m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00274)

Target Name	Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A)
Synonyms	HIF-1-alpha; HIF1-alpha; ARNT-interacting protein; Basic-helix-loop-helix-PAS protein MOP1; Class E basic helix-loop-helix protein 78; bHLHe78; Member of PAS protein 1; PAS domain-containing protein 8; BHLHE78; MOP1; PASD8 Click to Show/Hide
Gene Name	HIF1A
Chromosomal Location	14q23.2
Function	Functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. Plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Heterodimerizes with ARNT; heterodimer binds to core DNA sequence 5'-TACGTG-3' within the hypoxia response element (HRE) of target gene promoters (By similarity). Activation requires recruitment of transcriptional coactivators such as CREBBP and EP300. Activity is enhanced by interaction with NCOA1 and/or NCOA2. Interaction with redox regulatory protein APEX1 seems to activate CTAD and potentiates activation by NCOA1 and CREBBP. Involved in the axonal distribution and transport of mitochondria in neurons during hypoxia. (Microbial infection) Upon infection by human coronavirus SARS-CoV-2, is required for induction of glycolysis in monocytes and the consequent proinflammatory state. In monocytes, induces expression of ACE2 and cytokines such as IL1B, TNF, IL6, and interferons. Promotes human coronavirus SARS-CoV-2 replication and monocyte inflammatory response. Click to Show/Hide
Gene ID	3091
Uniprot ID	HIF1A_HUMAN
HGNC ID	HGNC:4910
KEGG ID	hsa:3091

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

HIF1A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 1.13E+00 p-value: 4.17E-08
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	HBXIP drives metabolic reprogramming in hepatocellular carcinoma cells via METTL3-mediated m6A modification of Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A). Highly expressed HBXIP and METTL3 are associated with dismal oncologic outcomes of patients with hepatocellular carcinoma. The positive relation between HBXIP and METTL3 can activate reprogramming of HCC cell metabolism by inducing m6A modification of HIF-1-alpha, which is unraveled to enhance aggressive biological behaviors of HCC cells.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	HIF-1 signaling pathway			hsa04066
Pathway Response	Central carbon metabolism in cancer			hsa05230
Cell Process	Glycolysis
Cell Process	Glutaminolysis
In-vitro Model	BEL-7402	Endocervical adenocarcinoma	Homo sapiens	CVCL_5492
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	MHCC97	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4971
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	IGF2BP3 positively regulated Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A) expression by directly binding to a specific m6A site in the coding region of HIF1A mRNA in gastric cancer cells. IGF2BP3 and HIF1A were highly expressed in GC tissues and hypoxia-treated GC cells.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Cell Process	Cell migration
In-vitro Model	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[9]
Response Summary	YTHDC2 contributes to colon tumor metastasis by promoting translation of Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A) and that YTHDC2 is potentially a diagnostic marker and target gene for treating colon cancer patients.
Target Regulation	Up regulation
Responsed Disease	Colon cancer		ICD-11: 2B90	Disease Info
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Biological regulation
In-vitro Model	COS (From the African green monkey cell line (CV-1).)
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	HCT116, Y2KD-116 and con-116 cells were resuspended at 1 × 10⁶ cells per 50 ul of PBS. Cells were injected into the exteriorized spleen after abdominal incision.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	IGF2BP3 positively regulated Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A) expression by directly binding to a specific m6A site in the coding region of HIF1A mRNA in gastric cancer cells. IGF2BP3 and HIF1A were highly expressed in GC tissues and hypoxia-treated GC cells.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell migration
In-vitro Model	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

Colon cancer [ICD-11: 2B90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[9]
Response Summary	YTHDC2 contributes to colon tumor metastasis by promoting translation of Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A) and that YTHDC2 is potentially a diagnostic marker and target gene for treating colon cancer patients.
Responsed Disease	Colon cancer [ICD-11: 2B90]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Biological regulation
In-vitro Model	COS (From the African green monkey cell line (CV-1).)
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	HCT116, Y2KD-116 and con-116 cells were resuspended at 1 × 10⁶ cells per 50 ul of PBS. Cells were injected into the exteriorized spleen after abdominal incision.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	HBXIP drives metabolic reprogramming in hepatocellular carcinoma cells via METTL3-mediated m6A modification of Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A). Highly expressed HBXIP and METTL3 are associated with dismal oncologic outcomes of patients with hepatocellular carcinoma. The positive relation between HBXIP and METTL3 can activate reprogramming of HCC cell metabolism by inducing m6A modification of HIF-1-alpha, which is unraveled to enhance aggressive biological behaviors of HCC cells.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	HIF-1 signaling pathway			hsa04066
Pathway Response	Central carbon metabolism in cancer			hsa05230
Cell Process	Glycolysis
Cell Process	Glutaminolysis
In-vitro Model	BEL-7402	Endocervical adenocarcinoma	Homo sapiens	CVCL_5492
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	MHCC97	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4971
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534

Inflammatory response [ICD-11: MG46]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	Lnc-Dpf3 directly bound to Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A) and suppressed HIF-1-alpha-dependent transcription of the glycolytic gene Ldha, thus inhibiting DC glycolytic metabolism and migratory capacity. CCR7-inducible lnc-Dpf3 in coupling epigenetic and metabolic pathways to feedback-control DC migration and inflammatory responses.
Responsed Disease	Inflammatory response [ICD-11: MG46]
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Glycolysis
	Immune responses
	Inflammatory injuries
In-vitro Model	()
	()
	()
	()
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	Positive ES cell clones were expanded and injected into C57BL/6J blastocysts to generate the chimeric offspring. The chimeric mice were mated with C57BL/6J mice to obtain the lnc-Dpf3 floxed heterozygous mouse (lnc-Dpf3^fl/+). The lnc-Dpf3^fl/+ mice were bred with C57BL/6J mice expressing the Cre recombinase under the control of the Itgax promoter (Itgax-cre mice; The Jackson Laboratory) to generate lnc-Dpf3 floxed heterozygous mouse with Itgax-cre allele (lnc-Dpf3^fl/+Itgax-cre⁺). These mice were intercrossed to generate DC-specific lnc-Dpf3-deficient mice (lnc-Dpf3^fl/flItgax-cre⁺) used for this study. Hif1a^fl/fl mice, a kindly gift from Dr. Ming Zhang (Renji Hospital, Medical College of Shanghai Jiaotong University, China) were crossed with Itgax-cre mice to generate DC-specific HIF-1-Alpha-deficient mice (Hif1a^fl/flItgax-cre⁺). All mice were maintained under specific pathogen-free conditions and used at 6-8 weeks of age.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Methyltransferase-like 16 (METTL16)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00523		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 142 (MIR142)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00527		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	MicroRNA 576 (MIR576)
Crosstalk relationship	m6Am → m6A

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00524		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 142 (MIR142)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00528		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	MicroRNA 576 (MIR576)
Crosstalk relationship	m6Am → m6A

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00525		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 142 (MIR142)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00529		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	MicroRNA 576 (MIR576)
Crosstalk relationship	m6Am → m6A

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00526		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 142 (MIR142)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00530		Crosstalk Info
Epigenetic Regulator	Fat mass and obesity-associated protein (FTO)
Regulated Target	MicroRNA 576 (MIR576)
Crosstalk relationship	m6Am → m6A

Non-coding RNA

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05123		Crosstalk Info
Epigenetic Regulator	Urothelial cancer associated 1 (UCA1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	ncRNA → m6A
Disease	Psoriasis	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00274)

Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A)

Adenosine-to-Inosine editing (A-to-I)

In total 27 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006373		Click to Show/Hide the Full List
mod site	chr14:61702198-61702199:+		[10]
Sequence	CCATTTTGGGAGGCCGGGGCAGGTGAATCACCTGAGGTCAG
Transcript ID List	rmsk_4191415; ENST00000394997.5; ENST00000557446.5; ENST00000323441.10; ENST00000539097.2; ENST00000553999.5; ENST00000557538.5; ENST00000337138.9; ENST00000557206.1
External Link	RMBase: RNA-editing_site_38833
mod ID: A2ISITE006374		Click to Show/Hide the Full List
mod site	chr14:61702217-61702218:+		[10]
Sequence	CAGGTGAATCACCTGAGGTCAGGAGTTCAAGACAAGCCTGA
Transcript ID List	ENST00000323441.10; ENST00000557206.1; ENST00000394997.5; ENST00000557538.5; ENST00000337138.9; ENST00000539097.2; ENST00000553999.5; rmsk_4191415; ENST00000557446.5
External Link	RMBase: RNA-editing_site_38834
mod ID: A2ISITE006375		Click to Show/Hide the Full List
mod site	chr14:61702225-61702226:+		[10]
Sequence	TCACCTGAGGTCAGGAGTTCAAGACAAGCCTGACCAACTTG
Transcript ID List	ENST00000337138.9; ENST00000539097.2; ENST00000557206.1; ENST00000553999.5; ENST00000557538.5; rmsk_4191415; ENST00000557446.5; ENST00000394997.5; ENST00000323441.10
External Link	RMBase: RNA-editing_site_38835
mod ID: A2ISITE006376		Click to Show/Hide the Full List
mod site	chr14:61702231-61702232:+		[10]
Sequence	GAGGTCAGGAGTTCAAGACAAGCCTGACCAACTTGGAGAAA
Transcript ID List	ENST00000557538.5; ENST00000557446.5; ENST00000539097.2; ENST00000337138.9; rmsk_4191415; ENST00000557206.1; ENST00000323441.10; ENST00000394997.5; ENST00000553999.5
External Link	RMBase: RNA-editing_site_38836
mod ID: A2ISITE006377		Click to Show/Hide the Full List
mod site	chr14:61702241-61702242:+		[10]
Sequence	GTTCAAGACAAGCCTGACCAACTTGGAGAAACCCCGTCTCT
Transcript ID List	ENST00000557206.1; ENST00000557538.5; ENST00000553999.5; rmsk_4191415; ENST00000337138.9; ENST00000394997.5; ENST00000539097.2; ENST00000323441.10; ENST00000557446.5
External Link	RMBase: RNA-editing_site_38837
mod ID: A2ISITE006378		Click to Show/Hide the Full List
mod site	chr14:61702247-61702248:+		[10]
Sequence	GACAAGCCTGACCAACTTGGAGAAACCCCGTCTCTACTAAA
Transcript ID List	ENST00000394997.5; rmsk_4191415; ENST00000557538.5; ENST00000539097.2; ENST00000553999.5; ENST00000557206.1; ENST00000557446.5; ENST00000337138.9; ENST00000323441.10
External Link	RMBase: RNA-editing_site_38838
mod ID: A2ISITE006379		Click to Show/Hide the Full List
mod site	chr14:61702251-61702252:+		[10]
Sequence	AGCCTGACCAACTTGGAGAAACCCCGTCTCTACTAAAAATA
Transcript ID List	ENST00000394997.5; ENST00000323441.10; ENST00000557446.5; ENST00000557538.5; rmsk_4191415; ENST00000539097.2; ENST00000553999.5; ENST00000337138.9; ENST00000557206.1
External Link	RMBase: RNA-editing_site_38839
mod ID: A2ISITE006380		Click to Show/Hide the Full List
mod site	chr14:61702311-61702312:+		[10]
Sequence	ATAGCAGGATGTGGTGGCACATGCCTGTAATCCCAGCTACT
Transcript ID List	ENST00000557446.5; rmsk_4191415; ENST00000323441.10; ENST00000539097.2; ENST00000557206.1; ENST00000394997.5; ENST00000553999.5; ENST00000337138.9; ENST00000557538.5
External Link	RMBase: RNA-editing_site_38840
mod ID: A2ISITE006381		Click to Show/Hide the Full List
mod site	chr14:61702320-61702321:+		[10]
Sequence	TGTGGTGGCACATGCCTGTAATCCCAGCTACTCGGAGGCTG
Transcript ID List	ENST00000337138.9; ENST00000553999.5; ENST00000394997.5; ENST00000539097.2; ENST00000557538.5; ENST00000557206.1; rmsk_4191415; ENST00000323441.10; ENST00000557446.5
External Link	RMBase: RNA-editing_site_38841
mod ID: A2ISITE006382		Click to Show/Hide the Full List
mod site	chr14:61702329-61702330:+		[10]
Sequence	ACATGCCTGTAATCCCAGCTACTCGGAGGCTGAGGCAGGAG
Transcript ID List	ENST00000557538.5; rmsk_4191415; ENST00000394997.5; ENST00000337138.9; ENST00000557446.5; ENST00000557206.1; ENST00000323441.10; ENST00000553999.5; ENST00000539097.2
External Link	RMBase: RNA-editing_site_38842
mod ID: A2ISITE006383		Click to Show/Hide the Full List
mod site	chr14:61709057-61709058:+		[11]
Sequence	CAGGCACGTGGCAACATGCCTAGCTAATTTTGTATTTTTAG
Transcript ID List	ENST00000539097.2; ENST00000553999.5; ENST00000323441.10; ENST00000557446.5; ENST00000557206.1; ENST00000557538.5; ENST00000337138.9; ENST00000394997.5
External Link	RMBase: RNA-editing_site_38843
mod ID: A2ISITE006384		Click to Show/Hide the Full List
mod site	chr14:61710782-61710783:+		[12]
Sequence	TTAAAAAAACAAAGCTGGCCAGGCGCGGTGGCTCACGCCTG
Transcript ID List	ENST00000553999.5; ENST00000337138.9; ENST00000557538.5; ENST00000557206.1; ENST00000323441.10; rmsk_4191430; ENST00000557446.5; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: RNA-editing_site_38844
mod ID: A2ISITE006385		Click to Show/Hide the Full List
mod site	chr14:61711010-61711011:+		[11]
Sequence	GAGCGGAGATCGCACCACTGTACTTCAGCCTTGGGCAACAG
Transcript ID List	ENST00000557206.1; rmsk_4191430; ENST00000553999.5; ENST00000557446.5; ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: RNA-editing_site_38845
mod ID: A2ISITE006386		Click to Show/Hide the Full List
mod site	chr14:61711342-61711343:+		[11]
Sequence	GCCTCCTGAGTATCTGGAACTACAGGAGTGCACCATTACAC
Transcript ID List	ENST00000539097.2; ENST00000557446.5; ENST00000557206.1; ENST00000394997.5; ENST00000323441.10; ENST00000337138.9; ENST00000553999.5; ENST00000557538.5
External Link	RMBase: RNA-editing_site_38846
mod ID: A2ISITE006387		Click to Show/Hide the Full List
mod site	chr14:61711358-61711359:+		[11]
Sequence	GAACTACAGGAGTGCACCATTACACTCGGCTAGTAATTTGA
Transcript ID List	ENST00000539097.2; ENST00000553999.5; ENST00000323441.10; ENST00000557538.5; ENST00000557446.5; ENST00000394997.5; ENST00000337138.9; ENST00000557206.1
External Link	RMBase: RNA-editing_site_38847
mod ID: A2ISITE006388		Click to Show/Hide the Full List
mod site	chr14:61711368-61711369:+		[11]
Sequence	AGTGCACCATTACACTCGGCTAGTAATTTGATTGGTTAAGA
Transcript ID List	ENST00000557446.5; ENST00000539097.2; ENST00000557206.1; ENST00000557538.5; ENST00000394997.5; ENST00000337138.9; ENST00000553999.5; ENST00000323441.10
External Link	RMBase: RNA-editing_site_38848
mod ID: A2ISITE006389		Click to Show/Hide the Full List
mod site	chr14:61721140-61721141:+		[11]
Sequence	ATCTCAGCTACTAGGGAGGCTGAGGCAGGAGAATTGCTTAA
Transcript ID List	ENST00000557446.5; ENST00000337138.9; rmsk_4191446; ENST00000557538.5; ENST00000394997.5; ENST00000323441.10; ENST00000557206.1; ENST00000539097.2; ENST00000553999.5
External Link	RMBase: RNA-editing_site_38849
mod ID: A2ISITE006391		Click to Show/Hide the Full List
mod site	chr14:61727863-61727864:+		[11]
Sequence	ATGTGGTGAAACCCCATCTCTACTAAAAAATACAAAAATTA
Transcript ID List	ENST00000557538.5; ENST00000323441.10; ENST00000539097.2; rmsk_4191460; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: RNA-editing_site_38851
mod ID: A2ISITE006392		Click to Show/Hide the Full List
mod site	chr14:61738874-61738875:+		[11]
Sequence	GCCTCCCAAGTAGCTGGGACTACAGGCCTGCATCACCATGC
Transcript ID List	ENST00000555937.1; ENST00000337138.9; ENST00000394997.5; ENST00000539097.2; ENST00000323441.10; ENST00000555014.1; ENST00000557538.5
External Link	RMBase: RNA-editing_site_38852
mod ID: A2ISITE006393		Click to Show/Hide the Full List
mod site	chr14:61738949-61738950:+		[11]
Sequence	TGTGGAGTTGGGGTTCTCACTATGTTGCTCAGGCTGGTTTT
Transcript ID List	ENST00000555014.1; ENST00000555937.1; ENST00000539097.2; ENST00000337138.9; ENST00000394997.5; ENST00000557538.5; ENST00000323441.10
External Link	RMBase: RNA-editing_site_38853
mod ID: A2ISITE006394		Click to Show/Hide the Full List
mod site	chr14:61739036-61739037:+		[11]
Sequence	CTAGGATTACAGGCGTGAGCTACCATGCCTGGCCCATTACC
Transcript ID List	ENST00000539097.2; ENST00000337138.9; ENST00000557538.5; ENST00000555937.1; ENST00000323441.10; ENST00000555014.1; ENST00000394997.5
External Link	RMBase: RNA-editing_site_38854
mod ID: A2ISITE006395		Click to Show/Hide the Full List
mod site	chr14:61740873-61740874:+		[12]
Sequence	TCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTAC
Transcript ID List	ENST00000323441.10; ENST00000547430.2; ENST00000539097.2; ENST00000557538.5; ENST00000337138.9; ENST00000555014.1; ENST00000394997.5; ENST00000555937.1
External Link	RMBase: RNA-editing_site_38855
mod ID: A2ISITE006396		Click to Show/Hide the Full List
mod site	chr14:61743067-61743068:+		[12]
Sequence	ACAACACATCAAGTCACTTTAGCAATTTATTTTTGAGACGG
Transcript ID List	ENST00000323441.10; ENST00000394997.5; ENST00000337138.9; ENST00000557538.5; ENST00000555937.1; ENST00000539097.2
External Link	RMBase: RNA-editing_site_38856
mod ID: A2ISITE006397		Click to Show/Hide the Full List
mod site	chr14:61743243-61743244:+		[11]
Sequence	ACCACACCCAGCTAATTTTGTATTTTTAGTAGAGACAGTGT
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000555937.1; ENST00000323441.10; ENST00000557538.5; ENST00000539097.2
External Link	RMBase: RNA-editing_site_38857
mod ID: A2ISITE006400		Click to Show/Hide the Full List
mod site	chr14:61746541-61746542:+		[11]
Sequence	GCCTCCTGAGTAGCTCGCACTACAGACATGCCTCACCACAC
Transcript ID List	ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000555937.1; ENST00000337138.9; ENST00000539097.2; ENST00000556827.1
External Link	RMBase: RNA-editing_site_38860
mod ID: A2ISITE006401		Click to Show/Hide the Full List
mod site	chr14:61746593-61746594:+		[11]
Sequence	TTGTAGAGATGGGGTCTCACTATGTTGCCTAGGCTGGTTTC
Transcript ID List	ENST00000557538.5; ENST00000556827.1; ENST00000539097.2; ENST00000337138.9; ENST00000394997.5; ENST00000323441.10; ENST00000555937.1
External Link	RMBase: RNA-editing_site_38861
mod ID: A2ISITE006402		Click to Show/Hide the Full List
mod site	chr14:61746602-61746603:+		[11]
Sequence	TGGGGTCTCACTATGTTGCCTAGGCTGGTTTCAAACTCCTG
Transcript ID List	ENST00000556827.1; ENST00000555937.1; ENST00000337138.9; ENST00000539097.2; ENST00000557538.5; ENST00000323441.10; ENST00000394997.5
External Link	RMBase: RNA-editing_site_38862

5-methylcytidine (m5C)

In total 12 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000240		Click to Show/Hide the Full List
mod site	chr14:61737908-61737909:+
Sequence	TGGTGGTGTGCGCCTGTAATCCCAGCTACTTGGGAGGCTGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000539097.2; ENST00000323441.10; ENST00000557538.5; ENST00000555014.1; ENST00000555937.1; rmsk_4191479
External Link	RMBase: m5C_site_12915
mod ID: M5CSITE000241		Click to Show/Hide the Full List
mod site	chr14:61737909-61737910:+
Sequence	GGTGGTGTGCGCCTGTAATCCCAGCTACTTGGGAGGCTGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000394997.5; ENST00000323441.10; ENST00000557538.5; ENST00000539097.2; rmsk_4191479; ENST00000555014.1; ENST00000337138.9; ENST00000555937.1
External Link	RMBase: m5C_site_12916
mod ID: M5CSITE000242		Click to Show/Hide the Full List
mod site	chr14:61737910-61737911:+
Sequence	GTGGTGTGCGCCTGTAATCCCAGCTACTTGGGAGGCTGAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000394997.5; ENST00000557538.5; ENST00000555937.1; rmsk_4191479; ENST00000323441.10; ENST00000539097.2; ENST00000337138.9; ENST00000555014.1
External Link	RMBase: m5C_site_12917
mod ID: M5CSITE000243		Click to Show/Hide the Full List
mod site	chr14:61737913-61737914:+
Sequence	GTGTGCGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000323441.10; ENST00000555014.1; ENST00000555937.1; ENST00000557538.5; ENST00000394997.5; ENST00000539097.2; rmsk_4191479; ENST00000337138.9
External Link	RMBase: m5C_site_12918
mod ID: M5CSITE000244		Click to Show/Hide the Full List
mod site	chr14:61737916-61737917:+
Sequence	TGCGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000557538.5; ENST00000337138.9; ENST00000539097.2; ENST00000394997.5; rmsk_4191479; ENST00000555937.1; ENST00000555014.1; ENST00000323441.10
External Link	RMBase: m5C_site_12919
mod ID: M5CSITE000245		Click to Show/Hide the Full List
mod site	chr14:61737925-61737926:+
Sequence	AATCCCAGCTACTTGGGAGGCTGAGGCAGGGGAATTGCTTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000323441.10; ENST00000337138.9; ENST00000555014.1; rmsk_4191479; ENST00000539097.2; ENST00000557538.5; ENST00000394997.5; ENST00000555937.1
External Link	RMBase: m5C_site_12920
mod ID: M5CSITE000246		Click to Show/Hide the Full List
mod site	chr14:61737931-61737932:+
Sequence	AGCTACTTGGGAGGCTGAGGCAGGGGAATTGCTTGAACCTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000337138.9; ENST00000557538.5; ENST00000555014.1; ENST00000539097.2; ENST00000555937.1; ENST00000394997.5; ENST00000323441.10; rmsk_4191479
External Link	RMBase: m5C_site_12921
mod ID: M5CSITE000247		Click to Show/Hide the Full List
mod site	chr14:61737948-61737949:+
Sequence	AGGCAGGGGAATTGCTTGAACCTGGGAGGCAGAGGTTGCAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000394997.5; rmsk_4191479; ENST00000337138.9; ENST00000555014.1; ENST00000539097.2; ENST00000557538.5; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m5C_site_12922
mod ID: M5CSITE000248		Click to Show/Hide the Full List
mod site	chr14:61737957-61737958:+
Sequence	AATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCAAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555937.1; rmsk_4191479; ENST00000557538.5; ENST00000555014.1; ENST00000394997.5; ENST00000539097.2; ENST00000323441.10; ENST00000337138.9
External Link	RMBase: m5C_site_12923
mod ID: M5CSITE000249		Click to Show/Hide the Full List
mod site	chr14:61737966-61737967:+
Sequence	AACCTGGGAGGCAGAGGTTGCAGTGAGCCAAGATTGCGCCA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555937.1; ENST00000394997.5; ENST00000337138.9; ENST00000323441.10; ENST00000557538.5; ENST00000555014.1; rmsk_4191479; ENST00000539097.2
External Link	RMBase: m5C_site_12924
mod ID: M5CSITE000250		Click to Show/Hide the Full List
mod site	chr14:61737973-61737974:+
Sequence	GAGGCAGAGGTTGCAGTGAGCCAAGATTGCGCCATTGCACT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555014.1; ENST00000337138.9; ENST00000323441.10; ENST00000555937.1; ENST00000394997.5; ENST00000557538.5; rmsk_4191479; ENST00000539097.2
External Link	RMBase: m5C_site_12925
mod ID: M5CSITE000251		Click to Show/Hide the Full List
mod site	chr14:61737974-61737975:+
Sequence	AGGCAGAGGTTGCAGTGAGCCAAGATTGCGCCATTGCACTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_4191479; ENST00000555014.1; ENST00000539097.2; ENST00000394997.5; ENST00000557538.5; ENST00000323441.10; ENST00000337138.9; ENST00000555937.1
External Link	RMBase: m5C_site_12926

N6-methyladenosine (m6A)

In total 113 m6A sequence/site(s) in this target gene
mod ID: M6ASITE019927		Click to Show/Hide the Full List
mod site	chr14:61695540-61695541:+		[13]
Sequence	GTGCTGCCTCGTCTGAGGGGACAGGAGGATCACCCTCTTCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553999.5; ENST00000337138.9; ENST00000557446.5; ENST00000394997.5
External Link	RMBase: m6A_site_250380
mod ID: M6ASITE019928		Click to Show/Hide the Full List
mod site	chr14:61695593-61695594:+		[14]
Sequence	GTGTGTCGGGCTGGGCCCTGACAAGCCACCTGAGGAGAGGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000553999.5; ENST00000557446.5; ENST00000337138.9; ENST00000394997.5
External Link	RMBase: m6A_site_250381
mod ID: M6ASITE019929		Click to Show/Hide the Full List
mod site	chr14:61695630-61695631:+		[13]
Sequence	AGGCTCGGAGCCGGGCCCGGACCCCGGCGATTGCCGCCCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000553999.5; ENST00000557446.5
External Link	RMBase: m6A_site_250382
mod ID: M6ASITE019930		Click to Show/Hide the Full List
mod site	chr14:61695700-61695701:+		[13]
Sequence	CCTCGCACCCCCACCTCTGGACTTGCCTTTCCTTCTCTTCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; A549; LCLs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337138.9; ENST00000553999.5; ENST00000394997.5; ENST00000557446.5
External Link	RMBase: m6A_site_250383
mod ID: M6ASITE019931		Click to Show/Hide the Full List
mod site	chr14:61695782-61695783:+		[13]
Sequence	GGGGGCCGCCCGCCGTGAAGACATCGCGGGGACCGATTCAC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; A549; hESC-HEK293T; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000557446.5; ENST00000553999.5; ENST00000337138.9; ENST00000323441.10; ENST00000394997.5
External Link	RMBase: m6A_site_250384
mod ID: M6ASITE019932		Click to Show/Hide the Full List
mod site	chr14:61695793-61695794:+		[13]
Sequence	GCCGTGAAGACATCGCGGGGACCGATTCACCATGGAGGGCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000323441.10; ENST00000553999.5; ENST00000557446.5
External Link	RMBase: m6A_site_250385
mod ID: M6ASITE019933		Click to Show/Hide the Full List
mod site	chr14:61695829-61695830:+		[14]
Sequence	GGGCGCCGGCGGCGCGAACGACAAGAAAAAGTAAGCCCATT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000557446.5; ENST00000553999.5; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: m6A_site_250386
mod ID: M6ASITE019934		Click to Show/Hide the Full List
mod site	chr14:61697629-61697630:+		[13]
Sequence	CAAAATTTTCTCATTTGAAAACTTGGCAACCTTGGATTGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; A549; Jurkat; CD4T; GSC-11; iSLK; MSC; TIME; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557446.5; ENST00000553999.5; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000337138.9; ENST00000557538.5
External Link	RMBase: m6A_site_250387
mod ID: M6ASITE019935		Click to Show/Hide the Full List
mod site	chr14:61697705-61697706:+		[13]
Sequence	TAACTGAAAAATTAAGTTAAACACTTAATAAGTGGTGGTTA
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000394997.5; ENST00000557538.5; ENST00000323441.10; ENST00000557446.5; ENST00000539097.2; ENST00000553999.5; ENST00000337138.9
External Link	RMBase: m6A_site_250388
mod ID: M6ASITE019936		Click to Show/Hide the Full List
mod site	chr14:61720393-61720394:+		[15]
Sequence	TTAAGTAGGATAAGTTCTGAACGTCGAAAAGAAAAGTCTCG
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000539097.2; ENST00000557206.1; ENST00000323441.10; ENST00000394997.5; ENST00000557538.5; ENST00000557446.5; ENST00000553999.5; ENST00000337138.9
External Link	RMBase: m6A_site_250389
mod ID: M6ASITE019937		Click to Show/Hide the Full List
mod site	chr14:61720486-61720487:+		[14]
Sequence	GCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000553999.5; ENST00000557538.5; ENST00000539097.2; ENST00000337138.9; ENST00000557446.5; ENST00000394997.5; ENST00000557206.1
External Link	RMBase: m6A_site_250390
mod ID: M6ASITE019938		Click to Show/Hide the Full List
mod site	chr14:61720558-61720559:+		[13]
Sequence	AGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGTGAGTT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000557446.5; ENST00000557206.1; ENST00000323441.10; ENST00000539097.2; ENST00000394997.5; ENST00000337138.9; ENST00000553999.5
External Link	RMBase: m6A_site_250391
mod ID: M6ASITE019939		Click to Show/Hide the Full List
mod site	chr14:61721529-61721530:+		[14]
Sequence	TGATTTGGATATTGAAGATGACATGAAAGCACAGATGAATT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394997.5; ENST00000553999.5; ENST00000557538.5; ENST00000337138.9; ENST00000557206.1; ENST00000323441.10; ENST00000539097.2; ENST00000557446.5
External Link	RMBase: m6A_site_250392
mod ID: M6ASITE019940		Click to Show/Hide the Full List
mod site	chr14:61721591-61721592:+		[16]
Sequence	ATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATT
Motif Score	2.047297619
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000557446.5; ENST00000323441.10; ENST00000557206.1; ENST00000394997.5; ENST00000553999.5; ENST00000557538.5; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: m6A_site_250393
mod ID: M6ASITE019941		Click to Show/Hide the Full List
mod site	chr14:61721631-61721632:+		[13]
Sequence	TTACATTTCTGATAATGTGAACAAATACATGGGATTAACTC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394997.5; ENST00000557446.5; ENST00000323441.10; ENST00000557206.1; ENST00000337138.9; ENST00000557538.5; ENST00000553999.5; ENST00000539097.2
External Link	RMBase: m6A_site_250394
mod ID: M6ASITE019942		Click to Show/Hide the Full List
mod site	chr14:61721637-61721638:+		[15]
Sequence	TTCTGATAATGTGAACAAATACATGGGATTAACTCAGGTAA
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000394997.5; ENST00000539097.2; ENST00000553999.5; ENST00000557446.5; ENST00000337138.9; ENST00000557538.5; ENST00000323441.10; ENST00000557206.1
External Link	RMBase: m6A_site_250395
mod ID: M6ASITE019943		Click to Show/Hide the Full List
mod site	chr14:61721743-61721744:+		[13]
Sequence	AAAATGTGTTTACAGTTTGAACTAACTGGACACAGTGTGTT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000553999.5; ENST00000539097.2; ENST00000557206.1; ENST00000557538.5; ENST00000337138.9; ENST00000557446.5; ENST00000323441.10; ENST00000394997.5
External Link	RMBase: m6A_site_250396
mod ID: M6ASITE019944		Click to Show/Hide the Full List
mod site	chr14:61721752-61721753:+		[13]
Sequence	TTACAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000557446.5; ENST00000323441.10; ENST00000557538.5; ENST00000539097.2; ENST00000553999.5; ENST00000557206.1; ENST00000394997.5
External Link	RMBase: m6A_site_250397
mod ID: M6ASITE019945		Click to Show/Hide the Full List
mod site	chr14:61721784-61721785:+		[15]
Sequence	TGATTTTACTCATCCATGTGACCATGAGGAAATGAGAGAAA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000557538.5; ENST00000394997.5; ENST00000323441.10; ENST00000557206.1; ENST00000553999.5; ENST00000557446.5; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: m6A_site_250398
mod ID: M6ASITE019946		Click to Show/Hide the Full List
mod site	chr14:61721810-61721811:+		[14]
Sequence	AGGAAATGAGAGAAATGCTTACACACAGAAATGGTAAGAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000557446.5; ENST00000557538.5; ENST00000539097.2; ENST00000323441.10; ENST00000553999.5; ENST00000557206.1
External Link	RMBase: m6A_site_250399
mod ID: M6ASITE019947		Click to Show/Hide the Full List
mod site	chr14:61726682-61726683:+		[13]
Sequence	GTATATTTAGTTGCTTTAAAACTTTATTTCATGCTTTCATT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337138.9; ENST00000557206.1; ENST00000323441.10; ENST00000539097.2; ENST00000556237.1; ENST00000394997.5; ENST00000557538.5; ENST00000553999.5
External Link	RMBase: m6A_site_250400
mod ID: M6ASITE019948		Click to Show/Hide the Full List
mod site	chr14:61726727-61726728:+		[13]
Sequence	CTTGTGAAAAAGGGTAAAGAACAAAACACACAGCGAAGCTT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557206.1; ENST00000539097.2; ENST00000556237.1; ENST00000394997.5; ENST00000557538.5; ENST00000337138.9; ENST00000553999.5; ENST00000323441.10
External Link	RMBase: m6A_site_250401
mod ID: M6ASITE019949		Click to Show/Hide the Full List
mod site	chr14:61726732-61726733:+		[13]
Sequence	GAAAAAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557206.1; ENST00000337138.9; ENST00000539097.2; ENST00000557538.5; ENST00000394997.5; ENST00000323441.10; ENST00000553999.5; ENST00000556237.1
External Link	RMBase: m6A_site_250402
mod ID: M6ASITE019950		Click to Show/Hide the Full List
mod site	chr14:61726788-61726789:+		[13]
Sequence	CCCTAACTAGCCGAGGAAGAACTATGAACATAAAGTCTGCA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337138.9; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000557206.1; ENST00000557538.5; ENST00000556237.1
External Link	RMBase: m6A_site_250403
mod ID: M6ASITE019951		Click to Show/Hide the Full List
mod site	chr14:61726795-61726796:+		[13]
Sequence	TAGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000557206.1; ENST00000337138.9; ENST00000394997.5; ENST00000556237.1; ENST00000557538.5; ENST00000539097.2
External Link	RMBase: m6A_site_250404
mod ID: M6ASITE019952		Click to Show/Hide the Full List
mod site	chr14:61727523-61727524:+		[13]
Sequence	CCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000337138.9; ENST00000556237.1; ENST00000557206.1; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250405
mod ID: M6ASITE019953		Click to Show/Hide the Full List
mod site	chr14:61727556-61727557:+		[13]
Sequence	TGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394997.5; ENST00000539097.2; ENST00000557206.1; ENST00000323441.10; ENST00000557538.5; ENST00000337138.9; ENST00000556237.1
External Link	RMBase: m6A_site_250406
mod ID: M6ASITE019954		Click to Show/Hide the Full List
mod site	chr14:61727602-61727603:+		[13]
Sequence	AAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000394997.5; ENST00000556237.1; ENST00000323441.10; ENST00000557206.1; ENST00000539097.2; ENST00000557538.5; ENST00000337138.9
External Link	RMBase: m6A_site_250407
mod ID: M6ASITE019955		Click to Show/Hide the Full List
mod site	chr14:61727616-61727617:+		[15]
Sequence	AGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATT
Motif Score	2.865571429
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000539097.2; ENST00000557538.5; ENST00000556237.1; ENST00000323441.10; ENST00000557206.1
External Link	RMBase: m6A_site_250408
mod ID: M6ASITE019956		Click to Show/Hide the Full List
mod site	chr14:61732450-61732451:+		[13]
Sequence	ATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000539097.2; ENST00000394997.5; ENST00000557538.5; ENST00000337138.9; ENST00000323441.10
External Link	RMBase: m6A_site_250409
mod ID: M6ASITE019957		Click to Show/Hide the Full List
mod site	chr14:61732491-61732492:+		[13]
Sequence	TGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000394997.5; ENST00000539097.2; ENST00000337138.9; ENST00000557538.5; ENST00000323441.10
External Link	RMBase: m6A_site_250410
mod ID: M6ASITE019958		Click to Show/Hide the Full List
mod site	chr14:61732511-61732512:+		[13]
Sequence	ACTCTGATCATCTGACCAAAACTCATCATGATAGTAAGTAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000394997.5; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: m6A_site_250411
mod ID: M6ASITE019959		Click to Show/Hide the Full List
mod site	chr14:61734150-61734151:+		[13]
Sequence	CCCCTAGTGTTTACTAAAGGACAAGTCACCACAGGACAGTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000555937.1; ENST00000539097.2; ENST00000557538.5; ENST00000394997.5; rmsk_4191473; ENST00000323441.10
External Link	RMBase: m6A_site_250412
mod ID: M6ASITE019960		Click to Show/Hide the Full List
mod site	chr14:61734165-61734166:+		[13]
Sequence	AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000555937.1; ENST00000337138.9; ENST00000539097.2; rmsk_4191473
External Link	RMBase: m6A_site_250413
mod ID: M6ASITE019961		Click to Show/Hide the Full List
mod site	chr14:61734211-61734212:+		[13]
Sequence	GTGGATATGTCTGGGTTGAAACTCAAGCAACTGTCATATAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000555937.1; ENST00000337138.9; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250414
mod ID: M6ASITE019962		Click to Show/Hide the Full List
mod site	chr14:61734233-61734234:+		[14]
Sequence	TCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCAC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394997.5; ENST00000555937.1; ENST00000539097.2; ENST00000337138.9; ENST00000557538.5; ENST00000323441.10
External Link	RMBase: m6A_site_250415
mod ID: M6ASITE019963		Click to Show/Hide the Full List
mod site	chr14:61736924-61736925:+		[15]
Sequence	GACTTGATTTTCTCCCTTCAACAAACAGAATGTGTCCTTAA
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000555937.1; ENST00000337138.9; ENST00000555014.1; ENST00000539097.2; ENST00000394997.5; ENST00000557538.5; ENST00000323441.10
External Link	RMBase: m6A_site_250416
mod ID: M6ASITE019964		Click to Show/Hide the Full List
mod site	chr14:61736928-61736929:+		[13]
Sequence	TGATTTTCTCCCTTCAACAAACAGAATGTGTCCTTAAACCG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000539097.2; ENST00000323441.10; ENST00000337138.9; ENST00000557538.5; ENST00000555937.1; ENST00000555014.1; ENST00000394997.5
External Link	RMBase: m6A_site_250417
mod ID: M6ASITE019965		Click to Show/Hide the Full List
mod site	chr14:61736945-61736946:+		[13]
Sequence	CAAACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337138.9; ENST00000323441.10; ENST00000539097.2; ENST00000394997.5; ENST00000557538.5; ENST00000555014.1; ENST00000555937.1
External Link	RMBase: m6A_site_250418
mod ID: M6ASITE019966		Click to Show/Hide the Full List
mod site	chr14:61736985-61736986:+		[15]
Sequence	TGAAAATGACTCAGCTATTCACCAAAGTTGAATCAGAAGAT
Motif Score	2.026654762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337138.9; ENST00000555014.1; ENST00000555937.1; ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250419
mod ID: M6ASITE019967		Click to Show/Hide the Full List
mod site	chr14:61737006-61737007:+		[14]
Sequence	CCAAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000337138.9; ENST00000555014.1; ENST00000394997.5; ENST00000557538.5; ENST00000555937.1; ENST00000539097.2
External Link	RMBase: m6A_site_250420
mod ID: M6ASITE019968		Click to Show/Hide the Full List
mod site	chr14:61737022-61737023:+		[14]
Sequence	AGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555014.1; ENST00000557538.5; ENST00000555937.1; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: m6A_site_250421
mod ID: M6ASITE019969		Click to Show/Hide the Full List
mod site	chr14:61737026-61737027:+		[13]
Sequence	ACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000539097.2; ENST00000555014.1; ENST00000394997.5; ENST00000337138.9; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250422
mod ID: M6ASITE019970		Click to Show/Hide the Full List
mod site	chr14:61737038-61737039:+		[13]
Sequence	TTTGACAAACTTAAGAAGGAACCTGATGCTTTAACTTTGCT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000555014.1; ENST00000323441.10; ENST00000539097.2; ENST00000555937.1; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: m6A_site_250423
mod ID: M6ASITE019971		Click to Show/Hide the Full List
mod site	chr14:61737076-61737077:+		[13]
Sequence	GCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000539097.2; ENST00000337138.9; ENST00000323441.10; ENST00000555014.1; ENST00000555937.1; ENST00000394997.5; ENST00000557538.5
External Link	RMBase: m6A_site_250424
mod ID: M6ASITE019972		Click to Show/Hide the Full List
mod site	chr14:61738086-61738087:+		[14]
Sequence	CTCATATTTTTTCCCCACAGACACAGAAACTGATGACCAGC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555014.1; ENST00000323441.10; ENST00000555937.1; ENST00000557538.5; ENST00000394997.5; ENST00000539097.2; ENST00000337138.9
External Link	RMBase: m6A_site_250425
mod ID: M6ASITE019973		Click to Show/Hide the Full List
mod site	chr14:61738094-61738095:+		[13]
Sequence	TTTTCCCCACAGACACAGAAACTGATGACCAGCAACTTGAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000555937.1; ENST00000539097.2; ENST00000394997.5; ENST00000337138.9; ENST00000555014.1
External Link	RMBase: m6A_site_250426
mod ID: M6ASITE019974		Click to Show/Hide the Full List
mod site	chr14:61738208-61738209:+		[15]
Sequence	CTCCATTACCCACCGCTGAAACGCCAAAGCCACTTCGAAGT
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000323441.10; ENST00000539097.2; ENST00000555937.1; ENST00000557538.5; ENST00000555014.1
External Link	RMBase: m6A_site_250427
mod ID: M6ASITE019975		Click to Show/Hide the Full List
mod site	chr14:61738236-61738237:+		[15]
Sequence	GCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAG
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000539097.2; ENST00000394997.5; ENST00000323441.10; ENST00000555014.1; ENST00000337138.9; ENST00000555937.1; ENST00000557538.5
External Link	RMBase: m6A_site_250428
mod ID: M6ASITE019976		Click to Show/Hide the Full List
mod site	chr14:61738273-61738274:+		[13]
Sequence	GAAGTTGCATTAAAATTAGAACCAAATCCAGAGTCACTGGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539097.2; ENST00000323441.10; ENST00000557538.5; ENST00000394997.5; ENST00000337138.9; ENST00000555014.1; ENST00000555937.1
External Link	RMBase: m6A_site_250429
mod ID: M6ASITE019977		Click to Show/Hide the Full List
mod site	chr14:61738294-61738295:+		[13]
Sequence	CCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555937.1; ENST00000323441.10; ENST00000539097.2; ENST00000555014.1; ENST00000394997.5; ENST00000557538.5; ENST00000337138.9
External Link	RMBase: m6A_site_250430
mod ID: M6ASITE019978		Click to Show/Hide the Full List
mod site	chr14:61738328-61738329:+		[13]
Sequence	TGCCCCAGATTCAGGATCAGACACCTAGTCCTTCCGATGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000323441.10; ENST00000539097.2; ENST00000555014.1; ENST00000337138.9; ENST00000555937.1; ENST00000394997.5; ENST00000557538.5
External Link	RMBase: m6A_site_250431
mod ID: M6ASITE019979		Click to Show/Hide the Full List
mod site	chr14:61738357-61738358:+		[13]
Sequence	CCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGGTAGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; kidney; hESC-HEK293T
Seq Type List	m6A-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000539097.2; ENST00000557538.5; ENST00000337138.9; ENST00000555937.1; ENST00000555014.1; ENST00000394997.5; ENST00000323441.10
External Link	RMBase: m6A_site_250432
mod ID: M6ASITE019980		Click to Show/Hide the Full List
mod site	chr14:61740581-61740582:+		[13]
Sequence	AAGTTGGAATTGGTAGAAAAACTTTTTGCTGAAGACACAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000539097.2; ENST00000555937.1; ENST00000557538.5; ENST00000555014.1; ENST00000394997.5; ENST00000323441.10; ENST00000547430.2; ENST00000337138.9
External Link	RMBase: m6A_site_250433
mod ID: M6ASITE019981		Click to Show/Hide the Full List
mod site	chr14:61740595-61740596:+		[13]
Sequence	AGAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000557538.5; ENST00000555014.1; ENST00000539097.2; ENST00000323441.10; ENST00000555937.1; ENST00000394997.5; ENST00000547430.2; ENST00000337138.9
External Link	RMBase: m6A_site_250434
mod ID: M6ASITE019982		Click to Show/Hide the Full List
mod site	chr14:61740610-61740611:+		[13]
Sequence	TGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGTAT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337138.9; ENST00000557538.5; ENST00000547430.2; ENST00000539097.2; ENST00000555014.1; ENST00000394997.5; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250435
mod ID: M6ASITE019983		Click to Show/Hide the Full List
mod site	chr14:61740767-61740768:+		[13]
Sequence	TTTAAAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337138.9; ENST00000547430.2; ENST00000555014.1; ENST00000555937.1; ENST00000557538.5; ENST00000323441.10; ENST00000539097.2; ENST00000394997.5
External Link	RMBase: m6A_site_250436
mod ID: M6ASITE019984		Click to Show/Hide the Full List
mod site	chr14:61740907-61740908:+		[13]
Sequence	CAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000323441.10; ENST00000555014.1; ENST00000394997.5; ENST00000557538.5; ENST00000539097.2; ENST00000337138.9; ENST00000555937.1
External Link	RMBase: m6A_site_250437
mod ID: M6ASITE019985		Click to Show/Hide the Full List
mod site	chr14:61740915-61740916:+		[14]
Sequence	GTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555014.1; ENST00000555937.1; ENST00000323441.10; ENST00000394997.5; ENST00000539097.2; ENST00000337138.9; ENST00000557538.5
External Link	RMBase: m6A_site_250438
mod ID: M6ASITE019986		Click to Show/Hide the Full List
mod site	chr14:61740921-61740922:+		[13]
Sequence	CAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555937.1; ENST00000555014.1; ENST00000557538.5; ENST00000539097.2; ENST00000394997.5; ENST00000337138.9; ENST00000323441.10
External Link	RMBase: m6A_site_250439
mod ID: M6ASITE019987		Click to Show/Hide the Full List
mod site	chr14:61740970-61740971:+		[13]
Sequence	CCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; brain; kidney; hESC-HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; Huh7; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000555014.1; ENST00000557538.5; ENST00000337138.9; ENST00000323441.10; ENST00000394997.5; ENST00000555937.1; ENST00000539097.2
External Link	RMBase: m6A_site_250440
mod ID: M6ASITE019988		Click to Show/Hide the Full List
mod site	chr14:61740976-61740977:+		[14]
Sequence	CTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394997.5; ENST00000555937.1; ENST00000323441.10; ENST00000337138.9; ENST00000557538.5; ENST00000539097.2; ENST00000555014.1
External Link	RMBase: m6A_site_250441
mod ID: M6ASITE019989		Click to Show/Hide the Full List
mod site	chr14:61740983-61740984:+		[13]
Sequence	ATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; hNPCs; hESCs; fibroblasts; LCLs; Huh7; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337138.9; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000555014.1; ENST00000555937.1; ENST00000557538.5
External Link	RMBase: m6A_site_250442
mod ID: M6ASITE019990		Click to Show/Hide the Full List
mod site	chr14:61740995-61740996:+		[13]
Sequence	GACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; hNPCs; hESCs; fibroblasts; LCLs; Huh7; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000337138.9; ENST00000555937.1; ENST00000394997.5; ENST00000555014.1; ENST00000557538.5; ENST00000539097.2
External Link	RMBase: m6A_site_250443
mod ID: M6ASITE019991		Click to Show/Hide the Full List
mod site	chr14:61741045-61741046:+		[13]
Sequence	CTACCCACATACATAAAGAAACTACTAGTGCCACATCATCA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; hNPCs; hESCs; fibroblasts; LCLs; H1299; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000539097.2; ENST00000323441.10; ENST00000555937.1; ENST00000394997.5; ENST00000337138.9; ENST00000557538.5; ENST00000555014.1
External Link	RMBase: m6A_site_250444
mod ID: M6ASITE019992		Click to Show/Hide the Full List
mod site	chr14:61741090-61741091:+		[13]
Sequence	ATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; hNPCs; hESCs; fibroblasts; LCLs; H1299; Huh7; MSC; TIME; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000337138.9; ENST00000323441.10; ENST00000557538.5; ENST00000555937.1; ENST00000555014.1; ENST00000539097.2; ENST00000394997.5
External Link	RMBase: m6A_site_250445
mod ID: M6ASITE019993		Click to Show/Hide the Full List
mod site	chr14:61741103-61741104:+		[13]
Sequence	AAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; kidney; A549; hNPCs; hESCs; fibroblasts; LCLs; H1299; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000555014.1; ENST00000337138.9; ENST00000323441.10; ENST00000394997.5; ENST00000555937.1; ENST00000539097.2; ENST00000557538.5
External Link	RMBase: m6A_site_250446
mod ID: M6ASITE019994		Click to Show/Hide the Full List
mod site	chr14:61741128-61741129:+		[13]
Sequence	GCAGGAAAAGGAGTCATAGAACAGACAGAAAAATCTCATCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; hNPCs; hESCs; fibroblasts; LCLs; H1299; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000555014.1; ENST00000557538.5; ENST00000323441.10; ENST00000555937.1; ENST00000394997.5; ENST00000539097.2; ENST00000337138.9
External Link	RMBase: m6A_site_250447
mod ID: M6ASITE019995		Click to Show/Hide the Full List
mod site	chr14:61741132-61741133:+		[15]
Sequence	GAAAAGGAGTCATAGAACAGACAGAAAAATCTCATCCAAGA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; BGC823
Seq Type List	DART-seq; m6A-seq
Transcript ID List	ENST00000323441.10; ENST00000555937.1; ENST00000337138.9; ENST00000539097.2; ENST00000555014.1; ENST00000394997.5; ENST00000557538.5
External Link	RMBase: m6A_site_250448
mod ID: M6ASITE019996		Click to Show/Hide the Full List
mod site	chr14:61741160-61741161:+		[15]
Sequence	ATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGA
Motif Score	2.142029762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337138.9; ENST00000557538.5; ENST00000394997.5; ENST00000555937.1; ENST00000555014.1; ENST00000323441.10; ENST00000539097.2
External Link	RMBase: m6A_site_250449
mod ID: M6ASITE019997		Click to Show/Hide the Full List
mod site	chr14:61744725-61744726:+		[13]
Sequence	ACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; BGC823; HepG2; hNPCs; LCLs; H1299; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000337138.9; ENST00000555937.1; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250450
mod ID: M6ASITE019998		Click to Show/Hide the Full List
mod site	chr14:61744779-61744780:+		[13]
Sequence	CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; BGC823; HepG2; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000394997.5; ENST00000539097.2; ENST00000555937.1; ENST00000557538.5; ENST00000323441.10; ENST00000337138.9
External Link	RMBase: m6A_site_250451
mod ID: M6ASITE019999		Click to Show/Hide the Full List
mod site	chr14:61745659-61745660:+		[13]
Sequence	TTAAAAAAAAAATTCAACAAACTAAACTTGAAATAACTTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337138.9; ENST00000556827.1; ENST00000394997.5; ENST00000539097.2; ENST00000555937.1; ENST00000323441.10; ENST00000557538.5
External Link	RMBase: m6A_site_250452
mod ID: M6ASITE020000		Click to Show/Hide the Full List
mod site	chr14:61745664-61745665:+		[13]
Sequence	AAAAAAATTCAACAAACTAAACTTGAAATAACTTTACTGTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000394997.5; ENST00000556827.1; ENST00000555937.1; ENST00000323441.10; ENST00000539097.2; ENST00000337138.9; ENST00000557538.5
External Link	RMBase: m6A_site_250453
mod ID: M6ASITE020001		Click to Show/Hide the Full List
mod site	chr14:61745693-61745694:+		[13]
Sequence	AACTTTACTGTTTATAGGGAACATTATTACAGCAGCCAGAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557538.5; ENST00000539097.2; ENST00000556827.1; ENST00000394997.5; ENST00000323441.10; ENST00000555937.1; ENST00000337138.9
External Link	RMBase: m6A_site_250454
mod ID: M6ASITE020002		Click to Show/Hide the Full List
mod site	chr14:61745729-61745730:+		[14]
Sequence	CAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000539097.2; ENST00000394997.5; ENST00000323441.10; ENST00000557538.5; ENST00000337138.9; ENST00000556827.1; ENST00000555937.1
External Link	RMBase: m6A_site_250455
mod ID: M6ASITE020003		Click to Show/Hide the Full List
mod site	chr14:61745734-61745735:+		[15]
Sequence	GATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555937.1; ENST00000557538.5; ENST00000394997.5; ENST00000337138.9; ENST00000556827.1; ENST00000323441.10; ENST00000539097.2
External Link	RMBase: m6A_site_250456
mod ID: M6ASITE020004		Click to Show/Hide the Full List
mod site	chr14:61745773-61745774:+		[13]
Sequence	AAAGGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; HepG2
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000555937.1; ENST00000323441.10; ENST00000557538.5; ENST00000394997.5; ENST00000539097.2; ENST00000556827.1; ENST00000337138.9
External Link	RMBase: m6A_site_250457
mod ID: M6ASITE020005		Click to Show/Hide the Full List
mod site	chr14:61745795-61745796:+		[13]
Sequence	AGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000557538.5; ENST00000337138.9; ENST00000539097.2; ENST00000323441.10; ENST00000555937.1; ENST00000556827.1; ENST00000394997.5
External Link	RMBase: m6A_site_250458
mod ID: M6ASITE020006		Click to Show/Hide the Full List
mod site	chr14:61746946-61746947:+		[13]
Sequence	TTTTCAGATTTAGCATGTAGACTGCTGGGGCAATCAATGGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000557538.5; ENST00000556827.1; ENST00000555937.1; ENST00000323441.10; ENST00000539097.2
External Link	RMBase: m6A_site_250459
mod ID: M6ASITE020007		Click to Show/Hide the Full List
mod site	chr14:61747021-61747022:+		[15]
Sequence	TGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACT
Motif Score	2.110482143
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000557538.5; ENST00000394997.5; ENST00000539097.2; ENST00000556827.1; ENST00000337138.9; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250460
mod ID: M6ASITE020008		Click to Show/Hide the Full List
mod site	chr14:61747035-61747036:+		[13]
Sequence	TCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAAGAAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000556827.1; ENST00000555937.1; ENST00000539097.2; ENST00000337138.9; ENST00000394997.5; ENST00000323441.10
External Link	RMBase: m6A_site_250461
mod ID: M6ASITE020009		Click to Show/Hide the Full List
mod site	chr14:61747115-61747116:+		[13]
Sequence	AATTTCATTCCTTTTTTTGGACACTGGTGGCTCATTACCTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000555937.1; ENST00000337138.9; ENST00000557538.5; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000556827.1
External Link	RMBase: m6A_site_250462
mod ID: M6ASITE020010		Click to Show/Hide the Full List
mod site	chr14:61747158-61747159:+		[15]
Sequence	GCAGTCTATTTATATTTTCTACATCTAATTTTAGAAGCCTG
Motif Score	2.078666667
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000556827.1; ENST00000323441.10; ENST00000557538.5; ENST00000555937.1; ENST00000394997.5; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: m6A_site_250463
mod ID: M6ASITE020011		Click to Show/Hide the Full List
mod site	chr14:61747182-61747183:+		[16]
Sequence	CTAATTTTAGAAGCCTGGCTACAATACTGCACAAACTTGGT
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000394997.5; ENST00000539097.2; ENST00000556827.1; ENST00000557538.5; ENST00000337138.9; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250464
mod ID: M6ASITE020012		Click to Show/Hide the Full List
mod site	chr14:61747187-61747188:+		[15]
Sequence	TTTAGAAGCCTGGCTACAATACTGCACAAACTTGGTTAGTT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000556827.1; ENST00000555937.1; ENST00000539097.2; ENST00000323441.10; ENST00000557538.5
External Link	RMBase: m6A_site_250465
mod ID: M6ASITE020013		Click to Show/Hide the Full List
mod site	chr14:61747192-61747193:+		[15]
Sequence	AAGCCTGGCTACAATACTGCACAAACTTGGTTAGTTCAATT
Motif Score	2.830589286
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000555937.1; ENST00000556827.1; ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250466
mod ID: M6ASITE020014		Click to Show/Hide the Full List
mod site	chr14:61747196-61747197:+		[13]
Sequence	CTGGCTACAATACTGCACAAACTTGGTTAGTTCAATTTTGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000539097.2; ENST00000394997.5; ENST00000323441.10; ENST00000337138.9; ENST00000557538.5; ENST00000555937.1; ENST00000556827.1
External Link	RMBase: m6A_site_250467
mod ID: M6ASITE020015		Click to Show/Hide the Full List
mod site	chr14:61747227-61747228:+		[15]
Sequence	TCAATTTTGATCCCCTTTCTACTTAATTTACATTAATGCTC
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000323441.10; ENST00000337138.9; ENST00000556827.1; ENST00000557538.5; ENST00000539097.2; ENST00000394997.5; ENST00000555937.1
External Link	RMBase: m6A_site_250468
mod ID: M6ASITE020016		Click to Show/Hide the Full List
mod site	chr14:61747236-61747237:+		[15]
Sequence	ATCCCCTTTCTACTTAATTTACATTAATGCTCTTTTTTAGT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000539097.2; ENST00000555937.1; ENST00000323441.10; ENST00000557538.5; ENST00000556827.1
External Link	RMBase: m6A_site_250469
mod ID: M6ASITE020017		Click to Show/Hide the Full List
mod site	chr14:61747277-61747278:+		[15]
Sequence	ATGTTCTTTAATGCTGGATCACAGACAGCTCATTTTCTCAG
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000323441.10; ENST00000394997.5; ENST00000337138.9; ENST00000539097.2; ENST00000557538.5; ENST00000556827.1; ENST00000555937.1
External Link	RMBase: m6A_site_250470
mod ID: M6ASITE020018		Click to Show/Hide the Full List
mod site	chr14:61747281-61747282:+		[13]
Sequence	TCTTTAATGCTGGATCACAGACAGCTCATTTTCTCAGTTTT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000555937.1; ENST00000556827.1; ENST00000539097.2; ENST00000323441.10; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: m6A_site_250471
mod ID: M6ASITE020019		Click to Show/Hide the Full List
mod site	chr14:61747313-61747314:+		[13]
Sequence	CTCAGTTTTTTGGTATTTAAACCATTGCATTGCAGTAGCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000539097.2; ENST00000555937.1; ENST00000337138.9; ENST00000556827.1; ENST00000323441.10; ENST00000394997.5
External Link	RMBase: m6A_site_250472
mod ID: M6ASITE020020		Click to Show/Hide the Full List
mod site	chr14:61747480-61747481:+		[14]
Sequence	TAGGCAGTTGAAAAATTTTTACACCTTTTTTTTCACATTTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000539097.2; ENST00000394997.5; ENST00000557538.5; ENST00000337138.9; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250473
mod ID: M6ASITE020021		Click to Show/Hide the Full List
mod site	chr14:61747501-61747502:+		[15]
Sequence	CACCTTTTTTTTCACATTTTACATAAATAATAATGCTTTGC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000557538.5; ENST00000323441.10; ENST00000539097.2; ENST00000337138.9; ENST00000555937.1; ENST00000394997.5
External Link	RMBase: m6A_site_250474
mod ID: M6ASITE020022		Click to Show/Hide the Full List
mod site	chr14:61747529-61747530:+		[15]
Sequence	AATAATGCTTTGCCAGCAGTACGTGGTAGCCACAATTGCAC
Motif Score	2.830077381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000394997.5; ENST00000323441.10; ENST00000539097.2; ENST00000557538.5; ENST00000555937.1; ENST00000337138.9
External Link	RMBase: m6A_site_250475
mod ID: M6ASITE020023		Click to Show/Hide the Full List
mod site	chr14:61747548-61747549:+		[14]
Sequence	TACGTGGTAGCCACAATTGCACAATATATTTTCTTAAAAAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000557538.5; ENST00000394997.5; ENST00000555937.1; ENST00000539097.2; ENST00000337138.9
External Link	RMBase: m6A_site_250476
mod ID: M6ASITE020024		Click to Show/Hide the Full List
mod site	chr14:61747580-61747581:+		[15]
Sequence	CTTAAAAAATACCAGCAGTTACTCATGGAATATATTCTGCG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337138.9; ENST00000394997.5; ENST00000555937.1; ENST00000323441.10; ENST00000557538.5; ENST00000539097.2
External Link	RMBase: m6A_site_250477
mod ID: M6ASITE020025		Click to Show/Hide the Full List
mod site	chr14:61747609-61747610:+		[13]
Sequence	ATATATTCTGCGTTTATAAAACTAGTTTTTAAGAAGAAATT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000557538.5; ENST00000555937.1; ENST00000323441.10; ENST00000539097.2; ENST00000394997.5; ENST00000337138.9
External Link	RMBase: m6A_site_250478
mod ID: M6ASITE020026		Click to Show/Hide the Full List
mod site	chr14:61747654-61747655:+		[13]
Sequence	TTGGCCTATGAAATTGTTAAACCTGGAACATGACATTGTTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000557538.5; ENST00000555937.1; ENST00000394997.5; ENST00000337138.9; ENST00000323441.10; ENST00000539097.2
External Link	RMBase: m6A_site_250479
mod ID: M6ASITE020027		Click to Show/Hide the Full List
mod site	chr14:61747661-61747662:+		[13]
Sequence	ATGAAATTGTTAAACCTGGAACATGACATTGTTAATCATAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000555937.1; ENST00000337138.9; ENST00000323441.10; ENST00000394997.5; ENST00000557538.5; ENST00000539097.2
External Link	RMBase: m6A_site_250480
mod ID: M6ASITE020028		Click to Show/Hide the Full List
mod site	chr14:61747666-61747667:+		[15]
Sequence	ATTGTTAAACCTGGAACATGACATTGTTAATCATATAATAA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000555937.1; ENST00000557538.5; ENST00000337138.9; ENST00000394997.5; ENST00000539097.2
External Link	RMBase: m6A_site_250481
mod ID: M6ASITE020029		Click to Show/Hide the Full List
mod site	chr14:61747736-61747737:+		[14]
Sequence	TTAAATGGGTAAAGCCATTTACATAATATAGAAAGATATGC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000539097.2; ENST00000557538.5; ENST00000323441.10; ENST00000394997.5; ENST00000555937.1
External Link	RMBase: m6A_site_250482
mod ID: M6ASITE020030		Click to Show/Hide the Full List
mod site	chr14:61747854-61747855:+		[13]
Sequence	CTTTGCCAGCTCAAAAGAAAACAATACCCTATGTAGTTGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000555937.1; ENST00000394997.5; ENST00000323441.10; ENST00000539097.2
External Link	RMBase: m6A_site_250483
mod ID: M6ASITE020031		Click to Show/Hide the Full List
mod site	chr14:61747898-61747899:+		[15]
Sequence	GTTTATGCTAATATTGTGTAACTGATATTAAACCTAAATGT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000539097.2; ENST00000337138.9; ENST00000394997.5; ENST00000555937.1; ENST00000323441.10
External Link	RMBase: m6A_site_250484
mod ID: M6ASITE020032		Click to Show/Hide the Full List
mod site	chr14:61747909-61747910:+		[13]
Sequence	TATTGTGTAACTGATATTAAACCTAAATGTTCTGCCTACCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000539097.2; ENST00000555937.1; ENST00000394997.5; ENST00000337138.9; ENST00000323441.10
External Link	RMBase: m6A_site_250485
mod ID: M6ASITE020033		Click to Show/Hide the Full List
mod site	chr14:61747956-61747957:+		[13]
Sequence	TATAAAGATATTTTGAGCAGACTGTAAACAAGAAAAAAAAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000323441.10; ENST00000394997.5; ENST00000555937.1; ENST00000337138.9; ENST00000539097.2
External Link	RMBase: m6A_site_250486
mod ID: M6ASITE020034		Click to Show/Hide the Full List
mod site	chr14:61747963-61747964:+		[13]
Sequence	ATATTTTGAGCAGACTGTAAACAAGAAAAAAAAAATCATGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000337138.9; ENST00000323441.10; ENST00000394997.5; ENST00000539097.2; ENST00000555937.1
External Link	RMBase: m6A_site_250487
mod ID: M6ASITE020035		Click to Show/Hide the Full List
mod site	chr14:61748025-61748026:+		[14]
Sequence	TATGTTAATTTGCTCAAAATACAATGTTTGATTTTATGCAC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000337138.9; ENST00000539097.2; ENST00000555937.1; ENST00000394997.5
External Link	RMBase: m6A_site_250488
mod ID: M6ASITE020036		Click to Show/Hide the Full List
mod site	chr14:61748044-61748045:+		[15]
Sequence	TACAATGTTTGATTTTATGCACTTTGTCGCTATTAACATCC
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000394997.5; ENST00000337138.9; ENST00000323441.10; ENST00000555937.1; ENST00000539097.2
External Link	RMBase: m6A_site_250489
mod ID: M6ASITE020037		Click to Show/Hide the Full List
mod site	chr14:61748059-61748060:+		[15]
Sequence	TATGCACTTTGTCGCTATTAACATCCTTTTTTTCATGTAGA
Motif Score	2.168095238
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000323441.10; ENST00000539097.2; ENST00000337138.9; ENST00000555937.1; ENST00000394997.5
External Link	RMBase: m6A_site_250490
mod ID: M6ASITE020038		Click to Show/Hide the Full List
mod site	chr14:61748239-61748240:+		[17]
Sequence	TGTTTTGTTACATCAAATAAACATCTTCTGTGGACCAGGCC
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000555937.1; ENST00000539097.2; ENST00000337138.9; ENST00000323441.10; ENST00000394997.5
External Link	RMBase: m6A_site_250491
mod ID: M6ASITE020039		Click to Show/Hide the Full List
mod site	chr14:61748252-61748253:+		[17]
Sequence	CAAATAAACATCTTCTGTGGACCAGGCCCCTTTGATCAGCT
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000323441.10; ENST00000555937.1; ENST00000394997.5; ENST00000539097.2; ENST00000337138.9
External Link	RMBase: m6A_site_250492

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000087		Click to Show/Hide the Full List
mod site	chr14:61732513-61732514:+		[18]
Sequence	TCTGATCATCTGACCAAAACTCATCATGATAGTAAGTACAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000394997.5; ENST00000557538.5; ENST00000323441.10; ENST00000539097.2; ENST00000337138.9
External Link	RMBase: Nm_site_1761

Ref 1	HBXIP drives metabolic reprogramming in hepatocellular carcinoma cells via METTL3-mediated m6A modification of HIF-1Alpha. J Cell Physiol. 2021 May;236(5):3863-3880. doi: 10.1002/jcp.30128. Epub 2020 Dec 11.
Ref 2	Local delivery of c-myc neutrally charged antisense oligonucleotides with transport catheter inhibits myointimal hyperplasia and positively affects vascular remodeling in the rabbit balloon injury model. Catheter Cardiovasc Interv. 2001 Oct;54(2):247-56. doi: 10.1002/ccd.1277.
Ref 3	Cytochromes P450 in crustacea. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998 Nov;121(1-3):157-72. doi: 10.1016/s0742-8413(98)10036-1.
Ref 4	Knockdown of m6A Reader IGF2BP3 Inhibited Hypoxia-Induced Cell Migration and Angiogenesis by Regulating Hypoxia Inducible Factor-1Alpha in Stomach Cancer. Front Oncol. 2021 Sep 21;11:711207. doi: 10.3389/fonc.2021.711207. eCollection 2021.
Ref 5	Drug-drug Interaction between Losartan and Paclitaxel in Human Liver Microsomes with Different CYP2C8 Genotypes. Basic Clin Pharmacol Toxicol. 2015 Jun;116(6):493-8. doi: 10.1111/bcpt.12355. Epub 2014 Dec 23.
Ref 6	Clinical pipeline report, company report or official report of Amgen.
Ref 7	UCN-01: a potent abrogator of G2 checkpoint function in cancer cells with disrupted p53. J Natl Cancer Inst. 1996 Jul 17;88(14):956-65. doi: 10.1093/jnci/88.14.956.
Ref 8	Health implications of high dietary omega-6 polyunsaturated Fatty acids. J Nutr Metab. 2012;2012:539426. doi: 10.1155/2012/539426. Epub 2012 Apr 5.
Ref 9	RNA helicase YTHDC2 promotes cancer metastasis via the enhancement of the efficiency by which HIF-1Alpha mRNA is translated. Cancer Lett. 2016 Jun 28;376(1):34-42. doi: 10.1016/j.canlet.2016.02.022. Epub 2016 Mar 17.
Ref 10	Widespread RNA editing of embedded alu elements in the human transcriptome. Genome Res. 2004 Sep;14(9):1719-25. doi: 10.1101/gr.2855504.
Ref 11	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 12	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 13	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 16	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 17	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 18	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map