m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00206)

Target Name	G1/S-specific cyclin-D1 (CCND1)
Synonyms	B-cell lymphoma 1 protein; BCL-1; BCL-1 oncogene; PRAD1 oncogene; BCL1; PRAD1 Click to Show/Hide
Gene Name	CCND1
Chromosomal Location	11q13.3
Family	cyclin family; Cyclin D subfamily
Function	Regulatory component of the cyclin D1-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also substrate for SMAD3, phosphorylating SMAD3 in a cell-cycle-dependent manner and repressing its transcriptional activity. Component of the ternary complex, cyclin D1/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex. Exhibits transcriptional corepressor activity with INSM1 on the NEUROD1 and INS promoters in a cell cycle-independent manner. Click to Show/Hide
Gene ID	595
Uniprot ID	CCND1_HUMAN
HGNC ID	HGNC:1582
KEGG ID	hsa:595

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CCND1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: FTO inhibition NB4 cells Control: NB4 cells		GSE103495
Regulation		logFC: -7.40E-01 p-value: 1.34E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	FTO regulates myoblast proliferation by controlling G1/S-specific cyclin-D1 (CCND1) expression in an m6A-YTHDF2-dependent manner.
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell apoptosis
In-vitro Model	GPM (Goat primary myoblasts)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of G1/S-specific cyclin-D1 (CCND1) and Cdk2(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity	ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle		hsa04110
Cell Process	Cell cycle

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LNCaP cell line	Homo sapiens
Treatment: shMETTL3 LNCaP cells Control: shControl LNCaP cells		GSE147884
Regulation		logFC: -6.51E-01 p-value: 1.46E-104
More Results	Click to View More RNA-seq Results

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and G1/S-specific cyclin-D1 (CCND1).
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3 knockdown downregulated the phosphorylation levels of AKT and the expression of the downstream effector G1/S-specific cyclin-D1 (CCND1) in ovarian cancer.
Target Regulation	Up regulation
Responsed Disease	Ovarian cancer		ICD-11: 2C73	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell cycle
	Cell apoptosis
In-vitro Model	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	METTL3 modulates miR-193b mature process in an m6A-dependent manner. Reintroduction of miR-193b profoundly inhibits tumorigenesis of cervical cancer cells both in vivo and in vitro through G1/S-specific cyclin-D1 (CCND1) targeting.
Target Regulation	Down regulation
Responsed Disease	Cervical cancer		ICD-11: 2C77	Disease Info
In-vitro Model	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
In-vivo Model	Mice were divided into two groups (n = 4/group) randomly. 3×10⁶ cells suspended in 200 uL PBS were administered via subcutaneous injection over the right flank region of nude mice. After the development of palpable tumors (average volume, 50 mm³), intratumoral injection of synthetic miR-193b, or negative control complexed with siPORT Amine transfection reagent (Ambion, USA) was given 6 times at a 4-day interval.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Obesity is becoming a global problem. ZFP217 knockdown-induced adipogenesis inhibition was caused by G1/S-specific cyclin-D1 (CCND1), which was mediated by METTL3 and YTHDF2 in an m6A-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Mitotic clonal
	Prolonged G1/S transition
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	GSC11 cell line	Homo sapiens
Treatment: siYTHDF2 GSC11 cells Control: siControl GSC11 cells		GSE142825
Regulation		logFC: 1.13E+00 p-value: 1.41E-27
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO regulates myoblast proliferation by controlling G1/S-specific cyclin-D1 (CCND1) expression in an m6A-YTHDF2-dependent manner.
Target Regulation	Down regulation
Cell Process	Cell proliferation
	Cell apoptosis
In-vitro Model	GPM (Goat primary myoblasts)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Obesity is becoming a global problem. ZFP217 knockdown-induced adipogenesis inhibition was caused by G1/S-specific cyclin-D1 (CCND1), which was mediated by METTL3 and YTHDF2 in an m6A-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Mitotic clonal
	Prolonged G1/S transition
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of G1/S-specific cyclin-D1 (CCND1) and Cdk2(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, G1/S-specific cyclin-D1 (CCND1), CDK4, EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Methyltransferase-like 16 (METTL16) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[14]
Response Summary	METTL16-mediated m6A methylation promotes proliferation of gastric cancer cells through enhancing G1/S-specific cyclin-D1 (CCND1) expression.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	G1/S blocking
In-vitro Model	SNU-719	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_5086
	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MKN28	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1416
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	Xenograft mouse model was used to verify the tumorigenic effect of METTL16 in vivo. BALB/c nude mice (4 weeks old) were injected with METTL16 gene knock-down stable MGC803 GC cells (3 × 10⁶ cells/mice, subcutaneous injection) or shNC control cells (3 × 10⁶, subcutaneous injection), and the dose was 100 uL, with PBS as solvent. The tumour size was measured every 3-5 days. At the end of feeding (6 weeks after subcutaneous injection), the mice were killed and the tumours were extracted for histological analysis.

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, G1/S-specific cyclin-D1 (CCND1), CDK4, EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[16]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and G1/S-specific cyclin-D1 (CCND1), and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene		[19]
Response Summary	Dysfunction of Ythdf3 and Mettl3 results in the translational defect of G1/S-specific cyclin-D1 (CCND1). Ythdf3 and Mettl3 regulates HSCs by transmitting m6A RNA methylation on the 5'UTR of Ccnd1.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene		[19]
Response Summary	Dysfunction of Ythdf3 and Mettl3 results in the translational defect of G1/S-specific cyclin-D1 (CCND1). Ythdf3 and Mettl3 regulates HSCs by transmitting m6A RNA methylation on the 5'UTR of Ccnd1.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[14]
Response Summary	METTL16-mediated m6A methylation promotes proliferation of gastric cancer cells through enhancing G1/S-specific cyclin-D1 (CCND1) expression.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 16 (METTL16)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	G1/S blocking
In-vitro Model	SNU-719	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_5086
	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MKN28	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1416
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	Xenograft mouse model was used to verify the tumorigenic effect of METTL16 in vivo. BALB/c nude mice (4 weeks old) were injected with METTL16 gene knock-down stable MGC803 GC cells (3 × 10⁶ cells/mice, subcutaneous injection) or shNC control cells (3 × 10⁶, subcutaneous injection), and the dose was 100 uL, with PBS as solvent. The tumour size was measured every 3-5 days. At the end of feeding (6 weeks after subcutaneous injection), the mice were killed and the tumours were extracted for histological analysis.
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and G1/S-specific cyclin-D1 (CCND1).
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vitro Model	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[11]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, G1/S-specific cyclin-D1 (CCND1), CDK4, EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630
Experiment 2 Reporting the m6A-centered Disease Response				[11]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, G1/S-specific cyclin-D1 (CCND1), CDK4, EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Protein virilizer homolog (VIRMA)		WRITER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630
Experiment 3 Reporting the m6A-centered Disease Response				[16]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and G1/S-specific cyclin-D1 (CCND1), and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Ovarian cancer [ICD-11: 2C73]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3 knockdown downregulated the phosphorylation levels of AKT and the expression of the downstream effector G1/S-specific cyclin-D1 (CCND1) in ovarian cancer.
Responsed Disease	Ovarian cancer [ICD-11: 2C73]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell cycle
	Cell apoptosis
In-vitro Model	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532

Cervical cancer [ICD-11: 2C77]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	METTL3 modulates miR-193b mature process in an m6A-dependent manner. Reintroduction of miR-193b profoundly inhibits tumorigenesis of cervical cancer cells both in vivo and in vitro through G1/S-specific cyclin-D1 (CCND1) targeting.
Responsed Disease	Cervical cancer [ICD-11: 2C77]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
In-vitro Model	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
In-vivo Model	Mice were divided into two groups (n = 4/group) randomly. 3×10⁶ cells suspended in 200 uL PBS were administered via subcutaneous injection over the right flank region of nude mice. After the development of palpable tumors (average volume, 50 mm³), intratumoral injection of synthetic miR-193b, or negative control complexed with siPORT Amine transfection reagent (Ambion, USA) was given 6 times at a 4-day interval.

Obesity [ICD-11: 5B81]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of G1/S-specific cyclin-D1 (CCND1) and Cdk2(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle
Experiment 2 Reporting the m6A-centered Disease Response				[6]
Response Summary	Obesity is becoming a global problem. ZFP217 knockdown-induced adipogenesis inhibition was caused by G1/S-specific cyclin-D1 (CCND1), which was mediated by METTL3 and YTHDF2 in an m6A-dependent manner.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Mitotic clonal
	Prolonged G1/S transition
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 3 Reporting the m6A-centered Disease Response				[6]
Response Summary	Obesity is becoming a global problem. ZFP217 knockdown-induced adipogenesis inhibition was caused by G1/S-specific cyclin-D1 (CCND1), which was mediated by METTL3 and YTHDF2 in an m6A-dependent manner.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Mitotic clonal
	Prolonged G1/S transition
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 4 Reporting the m6A-centered Disease Response				[2]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of G1/S-specific cyclin-D1 (CCND1) and Cdk2(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[16]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and G1/S-specific cyclin-D1 (CCND1), and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03509		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Cervical cancer	Disease Info
Crosstalk ID: M6ACROT03522		Crosstalk Info
Epigenetic Regulator	WD repeat-containing protein 5 (WDR5)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Cervical cancer	Disease Info
Crosstalk ID: M6ACROT03639		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05098		Crosstalk Info
Epigenetic Regulator	HNF1A antisense RNA 1 (HNF1A-AS1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00206)

G1/S-specific cyclin-D1 (CCND1)

5-methylcytidine (m5C)

In total 31 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005290		Click to Show/Hide the Full List
mod site	chr11:69641514-69641515:+		[21]
Sequence	CCACCTGGATGCTGGAGGTGCGGGGCTTCGGGCGGCTCTCT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000535993.1; ENST00000227507.2; ENST00000539241.1
External Link	RMBase: m5C_site_8369
mod ID: M5CSITE005291		Click to Show/Hide the Full List
mod site	chr11:69642439-69642440:+
Sequence	CGCCCAGGGGGAAGGGGGGGCCCCGGAGTTTGAATTCCTGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000539241.1; ENST00000535993.1; ENST00000227507.2
External Link	RMBase: m5C_site_8370
mod ID: M5CSITE005292		Click to Show/Hide the Full List
mod site	chr11:69642440-69642441:+
Sequence	GCCCAGGGGGAAGGGGGGGCCCCGGAGTTTGAATTCCTGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000539241.1; ENST00000227507.2; ENST00000535993.1
External Link	RMBase: m5C_site_8371
mod ID: M5CSITE005293		Click to Show/Hide the Full List
mod site	chr11:69642441-69642442:+
Sequence	CCCAGGGGGAAGGGGGGGCCCCGGAGTTTGAATTCCTGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000539241.1; ENST00000535993.1
External Link	RMBase: m5C_site_8372
mod ID: M5CSITE005294		Click to Show/Hide the Full List
mod site	chr11:69642442-69642443:+
Sequence	CCAGGGGGAAGGGGGGGCCCCGGAGTTTGAATTCCTGGGGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000539241.1; ENST00000535993.1
External Link	RMBase: m5C_site_8373
mod ID: M5CSITE005295		Click to Show/Hide the Full List
mod site	chr11:69642462-69642463:+
Sequence	CGGAGTTTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000535993.1; ENST00000539241.1; ENST00000227507.2
External Link	RMBase: m5C_site_8374
mod ID: M5CSITE005296		Click to Show/Hide the Full List
mod site	chr11:69642464-69642465:+
Sequence	GAGTTTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000535993.1; ENST00000539241.1; ENST00000536559.1; ENST00000227507.2
External Link	RMBase: m5C_site_8375
mod ID: M5CSITE005297		Click to Show/Hide the Full List
mod site	chr11:69642465-69642466:+
Sequence	AGTTTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000535993.1; ENST00000227507.2; ENST00000539241.1; ENST00000536559.1
External Link	RMBase: m5C_site_8376
mod ID: M5CSITE005298		Click to Show/Hide the Full List
mod site	chr11:69642466-69642467:+
Sequence	GTTTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAACT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000535993.1; ENST00000227507.2; ENST00000539241.1; ENST00000536559.1
External Link	RMBase: m5C_site_8377
mod ID: M5CSITE005299		Click to Show/Hide the Full List
mod site	chr11:69642467-69642468:+
Sequence	TTTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAACTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000539241.1; ENST00000227507.2; ENST00000535993.1
External Link	RMBase: m5C_site_8378
mod ID: M5CSITE005300		Click to Show/Hide the Full List
mod site	chr11:69642468-69642469:+
Sequence	TTGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAACTCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000535993.1; ENST00000539241.1
External Link	RMBase: m5C_site_8379
mod ID: M5CSITE005301		Click to Show/Hide the Full List
mod site	chr11:69642469-69642470:+
Sequence	TGAATTCCTGGGGCTCCCCCCGGAGCCTGTAACGAACTCCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000535993.1; ENST00000539241.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m5C_site_8380
mod ID: M5CSITE005302		Click to Show/Hide the Full List
mod site	chr11:69645552-69645553:+
Sequence	GAGTCCACTCCAGGGTGGGTCCCGAGGGAGGGGCAGGAGAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000545484.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m5C_site_8381
mod ID: M5CSITE005303		Click to Show/Hide the Full List
mod site	chr11:69645553-69645554:+
Sequence	AGTCCACTCCAGGGTGGGTCCCGAGGGAGGGGCAGGAGACC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000545484.1
External Link	RMBase: m5C_site_8382
mod ID: M5CSITE005304		Click to Show/Hide the Full List
mod site	chr11:69645554-69645555:+
Sequence	GTCCACTCCAGGGTGGGTCCCGAGGGAGGGGCAGGAGACCA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000545484.1
External Link	RMBase: m5C_site_8383
mod ID: M5CSITE005305		Click to Show/Hide the Full List
mod site	chr11:69645580-69645581:+
Sequence	AGGGGCAGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8384
mod ID: M5CSITE005306		Click to Show/Hide the Full List
mod site	chr11:69645581-69645582:+
Sequence	GGGGCAGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000545484.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m5C_site_8385
mod ID: M5CSITE005307		Click to Show/Hide the Full List
mod site	chr11:69645582-69645583:+
Sequence	GGGCAGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCCGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000545484.1
External Link	RMBase: m5C_site_8386
mod ID: M5CSITE005308		Click to Show/Hide the Full List
mod site	chr11:69645584-69645585:+
Sequence	GCAGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCCGGGT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536559.1; ENST00000545484.1; ENST00000227507.2
External Link	RMBase: m5C_site_8387
mod ID: M5CSITE005309		Click to Show/Hide the Full List
mod site	chr11:69645585-69645586:+
Sequence	CAGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCCGGGTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8388
mod ID: M5CSITE005310		Click to Show/Hide the Full List
mod site	chr11:69645586-69645587:+
Sequence	AGGAGACCAGGGGACCCACCCCTGCAAAGTGCTCCGGGTCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000545484.1; ENST00000536559.1
External Link	RMBase: m5C_site_8389
mod ID: M5CSITE005311		Click to Show/Hide the Full List
mod site	chr11:69646452-69646453:+
Sequence	GGGATGAAGTCTCGGATGGGCCGCCACACCCCTGGCGGCCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000545484.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m5C_site_8390
mod ID: M5CSITE005312		Click to Show/Hide the Full List
mod site	chr11:69646453-69646454:+
Sequence	GGATGAAGTCTCGGATGGGCCGCCACACCCCTGGCGGCCCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000545484.1; ENST00000536559.1
External Link	RMBase: m5C_site_8391
mod ID: M5CSITE005313		Click to Show/Hide the Full List
mod site	chr11:69646455-69646456:+
Sequence	ATGAAGTCTCGGATGGGCCGCCACACCCCTGGCGGCCCGTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8392
mod ID: M5CSITE005314		Click to Show/Hide the Full List
mod site	chr11:69646456-69646457:+
Sequence	TGAAGTCTCGGATGGGCCGCCACACCCCTGGCGGCCCGTGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000545484.1; ENST00000536559.1
External Link	RMBase: m5C_site_8393
mod ID: M5CSITE005315		Click to Show/Hide the Full List
mod site	chr11:69646467-69646468:+
Sequence	ATGGGCCGCCACACCCCTGGCGGCCCGTGGGGGCCCCTCTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8394
mod ID: M5CSITE005316		Click to Show/Hide the Full List
mod site	chr11:69646470-69646471:+
Sequence	GGCCGCCACACCCCTGGCGGCCCGTGGGGGCCCCTCTCCCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000545484.1; ENST00000536559.1
External Link	RMBase: m5C_site_8395
mod ID: M5CSITE005317		Click to Show/Hide the Full List
mod site	chr11:69646471-69646472:+
Sequence	GCCGCCACACCCCTGGCGGCCCGTGGGGGCCCCTCTCCCTT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8396
mod ID: M5CSITE005318		Click to Show/Hide the Full List
mod site	chr11:69646472-69646473:+
Sequence	CCGCCACACCCCTGGCGGCCCGTGGGGGCCCCTCTCCCTTT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000545484.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m5C_site_8397
mod ID: M5CSITE005319		Click to Show/Hide the Full List
mod site	chr11:69648117-69648118:+		[21]
Sequence	TACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000542367.1; ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m5C_site_8398
mod ID: M5CSITE005320		Click to Show/Hide the Full List
mod site	chr11:69651359-69651360:+		[21]
Sequence	GTGCTCCCCTGACAGTCCCTCCTCTCCGGAGCATTTTGATA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000542367.1; ENST00000227507.2
External Link	RMBase: m5C_site_8399

N6-methyladenosine (m6A)

In total 67 m6A sequence/site(s) in this target gene
mod ID: M6ASITE007770		Click to Show/Hide the Full List
mod site	chr11:69641111-69641112:+		[22]
Sequence	ACAACAGTAACGTCACACGGACTACAGGGGAGTTTTGTTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1B; fibroblasts; A549; HEK293A-TOA; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152838
mod ID: M6ASITE007771		Click to Show/Hide the Full List
mod site	chr11:69641262-69641263:+		[22]
Sequence	GAAGCGAGAGCCGAGCGCGGACCCAGCCAGGACCCACAGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; fibroblasts; H1299; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000535993.1; ENST00000539241.1
External Link	RMBase: m6A_site_152839
mod ID: M6ASITE007772		Click to Show/Hide the Full List
mod site	chr11:69641273-69641274:+		[22]
Sequence	CGAGCGCGGACCCAGCCAGGACCCACAGCCCTCCCCAGCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; fibroblasts; MT4; H1299; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000227507.2; ENST00000536559.1; ENST00000535993.1
External Link	RMBase: m6A_site_152840
mod ID: M6ASITE007773		Click to Show/Hide the Full List
mod site	chr11:69641318-69641319:+		[22]
Sequence	GGAAGAGCCCCAGCCATGGAACACCAGCTCCTGTGCTGCGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; H1299; Huh7; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000536559.1; ENST00000535993.1; ENST00000227507.2
External Link	RMBase: m6A_site_152841
mod ID: M6ASITE007774		Click to Show/Hide the Full List
mod site	chr11:69641346-69641347:+		[22]
Sequence	TCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; H1B; H1A; H1299; Huh7; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000535993.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m6A_site_152842
mod ID: M6ASITE007775		Click to Show/Hide the Full List
mod site	chr11:69641421-69641422:+		[22]
Sequence	CCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; H1299; Huh7; CD4T; GSC-11; HEK293T; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536559.1; ENST00000535993.1; ENST00000539241.1; ENST00000227507.2
External Link	RMBase: m6A_site_152843
mod ID: M6ASITE007776		Click to Show/Hide the Full List
mod site	chr11:69643041-69643042:+		[22]
Sequence	CCTCCGTAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; Huh7; CD4T; GSC-11; HEK293T; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000539241.1; ENST00000535993.1; ENST00000536559.1
External Link	RMBase: m6A_site_152844
mod ID: M6ASITE007777		Click to Show/Hide the Full List
mod site	chr11:69643079-69643080:+		[22]
Sequence	GGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; A549; Huh7; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536559.1; ENST00000535993.1; ENST00000539241.1; ENST00000227507.2
External Link	RMBase: m6A_site_152845
mod ID: M6ASITE007778		Click to Show/Hide the Full List
mod site	chr11:69643088-69643089:+		[22]
Sequence	GCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; Huh7; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000227507.2; ENST00000536559.1; ENST00000535993.1
External Link	RMBase: m6A_site_152846
mod ID: M6ASITE007779		Click to Show/Hide the Full List
mod site	chr11:69643177-69643178:+		[22]
Sequence	TGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; Huh7; GSC-11; HEK293T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535993.1; ENST00000539241.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m6A_site_152847
mod ID: M6ASITE007780		Click to Show/Hide the Full List
mod site	chr11:69643211-69643212:+		[23]
Sequence	GGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000227507.2; ENST00000535993.1; ENST00000539241.1; ENST00000536559.1
External Link	RMBase: m6A_site_152848
mod ID: M6ASITE007781		Click to Show/Hide the Full List
mod site	chr11:69643217-69643218:+		[23]
Sequence	GAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000535993.1; ENST00000539241.1; ENST00000536559.1; ENST00000227507.2
External Link	RMBase: m6A_site_152849
mod ID: M6ASITE007782		Click to Show/Hide the Full List
mod site	chr11:69643257-69643258:+		[22]
Sequence	GAGCTGCTGGTAACCACTGGACCCCGCCGCCCCCCGCCCCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000539241.1; ENST00000535993.1; ENST00000536559.1
External Link	RMBase: m6A_site_152850
mod ID: M6ASITE007783		Click to Show/Hide the Full List
mod site	chr11:69643295-69643296:+		[22]
Sequence	CCCCGCGAGCCGCACGCAGGACCACGGGGCCGGGGAAGGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000535993.1; ENST00000536559.1; ENST00000227507.2
External Link	RMBase: m6A_site_152851
mod ID: M6ASITE007784		Click to Show/Hide the Full List
mod site	chr11:69643853-69643854:+		[22]
Sequence	AATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; H1A; hESCs; A549; Huh7; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000536559.1; ENST00000545484.1; ENST00000539241.1; ENST00000227507.2
External Link	RMBase: m6A_site_152852
mod ID: M6ASITE007785		Click to Show/Hide the Full List
mod site	chr11:69643868-69643869:+		[22]
Sequence	GGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1A; A549; Huh7; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000539241.1; ENST00000545484.1
External Link	RMBase: m6A_site_152853
mod ID: M6ASITE007786		Click to Show/Hide the Full List
mod site	chr11:69643902-69643903:+		[22]
Sequence	ACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; H1A; H1B; A549; Huh7; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000545484.1; ENST00000536559.1; ENST00000539241.1
External Link	RMBase: m6A_site_152854
mod ID: M6ASITE007787		Click to Show/Hide the Full List
mod site	chr11:69643937-69643938:+		[22]
Sequence	AATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; Huh7; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539241.1; ENST00000227507.2; ENST00000536559.1; ENST00000545484.1
External Link	RMBase: m6A_site_152855
mod ID: M6ASITE007788		Click to Show/Hide the Full List
mod site	chr11:69643941-69643942:+		[23]
Sequence	CCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000536559.1; ENST00000545484.1; ENST00000539241.1; ENST00000227507.2
External Link	RMBase: m6A_site_152856
mod ID: M6ASITE007789		Click to Show/Hide the Full List
mod site	chr11:69643956-69643957:+		[22]
Sequence	AACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; Huh7; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000536559.1; ENST00000545484.1; ENST00000539241.1
External Link	RMBase: m6A_site_152857
mod ID: M6ASITE007790		Click to Show/Hide the Full List
mod site	chr11:69643966-69643967:+		[22]
Sequence	TCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; GSC-11; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000545484.1; ENST00000539241.1
External Link	RMBase: m6A_site_152858
mod ID: M6ASITE007791		Click to Show/Hide the Full List
mod site	chr11:69644100-69644101:+		[22]
Sequence	GTCTGGGAAGATGTCCCCAGACCCCCTCCTGCGCTGGAGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; GSC-11; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000539241.1; ENST00000545484.1; ENST00000227507.2; ENST00000536559.1
External Link	RMBase: m6A_site_152859
mod ID: M6ASITE007792		Click to Show/Hide the Full List
mod site	chr11:69648065-69648066:+		[22]
Sequence	GGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; Huh7; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000545484.1; ENST00000542367.1
External Link	RMBase: m6A_site_152860
mod ID: M6ASITE007793		Click to Show/Hide the Full List
mod site	chr11:69648106-69648107:+		[23]
Sequence	TCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000536559.1; ENST00000227507.2; ENST00000542367.1; ENST00000545484.1
External Link	RMBase: m6A_site_152861
mod ID: M6ASITE007794		Click to Show/Hide the Full List
mod site	chr11:69648192-69648193:+		[22]
Sequence	GCCGGGGCTTACAGGGGGAGACACCTAGTGCCACGGAAATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; H1299; Huh7; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000542367.1; ENST00000536559.1
External Link	RMBase: m6A_site_152862
mod ID: M6ASITE007795		Click to Show/Hide the Full List
mod site	chr11:69651187-69651188:+		[22]
Sequence	CCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000227507.2; ENST00000542367.1
External Link	RMBase: m6A_site_152863
mod ID: M6ASITE007796		Click to Show/Hide the Full List
mod site	chr11:69651193-69651194:+		[22]
Sequence	CCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000542367.1
External Link	RMBase: m6A_site_152864
mod ID: M6ASITE007797		Click to Show/Hide the Full List
mod site	chr11:69651238-69651239:+		[22]
Sequence	AGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; H1299; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000542367.1; rmsk_3579100
External Link	RMBase: m6A_site_152865
mod ID: M6ASITE007798		Click to Show/Hide the Full List
mod site	chr11:69651274-69651275:+		[22]
Sequence	CACCGACGTGCGGGACGTGGACATCTGAGGGCGCCAGGCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2; ENST00000542367.1
External Link	RMBase: m6A_site_152866
mod ID: M6ASITE007799		Click to Show/Hide the Full List
mod site	chr11:69651451-69651452:+		[24]
Sequence	CTTTCCCCCTTCCATCTCTGACTTAAGCAAAAGAAAAAGAT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152867
mod ID: M6ASITE007800		Click to Show/Hide the Full List
mod site	chr11:69651481-69651482:+		[22]
Sequence	AAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; H1299; Huh7; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152868
mod ID: M6ASITE007801		Click to Show/Hide the Full List
mod site	chr11:69651711-69651712:+		[23]
Sequence	GTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152869
mod ID: M6ASITE007802		Click to Show/Hide the Full List
mod site	chr11:69652242-69652243:+		[25]
Sequence	CTCACGTCCAGGTTCAACCCACAGCTACTTGGTTTGTGTTC
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152870
mod ID: M6ASITE007803		Click to Show/Hide the Full List
mod site	chr11:69652279-69652280:+		[22]
Sequence	GTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152871
mod ID: M6ASITE007804		Click to Show/Hide the Full List
mod site	chr11:69652391-69652392:+		[24]
Sequence	TGGTTTGGGAATATCCATGTACTTGTTTGCAAGCAGGACTT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152872
mod ID: M6ASITE007805		Click to Show/Hide the Full List
mod site	chr11:69652408-69652409:+		[26]
Sequence	TGTACTTGTTTGCAAGCAGGACTTTGAGGCAAGTGTGGGCC
Motif Score	4.065041667
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152873
mod ID: M6ASITE007806		Click to Show/Hide the Full List
mod site	chr11:69652591-69652592:+		[26]
Sequence	ACTGGTGTTTGAAAGTAGGGACCTCAGAGGTTTACCTAGAG
Motif Score	3.622404762
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152874
mod ID: M6ASITE007807		Click to Show/Hide the Full List
mod site	chr11:69652769-69652770:+		[22]
Sequence	GCAATCTCCCCTTGATTTAAACACACAGATACACACACACA
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3579101; ENST00000227507.2
External Link	RMBase: m6A_site_152875
mod ID: M6ASITE007808		Click to Show/Hide the Full List
mod site	chr11:69652805-69652806:+		[22]
Sequence	ACACACACACACACACACAAACCTTCTGCCTTTGATGTTAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152876
mod ID: M6ASITE007809		Click to Show/Hide the Full List
mod site	chr11:69652879-69652880:+		[22]
Sequence	CTTTTATAGGTGAGAAAAAAACAATCTGGAAGAAAAAAACC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152877
mod ID: M6ASITE007810		Click to Show/Hide the Full List
mod site	chr11:69652897-69652898:+		[26]
Sequence	AAACAATCTGGAAGAAAAAAACCACACAAAGACATTGATTC
Motif Score	2.185083333
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152878
mod ID: M6ASITE007811		Click to Show/Hide the Full List
mod site	chr11:69652908-69652909:+		[26]
Sequence	AAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGG
Motif Score	2.897386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152879
mod ID: M6ASITE007812		Click to Show/Hide the Full List
mod site	chr11:69652953-69652954:+		[26]
Sequence	TCCCAGAGTCATCTGATTGGACAGGCATGGGTGCAAGGAAA
Motif Score	3.643047619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152880
mod ID: M6ASITE007813		Click to Show/Hide the Full List
mod site	chr11:69653038-69653039:+		[26]
Sequence	CCTGCCCCTTCCTTTAAAAAACTTAGTGACAAAATAGACAA
Motif Score	2.627720238
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152881
mod ID: M6ASITE007814		Click to Show/Hide the Full List
mod site	chr11:69653055-69653056:+		[26]
Sequence	AAAACTTAGTGACAAAATAGACAATTTGCACATCTTGGCTA
Motif Score	2.897386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152882
mod ID: M6ASITE007815		Click to Show/Hide the Full List
mod site	chr11:69653152-69653153:+		[22]
Sequence	AGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2; rmsk_3579102
External Link	RMBase: m6A_site_152883
mod ID: M6ASITE007816		Click to Show/Hide the Full List
mod site	chr11:69653214-69653215:+		[22]
Sequence	GGGCGGTGCCCACACCGGGGACAGGCCGCAGCTCCATTTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152884
mod ID: M6ASITE007817		Click to Show/Hide the Full List
mod site	chr11:69653345-69653346:+		[24]
Sequence	GAGGATCAGTTTTTTGTTTTACAATGTCATATACTGCCATG
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152887
mod ID: M6ASITE007818		Click to Show/Hide the Full List
mod site	chr11:69653357-69653358:+		[24]
Sequence	TTTGTTTTACAATGTCATATACTGCCATGTACTAGTTTTAG
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152888
mod ID: M6ASITE007819		Click to Show/Hide the Full List
mod site	chr11:69653367-69653368:+		[24]
Sequence	AATGTCATATACTGCCATGTACTAGTTTTAGTTTTCTCTTA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152889
mod ID: M6ASITE007820		Click to Show/Hide the Full List
mod site	chr11:69653390-69653391:+		[22]
Sequence	AGTTTTAGTTTTCTCTTAGAACATTGTATTACAGATGCCTT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152890
mod ID: M6ASITE007821		Click to Show/Hide the Full List
mod site	chr11:69653559-69653560:+		[26]
Sequence	CTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACA
Motif Score	2.897386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152891
mod ID: M6ASITE007822		Click to Show/Hide the Full List
mod site	chr11:69653620-69653621:+		[26]
Sequence	CCGAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAG
Motif Score	2.930744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152892
mod ID: M6ASITE007823		Click to Show/Hide the Full List
mod site	chr11:69653641-69653642:+		[26]
Sequence	CCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCT
Motif Score	2.876744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152893
mod ID: M6ASITE007824		Click to Show/Hide the Full List
mod site	chr11:69653789-69653790:+		[23]
Sequence	TTATTATTATTATTATTATAACAAGTGTGTCTTACGTGCCA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152894
mod ID: M6ASITE007825		Click to Show/Hide the Full List
mod site	chr11:69653812-69653813:+		[24]
Sequence	AGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGAC
Motif Score	2.027047619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152895
mod ID: M6ASITE007826		Click to Show/Hide the Full List
mod site	chr11:69653822-69653823:+		[24]
Sequence	ACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCGG
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152896
mod ID: M6ASITE007827		Click to Show/Hide the Full List
mod site	chr11:69653935-69653936:+		[23]
Sequence	TTGTTATTGTTTTGTTAATTACACCATAATGCTAATTTAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152897
mod ID: M6ASITE007828		Click to Show/Hide the Full List
mod site	chr11:69653959-69653960:+		[22]
Sequence	CATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152898
mod ID: M6ASITE007829		Click to Show/Hide the Full List
mod site	chr11:69654023-69654024:+		[26]
Sequence	GTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCG
Motif Score	2.930744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152899
mod ID: M6ASITE007830		Click to Show/Hide the Full List
mod site	chr11:69654140-69654141:+		[22]
Sequence	CCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; A549; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152900
mod ID: M6ASITE007831		Click to Show/Hide the Full List
mod site	chr11:69654188-69654189:+		[22]
Sequence	TGGCTGCGGCGTCTGTCTGAACCACGCGGGGGCCTTGAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; H1B; A549; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152902
mod ID: M6ASITE007832		Click to Show/Hide the Full List
mod site	chr11:69654209-69654210:+		[27]
Sequence	CCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGG
Motif Score	3.616982143
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152903
mod ID: M6ASITE007833		Click to Show/Hide the Full List
mod site	chr11:69654426-69654427:+		[22]
Sequence	CGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152910
mod ID: M6ASITE007834		Click to Show/Hide the Full List
mod site	chr11:69654434-69654435:+		[22]
Sequence	TTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152911
mod ID: M6ASITE007835		Click to Show/Hide the Full List
mod site	chr11:69654459-69654460:+		[22]
Sequence	CATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAGCGTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152912
mod ID: M6ASITE007836		Click to Show/Hide the Full List
mod site	chr11:69654468-69654469:+		[22]
Sequence	CTAGAAATAAAACTGGTAAAACCCCAGCGTGGTGCCTGCCT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000227507.2
External Link	RMBase: m6A_site_152913

Ref 1	FTO regulates myoblast proliferation by controlling CCND1 expression in an m(6)A-YTHDF2-dependent manner. Exp Cell Res. 2021 Apr 15;401(2):112524. doi: 10.1016/j.yexcr.2021.112524. Epub 2021 Feb 27.
Ref 2	Metformin combats obesity by targeting FTO in an m(6)A-YTHDF2-dependent manner. J Drug Target. 2022 May 9:1-9. doi: 10.1080/1061186X.2022.2071906. Online ahead of print.
Ref 3	METTL3 Promotes the Proliferation and Mobility of Gastric Cancer Cells. Open Med (Wars). 2019 Mar 2;14:25-31. doi: 10.1515/med-2019-0005. eCollection 2019.
Ref 4	METTL3 serves an oncogenic role in human ovarian cancer cells partially via the AKT signaling pathway. Oncol Lett. 2020 Apr;19(4):3197-3204. doi: 10.3892/ol.2020.11425. Epub 2020 Mar 3.
Ref 5	N(6)-Methyladenosine Associated Silencing of miR-193b Promotes Cervical Cancer Aggressiveness by Targeting CCND1. Front Oncol. 2021 Jun 10;11:666597. doi: 10.3389/fonc.2021.666597. eCollection 2021.
Ref 6	ZFP217 regulates adipogenesis by controlling mitotic clonal expansion in a METTL3-m(6)A dependent manner. RNA Biol. 2019 Dec;16(12):1785-1793. doi: 10.1080/15476286.2019.1658508. Epub 2019 Aug 27.
Ref 7	Differences in the transport of the antiepileptic drugs phenytoin, levetiracetam and carbamazepine by human and mouse P-glycoprotein. Neuropharmacology. 2007 Feb;52(2):333-46. doi: 10.1016/j.neuropharm.2006.07.038. Epub 2006 Oct 10.
Ref 8	Influence of drug transporters and UGT polymorphisms on pharmacokinetics of phenolic glucuronide metabolite of mycophenolic acid in Japanese renal transplant recipients. Ther Drug Monit. 2008 Oct;30(5):559-64. doi: 10.1097/FTD.0b013e3181838063.
Ref 9	Structure-based design of potent small-molecule inhibitors of anti-apoptotic Bcl-2 proteins. J Med Chem. 2006 Oct 19;49(21):6139-42. doi: 10.1021/jm060460o.
Ref 10	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 11	Identification of pathology-specific regulators of m(6)A RNA modification to optimize lung cancer management in the context of predictive, preventive, and personalized medicine. EPMA J. 2020 Jul 29;11(3):485-504. doi: 10.1007/s13167-020-00220-3. eCollection 2020 Sep.
Ref 12	URL: http://www.guidetopharmacology.org Nucleic Acids Res. 2015 Oct 12. pii: gkv1037. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. (Target id: 1797).
Ref 13	Indomethacin induces apoptosis via a MRP1-dependent mechanism in doxorubicin-resistant small-cell lung cancer cells overexpressing MRP1. Br J Cancer. 2007 Oct 22;97(8):1077-83. doi: 10.1038/sj.bjc.6604010. Epub 2007 Oct 16.
Ref 14	METTL16 promotes cell proliferation by up-regulating cyclin D1 expression in gastric cancer. J Cell Mol Med. 2021 Jul;25(14):6602-6617. doi: 10.1111/jcmm.16664. Epub 2021 Jun 2.
Ref 15	Clinical pipeline report, company report or official report of Eli Lilly.
Ref 16	YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nat Commun. 2019 Oct 25;10(1):4892. doi: 10.1038/s41467-019-12801-6.
Ref 17	Effect of the carbocyclic nucleoside analogue MDL 201,112 on inhibition of interferon-gamma-induced priming of Lewis (LEW/N) rat macrophages for enhanced respiratory burst and MHC class II Ia+ antigen expression. J Leukoc Biol. 1994 Aug;56(2):133-44. doi: 10.1002/jlb.56.2.133.
Ref 18	Clinical pipeline report, company report or official report of Black Diamond Therapeutics.
Ref 19	YTHDF3 modulates hematopoietic stem cells by recognizing RNA m6A modification on Ccnd1. Haematologica. 2022 Feb 3. doi: 10.3324/haematol.2021.279739. Online ahead of print.
Ref 20	The influence of CYP3A5*3 and BCRPC421A genetic polymorphisms on the pharmacokinetics of felodipine in healthy Chinese volunteers. J Clin Pharm Ther. 2017 Jun;42(3):345-349. doi: 10.1111/jcpt.12505. Epub 2017 Feb 28.
Ref 21	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 22	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 23	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 24	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 25	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 26	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 27	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map