076707		Click to Show/Hide the Full List
mod site	chr1:11240487-11240488:-		[10]
Sequence	GATTCCACAGCTAAAGAAGGACATTCAAGATGGGCTACTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; endometrial
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7304
mod ID: M6ASITE076708		Click to Show/Hide the Full List
mod site	chr1:11241557-11241558:-		[10]
Sequence	GAGCCCATGCTGGCAGTGGGACTAAGGTGGGTGTCAGAAAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7305
mod ID: M6ASITE076709		Click to Show/Hide the Full List
mod site	chr1:11243125-11243126:-		[10]
Sequence	AGCGGCCCTGCCCCCAAAGGACTTCGCCCATAAGTAAGCAC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7306
mod ID: M6ASITE076710		Click to Show/Hide the Full List
mod site	chr1:11243155-11243156:-		[10]
Sequence	CTATTTGCCTCGCGTGCTGGACATCATCCGAGCGGCCCTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7307
mod ID: M6ASITE076711		Click to Show/Hide the Full List
mod site	chr1:11243272-11243273:-		[10]
Sequence	GTATCTCCAAGATACCATGAACCATGTCCTAAGCTGTGTCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7308
mod ID: M6ASITE076720		Click to Show/Hide the Full List
mod site	chr1:11247678-11247679:-		[11]
Sequence	AGAACTCGCTGATCCAAATGACAATCCTTAATTTGTTGCCC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7309
mod ID: M6ASITE076784		Click to Show/Hide the Full List
mod site	chr1:11247695-11247696:-		[10]
Sequence	GAAATGCAGGAATAGCAAGAACTCGCTGATCCAAATGACAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7310
mod ID: M6ASITE076817		Click to Show/Hide the Full List
mod site	chr1:11247843-11247844:-		[10]
Sequence	GGAGAGCCGGTGTTGCAGAGACTTGATGGAGGAGAAATTTG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7311
mod ID: M6ASITE076818		Click to Show/Hide the Full List
mod site	chr1:11247895-11247896:-		[10]
Sequence	AAGGCCTCATGGGATTTGGGACCTCCCCCAGTCCAGCTAAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7312
mod ID: M6ASITE076860		Click to Show/Hide the Full List
mod site	chr1:11248007-11248008:-		[10]
Sequence	CTCATGGGCTTCGGAACAAAACCTCGTCACATTACCCCCTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7313
mod ID: M6ASITE076884		Click to Show/Hide the Full List
mod site	chr1:11248012-11248013:-		[10]
Sequence	AAGATCTCATGGGCTTCGGAACAAAACCTCGTCACATTACC
Motif Score	2.951386905
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7314
mod ID: M6ASITE076885		Click to Show/Hide the Full List
mod site	chr1:11248066-11248067:-		[12]
Sequence	GAGAAGAAATGGAAGAAATCACACAGCAGCAGCTGGTACAC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7315
mod ID: M6ASITE076886		Click to Show/Hide the Full List
mod site	chr1:11253936-11253937:-		[10]
Sequence	CAGAGAAGGGATTTGATGAGACCTTGGCCAAAGAGAAGGGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7316
mod ID: M6ASITE076887		Click to Show/Hide the Full List
mod site	chr1:11253971-11253972:-		[12]
Sequence	ACCCTGTCTCTCTACATAGCACACATTTGAAGAAGCAGAGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7317
mod ID: M6ASITE076888		Click to Show/Hide the Full List
mod site	chr1:11256038-11256039:-		[12]
Sequence	TTCGTGCCTGTCTGATTCTCACAACCCAGCGTGAGCCGAAG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7318
mod ID: M6ASITE076889		Click to Show/Hide the Full List
mod site	chr1:11256090-11256091:-		[10]
Sequence	GTGGCCGTGTGGGACCCCAAACAGGCCATCCGTGAGGGAGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7319
mod ID: M6ASITE076890		Click to Show/Hide the Full List
mod site	chr1:11256097-11256098:-		[10]
Sequence	CATTTTTGTGGCCGTGTGGGACCCCAAACAGGCCATCCGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7320
mod ID: M6ASITE076891		Click to Show/Hide the Full List
mod site	chr1:11256121-11256122:-		[12]
Sequence	GCAAGTGCAACCCTTCTTTGACAACATTTTTGTGGCCGTGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7321
mod ID: M6ASITE076892		Click to Show/Hide the Full List
mod site	chr1:11256941-11256942:-		[10]
Sequence	GACCGCAATGAGGGCCGGAGACATGCAGCTGTGAGTGTCTA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7322
mod ID: M6ASITE076893		Click to Show/Hide the Full List
mod site	chr1:11257023-11257024:-		[10]
Sequence	CCGTCTTGCCATGGCAGGGGACACTTTTACCGCTGAGTACG
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7323
mod ID: M6ASITE076894		Click to Show/Hide the Full List
mod site	chr1:11257098-11257099:-		[10]
Sequence	ATTTGCCAACTATCTTCGGAACCTCCTCCCCTCCAATGACC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7324
mod ID: M6ASITE076895		Click to Show/Hide the Full List
mod site	chr1:11258546-11258547:-		[12]
Sequence	CTATGACCAACTGAACCATCACATTTTTGAATTGGTTTCCA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7325
mod ID: M6ASITE076961		Click to Show/Hide the Full List
mod site	chr1:11258552-11258553:-		[10]
Sequence	TCGCTTCTATGACCAACTGAACCATCACATTTTTGAATTGG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7326
mod ID: M6ASITE076962		Click to Show/Hide the Full List
mod site	chr1:11259256-11259257:-		[10]
Sequence	CAGCACTATGTCACCATGGAACTCCGAGAGGTGCTTCTGGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7327
mod ID: M6ASITE076965		Click to Show/Hide the Full List
mod site	chr1:11259303-11259304:-		[10]
Sequence	TAAAGAGCCGGAATGAGGAAACCAGGGCCAAAGCCGCCAAG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; Jurkat; CD4T; GSC-11; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7328
mod ID: M6ASITE076976		Click to Show/Hide the Full List
mod site	chr1:11259366-11259367:-		[12]
Sequence	CCGCCACCACCGCTGCCACCACATCTAGCAATGTGAGCGTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7329
mod ID: M6ASITE076984		Click to Show/Hide the Full List
mod site	chr1:11259394-11259395:-		[10]
Sequence	GGCAAGATGCTTGGAACCGGACCTGCCGCCGCCACCACCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TREX; iSLK; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7330
mod ID: M6ASITE076995		Click to Show/Hide the Full List
mod site	chr1:11259399-11259400:-		[10]
Sequence	CTCAGGGCAAGATGCTTGGAACCGGACCTGCCGCCGCCACC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TREX; iSLK; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361445.8
External Link	RMBase: m6A_site_7331

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000163		Click to Show/Hide the Full List
mod site	chr1:11127723-11127724:-		[16]
Sequence	AGAGGCATCTCGTTTGTACTTTGGGGAAAGGAACGTGAAAG
Transcript ID List	ENST00000361445.8; ENST00000376838.5
External Link	RMBase: Pseudo_site_32

Ref 1	Methyltransferase-like 3 promotes the progression of lung cancer via activating PI3K/AKT/mTOR pathway. Clin Exp Pharmacol Physiol. 2022 Jul;49(7):748-758. doi: 10.1111/1440-1681.13647. Epub 2022 May 23.
Ref 2	The M6A methyltransferase METTL3: acting as a tumor suppressor in renal cell carcinoma. Oncotarget. 2017 Oct 10;8(56):96103-96116. doi: 10.18632/oncotarget.21726. eCollection 2017 Nov 10.
Ref 3	m(6)A methyltransferase METTL3 promotes retinoblastoma progression via PI3K/AKT/mTOR pathway. J Cell Mol Med. 2020 Oct 8;24(21):12368-78. doi: 10.1111/jcmm.15736. Online ahead of print.
Ref 4	m(6)A mRNA methylation-directed myeloid cell activation controls progression of NAFLD and obesity. Cell Rep. 2021 Nov 9;37(6):109968. doi: 10.1016/j.celrep.2021.109968.
Ref 5	YTHDF1 promotes hepatocellular carcinoma progression via activating PI3K/AKT/mTOR signaling pathway and inducing epithelial-mesenchymal transition. Exp Hematol Oncol. 2021 Jun 4;10(1):35. doi: 10.1186/s40164-021-00227-0.
Ref 6	Targeting ATF4-dependent pro-survival autophagy to synergize glutaminolysis inhibition. Theranostics. 2021 Jul 25;11(17):8464-8479. doi: 10.7150/thno.60028. eCollection 2021.
Ref 7	The m6A methyltransferase METTL14 inhibits the proliferation, migration, and invasion of gastric cancer by regulating the PI3K/AKT/mTOR signaling pathway. J Clin Lab Anal. 2021 Mar;35(3):e23655. doi: 10.1002/jcla.23655. Epub 2020 Dec 12.
Ref 8	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 9	High-throughput identification of C/D box snoRNA targets with CLIP and RiboMeth-seq. Nucleic Acids Res. 2017 Mar 17;45(5):2341-2353. doi: 10.1093/nar/gkw1321.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 12	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 13	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 14	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 15	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 16	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map