m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00856)

Target Name	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Synonyms	7SK; RNA, 7SK, nuclear Click to Show/Hide
Gene Name	RN7SK
Chromosomal Location	6p12.2
Gene ID	125050
HGNC ID	HGNC:10037

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05648		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	The positive transcription elongation factor b complex (P-TEFb)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05660		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	mitoxantrone (MIT)	Drug Info
Crosstalk ID: M6ACROT06030		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	hydroxyurea (HYD)	Drug Info
Crosstalk ID: M6ACROT06033		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	raltitrexed (RAL)	Drug Info
Crosstalk ID: M6ACROT06036		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	oxaliplatin (OXA)	Drug Info
Crosstalk ID: M6ACROT06039		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	etoposide (ETO)	Drug Info

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05649		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	The positive transcription elongation factor b complex (P-TEFb)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)

Regulator Info

In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05659		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	mitoxantrone (MIT)	Drug Info
Crosstalk ID: M6ACROT06029		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	hydroxyurea (HYD)	Drug Info
Crosstalk ID: M6ACROT06032		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	raltitrexed (RAL)	Drug Info
Crosstalk ID: M6ACROT06035		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	oxaliplatin (OXA)	Drug Info
Crosstalk ID: M6ACROT06038		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	etoposide (ETO)	Drug Info

m6A Regulator: YTH domain-containing protein 2 (YTHDC2)

Regulator Info

In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05661		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	mitoxantrone (MIT)	Drug Info
Crosstalk ID: M6ACROT06031		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	hydroxyurea (HYD)	Drug Info
Crosstalk ID: M6ACROT06034		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	raltitrexed (RAL)	Drug Info
Crosstalk ID: M6ACROT06037		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	oxaliplatin (OXA)	Drug Info
Crosstalk ID: M6ACROT06040		Crosstalk Info
Epigenetic Regulator	RNA component of 7SK nuclear ribonucleoprotein (RN7SK)
Regulated Target	Cullin 1 (CUL1)
Crosstalk relationship	m6A → ncRNA
Drug	etoposide (ETO)	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00856)

RNA component of 7SK nuclear ribonucleoprotein (RN7SK)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004033		Click to Show/Hide the Full List
mod site	chr6:52995746-52995747:+		[3]
Sequence	CATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGTCGAAGAGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000365328.1; ENST00000636484.1; rmsk_1950532
External Link	RMBase: m5C_site_38204

N6-methyladenosine (m6A)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M6ASITE075524		Click to Show/Hide the Full List
mod site	chr6:52995790-52995791:+		[4]
Sequence	ACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000365328.1; rmsk_1950532; ENST00000636484.1
External Link	RMBase: m6A_site_720614
mod ID: M6ASITE075525		Click to Show/Hide the Full List
mod site	chr6:52995838-52995839:+		[4]
Sequence	AGCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCTCAAG
Motif Score	2.930744048
Cell/Tissue List	HeLa; H1A; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636484.1; ENST00000365328.1; rmsk_1950532
External Link	RMBase: m6A_site_720615
mod ID: M6ASITE075526		Click to Show/Hide the Full List
mod site	chr6:52995846-52995847:+		[4]
Sequence	TCCCCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; H1A; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636484.1; rmsk_1950532; ENST00000365328.1
External Link	RMBase: m6A_site_720616
mod ID: M6ASITE075527		Click to Show/Hide the Full List
mod site	chr6:52995899-52995900:+		[4]
Sequence	AGGGTAGTCAAGCTTCCAAGACTCCAGACACATCCAAATGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; H1A; MT4; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_1950532; ENST00000365328.1; ENST00000636484.1
External Link	RMBase: m6A_site_720617
mod ID: M6ASITE075528		Click to Show/Hide the Full List
mod site	chr6:52995906-52995907:+		[4]
Sequence	TCAAGCTTCCAAGACTCCAGACACATCCAAATGAGGCGCTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; H1A; MT4; Huh7; endometrial; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000365328.1; ENST00000636484.1; rmsk_1950532
External Link	RMBase: m6A_site_720618

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000407		Click to Show/Hide the Full List
mod site	chr6:52995676-52995677:+		[5]
Sequence	CATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	rmsk_1950532; ENST00000365328.1; ENST00000636484.1
External Link	RMBase: Nm_site_5855

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000236		Click to Show/Hide the Full List
mod site	chr6:52995868-52995869:+		[6]
Sequence	AAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCA
Transcript ID List	ENST00000365328.1; rmsk_1950532; ENST00000636484.1
External Link	RMBase: Pseudo_site_4265

Ref 1	US patent application no. 6,187,586, Antisense modulation of AKT-3 expression.
Ref 2	Melanocortin Receptor Agonists Facilitate Oxytocin-Dependent Partner Preference Formation in the Prairie Vole. Neuropsychopharmacology. 2015 Jul;40(8):1856-65. doi: 10.1038/npp.2015.35. Epub 2015 Feb 5.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 6	Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature. 2014 Nov 6;515(7525):143-6. doi: 10.1038/nature13802. Epub 2014 Sep 5.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map