m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00249)

Target Name	Histone-lysine N-methyltransferase EZH2 (EZH2)
Synonyms	ENX-1; Enhancer of zeste homolog 2; Lysine N-methyltransferase 6; KMT6 Click to Show/Hide
Gene Name	EZH2
Chromosomal Location	7q36.1
Family	class V-like SAM-binding methyltransferase superfamily; Histone-lysine methyltransferase family; EZ subfamily
Function	Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH2 complex, which methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Displays a preference for substrates with less methylation, loses activity when progressively more methyl groups are incorporated into H3K27, H3K27me0 > H3K27me1 > H3K27me2. Compared to EZH1-containing complexes, it is more abundant in embryonic stem cells and plays a major role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. The PRC2/EED-EZH2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems. Genes repressed by the PRC2/EED-EZH2 complex include HOXC8, HOXA9, MYT1, CDKN2A and retinoic acid target genes. EZH2 can also methylate non-histone proteins such as the transcription factor GATA4 and the nuclear receptor RORA. Regulates the circadian clock via histone methylation at the promoter of the circadian genes. Essential for the CRY1/2-mediated repression of the transcriptional activation of PER1/2 by the CLOCK-ARNTL/BMAL1 heterodimer; involved in the di and trimethylation of 'Lys-27' of histone H3 on PER1/2 promoters which is necessary for the CRY1/2 proteins to inhibit transcription. Click to Show/Hide
Gene ID	2146
Uniprot ID	EZH2_HUMAN
HGNC ID	HGNC:3527
KEGG ID	hsa:2146

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

EZH2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.23E+00 p-value: 1.10E-12
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between EZH2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.01E+00	GSE60213

In total 5 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 was highly expressed in nasopharyngeal carcinoma tissues, which inhibited Histone-lysine N-methyltransferase EZH2 (EZH2) expression by mediating m6A modification of EZH2 mRNA.
Target Regulation	Down regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Cell Process	Cell viability
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Simvastatin induces METTL3 down-regulation in lung cancer tissues, which further influences EMT via m6A modification on Histone-lysine N-methyltransferase EZH2 (EZH2) mRNA and thus inhibits the malignant progression of lung cancer.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 is upregulated in Breast Cancer. It could regulate the protein level of Histone-lysine N-methyltransferase EZH2 (EZH2) through m6A modification to promote EMT and metastasis in BCa cells, thereafter aggravating the progression of BCa.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Adherens junction			hsa04520
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3 promotes inflammation and cell apoptosis in a pediatric pneumonia model by regulating Histone-lysine N-methyltransferase EZH2 (EZH2).
Target Regulation	Up regulation
Responsed Disease	Congenital pneumonia		ICD-11: KB24	Disease Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
Cell Process	Inflammation
In-vitro Model	HPBM (Human Peripheral Blood Monocytes)
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	Uncover the fundamental mechanisms underlying the interplay of m6 A RNA modification and histone modification in Temozolomide resistance and emphasize the therapeutic potential of targeting the SOX4/EZH2/METTL3 axis in the treatment of TMZ-resistant glioblastoma.
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	RNA degradation			hsa03018
Cell Process	mRNA decay
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Used to inject 10 uL of the U87 MG-TMZ_R-luc cell suspension in the striatum at a depth of 3 mm from the dural surface. One week after the injection of the tumor cells, 40 mg/kg/day of TMZ in saline was administered for over 2 weeks by intraperitoneal injection.

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	PANC-1 cell line	Homo sapiens
Treatment: siIGF2BP1 PANC-1 cells Control: siControl PANC-1 cells		GSE161087
Regulation		logFC: -1.26E+00 p-value: 4.20E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	This data identify IGF2BP1 as an important driver of tumor progression in NEN, and indicate that disruption of the IGF2BP1-Myc-Histone-lysine N-methyltransferase EZH2 (EZH2) axis represents a promising approach for targeted therapy of neuroendocrine neoplasms.
Target Regulation	Up regulation
Responsed Disease	Neuroendocrine neoplasms		ICD-11: 2D4Y	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Increase in G1 and sub-G1 phases
In-vitro Model	NCI-H727	Lung carcinoid tumor	Homo sapiens	CVCL_1584
In-vitro Model	COLO 320DM	Colon adenocarcinoma	Homo sapiens	CVCL_0219
In-vivo Model	RIP1-Tag2 mice were purchased from NCI Mouse Repository (Bethesda, Rockville, MD, USA) and maintained in a C57BL/6N background.

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	Uncover the fundamental mechanisms underlying the interplay of m6 A RNA modification and histone modification in Temozolomide resistance and emphasize the therapeutic potential of targeting the SOX4/EZH2/METTL3 axis in the treatment of TMZ-resistant glioblastoma.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	RNA degradation			hsa03018
Cell Process	mRNA decay
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Used to inject 10 uL of the U87 MG-TMZ_R-luc cell suspension in the striatum at a depth of 3 mm from the dural surface. One week after the injection of the tumor cells, 40 mg/kg/day of TMZ in saline was administered for over 2 weeks by intraperitoneal injection.

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 was highly expressed in nasopharyngeal carcinoma tissues, which inhibited Histone-lysine N-methyltransferase EZH2 (EZH2) expression by mediating m6A modification of EZH2 mRNA.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell viability
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Simvastatin induces METTL3 down-regulation in lung cancer tissues, which further influences EMT via m6A modification on Histone-lysine N-methyltransferase EZH2 (EZH2) mRNA and thus inhibits the malignant progression of lung cancer.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 is upregulated in Breast Cancer. It could regulate the protein level of Histone-lysine N-methyltransferase EZH2 (EZH2) through m6A modification to promote EMT and metastasis in BCa cells, thereafter aggravating the progression of BCa.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Adherens junction			hsa04520
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031

Neuroendocrine neoplasms [ICD-11: 2D4Y]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	This data identify IGF2BP1 as an important driver of tumor progression in NEN, and indicate that disruption of the IGF2BP1-Myc-Histone-lysine N-methyltransferase EZH2 (EZH2) axis represents a promising approach for targeted therapy of neuroendocrine neoplasms.
Responsed Disease	Neuroendocrine neoplasms [ICD-11: 2D4Y]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Increase in G1 and sub-G1 phases
In-vitro Model	NCI-H727	Lung carcinoid tumor	Homo sapiens	CVCL_1584
In-vitro Model	COLO 320DM	Colon adenocarcinoma	Homo sapiens	CVCL_0219
In-vivo Model	RIP1-Tag2 mice were purchased from NCI Mouse Repository (Bethesda, Rockville, MD, USA) and maintained in a C57BL/6N background.

Congenital pneumonia [ICD-11: KB24]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[4]
Response Summary	METTL3 promotes inflammation and cell apoptosis in a pediatric pneumonia model by regulating Histone-lysine N-methyltransferase EZH2 (EZH2).
Responsed Disease	Congenital pneumonia [ICD-11: KB24]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	JAK-STAT signaling pathway		hsa04630
Cell Process	Inflammation
In-vitro Model	HPBM (Human Peripheral Blood Monocytes)

Temozolomide [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[7]
Response Summary	Uncover the fundamental mechanisms underlying the interplay of m6 A RNA modification and histone modification in Temozolomide resistance and emphasize the therapeutic potential of targeting the SOX4/EZH2/METTL3 axis in the treatment of TMZ-resistant glioblastoma.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Pathway Response	RNA degradation			hsa03018
Cell Process	mRNA decay
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Used to inject 10 uL of the U87 MG-TMZ_R-luc cell suspension in the striatum at a depth of 3 mm from the dural surface. One week after the injection of the tumor cells, 40 mg/kg/day of TMZ in saline was administered for over 2 weeks by intraperitoneal injection.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02145		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02158		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02171		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02184		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT05854		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Simvastatin	Drug Info
Crosstalk ID: M6ACROT05856		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Simvastatin	Drug Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03013		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	m6A → Histone modification
Crosstalk ID: M6ACROT03038		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	m6A → Histone modification
Disease	Brain cancer	Disease Info
Drug	Temozolomide	Drug Info
Crosstalk ID: M6ACROT03039		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info
Drug	Temozolomide	Drug Info
Crosstalk ID: M6ACROT03381		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Simvastatin*	Drug Info
Crosstalk ID: M6ACROT03394		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Simvastatin*	Drug Info

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03081		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	m6A → Histone modification
Disease	Endometriosis	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03082		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	m6A → Histone modification
Disease	Endometriosis	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03200		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	m6A → Histone modification
Disease	Neuroendocrine neoplasms	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00249)

Histone-lysine N-methyltransferase EZH2 (EZH2)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002392		Click to Show/Hide the Full List
mod site	chr7:148811422-148811423:-		[9]
Sequence	CGCGGTGGCCGACTCCTGCAATCCCAGCACTTTGGGAGGCC
Transcript ID List	ENST00000478654.5; ENST00000460911.5; ENST00000476773.5; ENST00000320356.6; rmsk_2406372; ENST00000492143.5; ENST00000469631.1; ENST00000483967.5; ENST00000350995.6
External Link	RMBase: RNA-editing_site_127936
mod ID: A2ISITE002393		Click to Show/Hide the Full List
mod site	chr7:148828540-148828541:-		[10]
Sequence	ATCCTAGCACTTGGGAGGCTAAGGTGGGCAGATTGCTTGAG
Transcript ID List	ENST00000320356.6; rmsk_2406399; ENST00000492143.5; ENST00000498186.5; ENST00000350995.6; ENST00000460911.5; ENST00000483012.1; ENST00000483967.5; ENST00000476773.5; ENST00000478654.5
External Link	RMBase: RNA-editing_site_127937
mod ID: A2ISITE002394		Click to Show/Hide the Full List
mod site	chr7:148838939-148838940:-		[9]
Sequence	TGTGCCTTGGCCTCCAGAGCAGCTGGGACTACAGGCATGCA
Transcript ID List	ENST00000478654.5; ENST00000350995.6; ENST00000483012.1; ENST00000492143.5; ENST00000320356.6; ENST00000498186.5; ENST00000460911.5; ENST00000483967.5; ENST00000476773.5
External Link	RMBase: RNA-editing_site_127938
mod ID: A2ISITE002395		Click to Show/Hide the Full List
mod site	chr7:148869442-148869443:-		[11]
Sequence	TGAGGTGAGAGGGTCGCTTGAGCCCAGAAGGTAGAGACTGC
Transcript ID List	ENST00000492143.5; ENST00000498186.5; ENST00000478654.5; ENST00000476773.5; ENST00000320356.6; ENST00000350995.6; ENST00000460911.5; ENST00000483967.5; ENST00000483012.1; rmsk_2406482
External Link	RMBase: RNA-editing_site_127939

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000472		Click to Show/Hide the Full List
mod site	chr7:148812168-148812169:-		[12]
Sequence	AGAATCAGGGGGTGTCCTGGGGCTGAAAATGGAATAACTAT
Cell/Tissue List	HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000350995.6; ENST00000492143.5; ENST00000476773.5; ENST00000320356.6; ENST00000460911.5; ENST00000483967.5; ENST00000478654.5
External Link	RMBase: Nm_site_6272

N6-methyladenosine (m6A)

In total 52 m6A sequence/site(s) in this target gene
mod ID: M6ASITE082972		Click to Show/Hide the Full List
mod site	chr7:148807410-148807411:-		[13]
Sequence	GCAGTATGGTACATTTTTCAACTTTGAATAAAGAATACTTG
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000478654.5; ENST00000492143.5; ENST00000320356.6; ENST00000460911.5; ENST00000350995.6
External Link	RMBase: m6A_site_781241
mod ID: M6ASITE082973		Click to Show/Hide the Full List
mod site	chr7:148807420-148807421:-		[14]
Sequence	TTGCAATAATGCAGTATGGTACATTTTTCAACTTTGAATAA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000350995.6; ENST00000320356.6; ENST00000460911.5; ENST00000478654.5; ENST00000492143.5
External Link	RMBase: m6A_site_781242
mod ID: M6ASITE082974		Click to Show/Hide the Full List
mod site	chr7:148807491-148807492:-		[13]
Sequence	AGTAATGAGTTTAAAAATCAACTTTTTATTGCCTTCTCACC
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000350995.6; ENST00000460911.5; ENST00000476773.5; ENST00000320356.6; ENST00000492143.5; ENST00000478654.5
External Link	RMBase: m6A_site_781243
mod ID: M6ASITE082975		Click to Show/Hide the Full List
mod site	chr7:148807561-148807562:-		[15]
Sequence	GTGGGCAATTTAGAAAAAGAACATGCAGTTTGAAATTCTGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000350995.6; ENST00000483967.5; ENST00000478654.5; ENST00000476773.5; ENST00000320356.6; ENST00000492143.5; ENST00000460911.5
External Link	RMBase: m6A_site_781244
mod ID: M6ASITE082976		Click to Show/Hide the Full List
mod site	chr7:148807593-148807594:-		[15]
Sequence	CAGCTGCCTTAGCTTCAGGAACCTCGAGTACTGTGGGCAAT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000350995.6; ENST00000476773.5; ENST00000320356.6; ENST00000492143.5; ENST00000478654.5; ENST00000483967.5; ENST00000460911.5
External Link	RMBase: m6A_site_781245
mod ID: M6ASITE082977		Click to Show/Hide the Full List
mod site	chr7:148807614-148807615:-		[15]
Sequence	CTCCTCCCCCCTCCTCTGAAACAGCTGCCTTAGCTTCAGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000478654.5; ENST00000320356.6; ENST00000460911.5; ENST00000350995.6; ENST00000483967.5; ENST00000492143.5; ENST00000476773.5
External Link	RMBase: m6A_site_781246
mod ID: M6ASITE082978		Click to Show/Hide the Full List
mod site	chr7:148807645-148807646:-		[14]
Sequence	AGAGAAATGGAAATCCCTTGACATCTGCTACCTCCTCCCCC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000350995.6; ENST00000476773.5; ENST00000492143.5; ENST00000320356.6; ENST00000460911.5; ENST00000483967.5; ENST00000478654.5
External Link	RMBase: m6A_site_781247
mod ID: M6ASITE082979		Click to Show/Hide the Full List
mod site	chr7:148809323-148809324:-		[15]
Sequence	AAATCATTCGGTAAATCCAAACTGCTATGCAAAAGGTAGGT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000478654.5; ENST00000492143.5; ENST00000320356.6; ENST00000476773.5; ENST00000460911.5; ENST00000483967.5; ENST00000350995.6
External Link	RMBase: m6A_site_781248
mod ID: M6ASITE082980		Click to Show/Hide the Full List
mod site	chr7:148809359-148809360:-		[14]
Sequence	GGATGCAACCCGCAAGGGTAACAAAATTCGTTTTGCAAATC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000483967.5; ENST00000320356.6; ENST00000478654.5; ENST00000460911.5; ENST00000476773.5; ENST00000492143.5; ENST00000350995.6
External Link	RMBase: m6A_site_781249
mod ID: M6ASITE082981		Click to Show/Hide the Full List
mod site	chr7:148811634-148811635:-		[13]
Sequence	AAATGAATTCATCTCAGAATACTGTGGAGAGGTAAGGCACT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000483967.5; ENST00000460911.5; ENST00000476773.5; ENST00000350995.6; ENST00000320356.6; ENST00000478654.5; ENST00000469631.1; ENST00000492143.5
External Link	RMBase: m6A_site_781250
mod ID: M6ASITE082982		Click to Show/Hide the Full List
mod site	chr7:148814094-148814095:-		[14]
Sequence	CCGCTGCAAAGCACAGTGCAACACCAAGCAGTGCCCGTGCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000492143.5; ENST00000478654.5; ENST00000483967.5; ENST00000460911.5; ENST00000320356.6; ENST00000476773.5; ENST00000350995.6
External Link	RMBase: m6A_site_781251
mod ID: M6ASITE082983		Click to Show/Hide the Full List
mod site	chr7:148816688-148816689:-		[15]
Sequence	CCAAGGAAAAAGAAGAGGAAACACCGGTGAGTCTGTCATGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000460911.5; ENST00000478654.5; ENST00000476773.5; ENST00000320356.6; ENST00000492143.5; ENST00000350995.6; ENST00000483967.5
External Link	RMBase: m6A_site_781252
mod ID: M6ASITE082984		Click to Show/Hide the Full List
mod site	chr7:148816814-148816815:-		[15]
Sequence	GAATGGTTTGCCTAAATAAGACTGTCCTCATGGCTCTGTGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000350995.6; ENST00000476773.5; ENST00000478654.5; ENST00000483967.5; ENST00000492143.5; ENST00000460911.5; ENST00000320356.6
External Link	RMBase: m6A_site_781253
mod ID: M6ASITE082985		Click to Show/Hide the Full List
mod site	chr7:148817270-148817271:-		[13]
Sequence	CCTCATTGGCACTTACTATGACAATTTCTGTGCCATTGCTA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000478654.5; ENST00000350995.6; ENST00000476773.5; ENST00000460911.5; ENST00000492143.5; ENST00000483967.5; ENST00000320356.6
External Link	RMBase: m6A_site_781254
mod ID: M6ASITE082986		Click to Show/Hide the Full List
mod site	chr7:148817341-148817342:-		[15]
Sequence	AAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000478654.5; ENST00000492143.5; ENST00000483967.5; ENST00000320356.6; ENST00000476773.5; ENST00000350995.6; ENST00000460911.5
External Link	RMBase: m6A_site_781255
mod ID: M6ASITE082987		Click to Show/Hide the Full List
mod site	chr7:148817370-148817371:-		[15]
Sequence	AAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000483967.5; ENST00000460911.5; ENST00000320356.6; ENST00000350995.6; ENST00000498186.5; ENST00000476773.5; ENST00000478654.5; ENST00000492143.5
External Link	RMBase: m6A_site_781256
mod ID: M6ASITE082988		Click to Show/Hide the Full List
mod site	chr7:148817870-148817871:-		[15]
Sequence	CTTCGAGCTCCTCTGGTAAGACACGTCTAATAACTGGGTTT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hNPCs; hESCs; HEK293T; fibroblasts; A549; LCLs; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000476773.5; ENST00000478654.5; ENST00000492143.5; ENST00000498186.5; ENST00000320356.6; ENST00000350995.6; ENST00000460911.5; ENST00000483967.5
External Link	RMBase: m6A_site_781257
mod ID: M6ASITE082989		Click to Show/Hide the Full List
mod site	chr7:148817891-148817892:-		[15]
Sequence	AAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGGTAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; MM6; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460911.5; ENST00000350995.6; ENST00000476773.5; ENST00000492143.5; ENST00000478654.5; ENST00000483967.5; ENST00000320356.6; ENST00000498186.5
External Link	RMBase: m6A_site_781258
mod ID: M6ASITE082990		Click to Show/Hide the Full List
mod site	chr7:148817926-148817927:-		[15]
Sequence	GACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; hESC-HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; H1299; MM6; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000483967.5; ENST00000478654.5; ENST00000476773.5; ENST00000498186.5; ENST00000350995.6; ENST00000460911.5; ENST00000492143.5; ENST00000320356.6
External Link	RMBase: m6A_site_781259
mod ID: M6ASITE082991		Click to Show/Hide the Full List
mod site	chr7:148817939-148817940:-		[16]
Sequence	ATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGAT
Motif Score	2.179660714
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000476773.5; ENST00000350995.6; ENST00000498186.5; ENST00000492143.5; ENST00000320356.6; ENST00000483967.5; ENST00000460911.5; ENST00000478654.5
External Link	RMBase: m6A_site_781260
mod ID: M6ASITE082992		Click to Show/Hide the Full List
mod site	chr7:148817945-148817946:-		[15]
Sequence	ACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; MM6; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000460911.5; ENST00000320356.6; ENST00000483967.5; ENST00000478654.5; ENST00000350995.6; ENST00000476773.5; ENST00000498186.5; ENST00000492143.5
External Link	RMBase: m6A_site_781261
mod ID: M6ASITE082993		Click to Show/Hide the Full List
mod site	chr7:148817965-148817966:-		[15]
Sequence	GCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492143.5; ENST00000350995.6; ENST00000460911.5; ENST00000476773.5; ENST00000478654.5; ENST00000483967.5; ENST00000498186.5; ENST00000320356.6
External Link	RMBase: m6A_site_781262
mod ID: M6ASITE082994		Click to Show/Hide the Full List
mod site	chr7:148818068-148818069:-		[15]
Sequence	TCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000350995.6; ENST00000320356.6; ENST00000460911.5; ENST00000492143.5; ENST00000478654.5; ENST00000476773.5; ENST00000483012.1; ENST00000483967.5; ENST00000498186.5
External Link	RMBase: m6A_site_781263
mod ID: M6ASITE082995		Click to Show/Hide the Full List
mod site	chr7:148819008-148819009:-		[15]
Sequence	TATTGCCTGTTGGATTTTGGACAGAAGATTCATTGAATGGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000350995.6; ENST00000320356.6; ENST00000483012.1; ENST00000498186.5; ENST00000483967.5; ENST00000460911.5; ENST00000476773.5; ENST00000492143.5; ENST00000478654.5
External Link	RMBase: m6A_site_781264
mod ID: M6ASITE082996		Click to Show/Hide the Full List
mod site	chr7:148819042-148819043:-		[15]
Sequence	CAAGCCACTCCTACCTAGGAACTAAATGGGTATATATTGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492143.5; ENST00000460911.5; ENST00000320356.6; ENST00000478654.5; ENST00000350995.6; ENST00000476773.5; ENST00000498186.5; ENST00000483967.5; ENST00000483012.1
External Link	RMBase: m6A_site_781265
mod ID: M6ASITE082997		Click to Show/Hide the Full List
mod site	chr7:148819616-148819617:-		[15]
Sequence	CTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000483012.1; ENST00000483967.5; ENST00000492143.5; ENST00000350995.6; ENST00000478654.5; ENST00000460911.5; ENST00000498186.5; ENST00000476773.5; ENST00000320356.6
External Link	RMBase: m6A_site_781266
mod ID: M6ASITE082998		Click to Show/Hide the Full List
mod site	chr7:148819625-148819626:-		[15]
Sequence	GAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460911.5; ENST00000498186.5; ENST00000350995.6; ENST00000320356.6; ENST00000483967.5; ENST00000476773.5; ENST00000492143.5; ENST00000478654.5; ENST00000483012.1
External Link	RMBase: m6A_site_781267
mod ID: M6ASITE082999		Click to Show/Hide the Full List
mod site	chr7:148819632-148819633:-		[15]
Sequence	GAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCAC
Motif Score	2.897386905
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492143.5; ENST00000498186.5; ENST00000476773.5; ENST00000350995.6; ENST00000483012.1; ENST00000460911.5; ENST00000483967.5; ENST00000320356.6; ENST00000478654.5
External Link	RMBase: m6A_site_781268
mod ID: M6ASITE083000		Click to Show/Hide the Full List
mod site	chr7:148819642-148819643:-		[15]
Sequence	ATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCT
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000478654.5; ENST00000492143.5; ENST00000476773.5; ENST00000483012.1; ENST00000483967.5; ENST00000498186.5; ENST00000350995.6; ENST00000460911.5; ENST00000320356.6
External Link	RMBase: m6A_site_781269
mod ID: M6ASITE083001		Click to Show/Hide the Full List
mod site	chr7:148819650-148819651:-		[15]
Sequence	CAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460911.5; ENST00000350995.6; ENST00000492143.5; ENST00000320356.6; ENST00000478654.5; ENST00000498186.5; ENST00000483012.1; ENST00000483967.5; ENST00000476773.5
External Link	RMBase: m6A_site_781270
mod ID: M6ASITE083002		Click to Show/Hide the Full List
mod site	chr7:148826472-148826473:-		[14]
Sequence	TTTAAATATGACTGCTTCCTACATCGTAAGTGCAATTATTG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000483967.5; ENST00000320356.6; ENST00000483012.1; ENST00000492143.5; ENST00000460911.5; ENST00000350995.6; ENST00000476773.5; ENST00000478654.5; ENST00000498186.5
External Link	RMBase: m6A_site_781271
mod ID: M6ASITE083003		Click to Show/Hide the Full List
mod site	chr7:148826526-148826527:-		[14]
Sequence	GTTCAGAGAGAGCAAAGCTTACACTCCTTTCATACGCTTTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000476773.5; ENST00000492143.5; ENST00000483012.1; ENST00000478654.5; ENST00000460911.5; ENST00000498186.5; ENST00000320356.6; ENST00000350995.6; ENST00000483967.5
External Link	RMBase: m6A_site_781272
mod ID: M6ASITE083004		Click to Show/Hide the Full List
mod site	chr7:148826562-148826563:-		[15]
Sequence	TGTACCCCCAACATAGATGGACCAAATGCTAAATCTGTTCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; hNPCs; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000483967.5; ENST00000476773.5; ENST00000350995.6; ENST00000492143.5; ENST00000320356.6; ENST00000460911.5; ENST00000478654.5; ENST00000498186.5; ENST00000483012.1
External Link	RMBase: m6A_site_781273
mod ID: M6ASITE083005		Click to Show/Hide the Full List
mod site	chr7:148826572-148826573:-		[14]
Sequence	TCCTCCTGAATGTACCCCCAACATAGATGGACCAAATGCTA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000350995.6; ENST00000476773.5; ENST00000492143.5; ENST00000483967.5; ENST00000483012.1; ENST00000460911.5; ENST00000320356.6; ENST00000478654.5; ENST00000498186.5
External Link	RMBase: m6A_site_781274
mod ID: M6ASITE083006		Click to Show/Hide the Full List
mod site	chr7:148826613-148826614:-		[15]
Sequence	AGATATAAAGAACTCACCGAACAGCAGCTCCCAGGCGCACT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000483012.1; ENST00000498186.5; ENST00000460911.5; ENST00000492143.5; ENST00000483967.5; ENST00000320356.6; ENST00000478654.5; ENST00000350995.6; ENST00000476773.5
External Link	RMBase: m6A_site_781275
mod ID: M6ASITE083007		Click to Show/Hide the Full List
mod site	chr7:148826622-148826623:-		[15]
Sequence	GTTAATGTCAGATATAAAGAACTCACCGAACAGCAGCTCCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000476773.5; ENST00000478654.5; ENST00000483012.1; ENST00000460911.5; ENST00000483967.5; ENST00000320356.6; ENST00000498186.5; ENST00000492143.5; ENST00000350995.6
External Link	RMBase: m6A_site_781276
mod ID: M6ASITE083008		Click to Show/Hide the Full List
mod site	chr7:148827174-148827175:-		[15]
Sequence	GATAAGGGCACAGCAGAAGAACTAAAGGAAAAGTAAGAATT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000492143.5; ENST00000460911.5; ENST00000483967.5; ENST00000483012.1; ENST00000350995.6; ENST00000476773.5; ENST00000498186.5; ENST00000320356.6; ENST00000478654.5
External Link	RMBase: m6A_site_781277
mod ID: M6ASITE083009		Click to Show/Hide the Full List
mod site	chr7:148828810-148828811:-		[13]
Sequence	TGGTCAATATAATGATGATGACGATGATGATGATGGAGACG
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000483012.1; ENST00000478654.5; ENST00000498186.5; ENST00000492143.5; ENST00000483967.5; ENST00000320356.6; ENST00000460911.5; ENST00000476773.5; ENST00000350995.6
External Link	RMBase: m6A_site_781278
mod ID: M6ASITE083010		Click to Show/Hide the Full List
mod site	chr7:148829740-148829741:-		[14]
Sequence	AAAAATTATGATGGGAAAGTACACGGGGATAGAGGTGAGCC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000483967.5; ENST00000483012.1; ENST00000492143.5; ENST00000320356.6; ENST00000476773.5; ENST00000460911.5; ENST00000498186.5; ENST00000478654.5; ENST00000350995.6
External Link	RMBase: m6A_site_781279
mod ID: M6ASITE083011		Click to Show/Hide the Full List
mod site	chr7:148829767-148829768:-		[15]
Sequence	GATGGTACTTTCATTGAAGAACTAATAAAAAATTATGATGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000483967.5; ENST00000492143.5; ENST00000478654.5; ENST00000483012.1; ENST00000498186.5; ENST00000476773.5; ENST00000350995.6; ENST00000460911.5; ENST00000320356.6
External Link	RMBase: m6A_site_781280
mod ID: M6ASITE083012		Click to Show/Hide the Full List
mod site	chr7:148829822-148829823:-		[14]
Sequence	AGATGAAACTGTTTTACATAACATTCCTTATATGGGAGATG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000478654.5; ENST00000483967.5; ENST00000492143.5; ENST00000498186.5; ENST00000476773.5; ENST00000350995.6; ENST00000483012.1; ENST00000320356.6; ENST00000460911.5
External Link	RMBase: m6A_site_781281
mod ID: M6ASITE083013		Click to Show/Hide the Full List
mod site	chr7:148829835-148829836:-		[15]
Sequence	TCTTTTAGGTGGAAGATGAAACTGTTTTACATAACATTCCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000350995.6; ENST00000476773.5; ENST00000478654.5; ENST00000492143.5; ENST00000460911.5; ENST00000498186.5; ENST00000483012.1; ENST00000483967.5; ENST00000320356.6
External Link	RMBase: m6A_site_781282
mod ID: M6ASITE083014		Click to Show/Hide the Full List
mod site	chr7:148832719-148832720:-		[14]
Sequence	CCAGTGACTTGGATTTTCCAACACAAGTCATCCCATTAAAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000478654.5; ENST00000483012.1; ENST00000483967.5; ENST00000492143.5; ENST00000320356.6; ENST00000460911.5; ENST00000498186.5; ENST00000350995.6; ENST00000476773.5
External Link	RMBase: m6A_site_781283
mod ID: M6ASITE083015		Click to Show/Hide the Full List
mod site	chr7:148836945-148836946:-		[15]
Sequence	TAACACAGTTTTTACTTGGAACCAGCCTTCTGCCAAGAGTC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000483012.1; ENST00000478654.5; ENST00000476773.5; ENST00000492143.5; ENST00000350995.6; ENST00000320356.6; ENST00000483967.5; ENST00000460911.5; ENST00000498186.5
External Link	RMBase: m6A_site_781284
mod ID: M6ASITE083016		Click to Show/Hide the Full List
mod site	chr7:148846509-148846510:-		[14]
Sequence	GCGAAGGATACAGCCTGTGCACATCCTGACTTCTGTGAGCT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000483967.5; ENST00000320356.6; ENST00000476773.5; ENST00000483012.1; ENST00000492143.5; ENST00000498186.5; ENST00000478654.5; ENST00000350995.6; ENST00000460911.5
External Link	RMBase: m6A_site_781285
mod ID: M6ASITE083017		Click to Show/Hide the Full List
mod site	chr7:148847230-148847231:-		[14]
Sequence	GAAGCGTGTAAAATCAGAGTACATGCGACTGAGACAGCTCA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000320356.6; ENST00000460911.5; ENST00000476773.5; ENST00000478654.5; ENST00000483967.5; ENST00000492143.5; ENST00000483012.1; ENST00000350995.6; ENST00000498186.5
External Link	RMBase: m6A_site_781286
mod ID: M6ASITE083018		Click to Show/Hide the Full List
mod site	chr7:148847265-148847266:-		[17]
Sequence	GGGAAGAAATCTGAGAAGGGACCAGTTTGTTGGCGGAAGCG
Motif Score	3.622404762
Cell/Tissue List	MT4; HEK293A-TOA; iSLK; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000492143.5; ENST00000320356.6; ENST00000460911.5; ENST00000483012.1; ENST00000476773.5; ENST00000478654.5; ENST00000483967.5; ENST00000350995.6; ENST00000498186.5
External Link	RMBase: m6A_site_781287
mod ID: M6ASITE083019		Click to Show/Hide the Full List
mod site	chr7:148847288-148847289:-		[17]
Sequence	TTAGAATAATCATGGGCCAGACTGGGAAGAAATCTGAGAAG
Motif Score	3.319380952
Cell/Tissue List	MT4; HEK293A-TOA; iSLK; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000350995.6; ENST00000498186.5; ENST00000483012.1; ENST00000478654.5; ENST00000476773.5; ENST00000483967.5; ENST00000492143.5; ENST00000320356.6; ENST00000460911.5
External Link	RMBase: m6A_site_781288
mod ID: M6ASITE083020		Click to Show/Hide the Full List
mod site	chr7:148883211-148883212:-		[15]
Sequence	GAAGCACGATCTTTTGGAAAACTTGGTGAACGCCTAGTGAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460911.5; ENST00000483967.5; ENST00000492143.5; ENST00000478654.5; ENST00000498186.5; ENST00000350995.6; ENST00000483012.1; ENST00000320356.6; ENST00000476773.5
External Link	RMBase: m6A_site_781289
mod ID: M6ASITE083021		Click to Show/Hide the Full List
mod site	chr7:148884190-148884191:-		[14]
Sequence	CGCGGGGGCGACGCGCGGGAACAACGCGAGTCGGCGCGCGG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; U2OS; MT4; HEK293A-TOA
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000350995.6; ENST00000492143.5; ENST00000483012.1; ENST00000460911.5; ENST00000498186.5; ENST00000320356.6; ENST00000483967.5
External Link	RMBase: m6A_site_781290
mod ID: M6ASITE083022		Click to Show/Hide the Full List
mod site	chr7:148884251-148884252:-		[15]
Sequence	CGCGTCCGACACCCGGTGGGACTCAGAAGGCAGTGGAGCCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4; HEK293T; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000320356.6; ENST00000498186.5; ENST00000483967.5; ENST00000483012.1; ENST00000492143.5
External Link	RMBase: m6A_site_781291
mod ID: M6ASITE083023		Click to Show/Hide the Full List
mod site	chr7:148884263-148884264:-		[14]
Sequence	GCTCGGTCCGGTCGCGTCCGACACCCGGTGGGACTCAGAAG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498186.5; ENST00000320356.6; ENST00000483012.1; ENST00000492143.5; ENST00000483967.5
External Link	RMBase: m6A_site_781292

Ref 1	METTL3 promotes the progression of nasopharyngeal carcinoma through mediating M6A modification of EZH2. Eur Rev Med Pharmacol Sci. 2020 Apr;24(8):4328-4336. doi: 10.26355/eurrev_202004_21014.
Ref 2	Simvastatin is beneficial to lung cancer progression by inducing METTL3-induced m6A modification on EZH2 mRNA. Eur Rev Med Pharmacol Sci. 2020 Apr;24(8):4263-4270. doi: 10.26355/eurrev_202004_21006.
Ref 3	METTL3 Accelerates Breast Cancer Progression via Regulating EZH2 m(6)A Modification. J Healthc Eng. 2022 Mar 29;2022:5794422. doi: 10.1155/2022/5794422. eCollection 2022.
Ref 4	METTL3 promotes inflammation and cell apoptosis in a pediatric pneumonia model by regulating EZH2. Allergol Immunopathol (Madr). 2021 Sep 1;49(5):49-56. doi: 10.15586/aei.v49i5.445. eCollection 2021.
Ref 5	IGF2BP1 Promotes Proliferation of Neuroendocrine Neoplasms by Post-Transcriptional Enhancement of EZH2. Cancers (Basel). 2022 Apr 24;14(9):2121. doi: 10.3390/cancers14092121.
Ref 6	URL: http://www.guidetopharmacology.org Nucleic Acids Res. 2015 Oct 12. pii: gkv1037. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. (Target id: 2608).
Ref 7	Interplay of m(6) A and histone modifications contributes to temozolomide resistance in glioblastoma. Clin Transl Med. 2021 Sep;11(9):e553. doi: 10.1002/ctm2.553.
Ref 8	Clinical pipeline report, company report or official report of Astex Pharmaceuticals.
Ref 9	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 10	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 11	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 12	High-throughput identification of C/D box snoRNA targets with CLIP and RiboMeth-seq. Nucleic Acids Res. 2017 Mar 17;45(5):2341-2353. doi: 10.1093/nar/gkw1321.
Ref 13	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 16	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 17	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map