General Information of the m6A Target Gene (ID: M6ATAR00605)
Target Name NACHT, LRR and PYD domains-containing protein 3 (NLRP3)
Synonyms
Angiotensin/vasopressin receptor AII/AVP-like; Caterpiller protein 1.1; CLR1.1; Cold-induced autoinflammatory syndrome 1 protein; Cryopyrin; PYRIN-containing APAF1-like protein 1
    Click to Show/Hide
Gene Name NLRP3
Chromosomal Location 1q44
Family NLRP family
Function
As the sensor component of the NLRP3 inflammasome, plays a crucial role in innate immunity and inflammation. In response to pathogens and other damage-associated signals, initiates the formation of the inflammasome polymeric complex, made of NLRP3, PYCARD and CASP1 (and possibly CASP4 and CASP5). Recruitment of proCASP1 to the inflammasome promotes its activation and CASP1-catalyzed IL1B and IL18 maturation and secretion in the extracellular milieu. Activation of NLRP3 inflammasome is also required for HMGB1 secretion. The active cytokines and HMGB1 stimulate inflammatory responses. Inflammasomes can also induce pyroptosis, an inflammatory form of programmed cell death. Under resting conditions, NLRP3 is autoinhibited. NLRP3 activation stimuli include extracellular ATP, reactive oxygen species, K(+) efflux, crystals of monosodium urate or cholesterol, amyloid-beta fibers, environmental or industrial particles and nanoparticles, cytosolic dsRNA, etc. Activation upon, at least, K(+) efflux is mediated by the interaction wit NEK7 (By similarity). Activation in presence of cytosolic dsRNA is mediated by DHX33. Independently of inflammasome activation, regulates the differentiation of T helper 2 (Th2) cells and has a role in Th2 cell-dependent asthma and tumor growth (By similarity). During Th2 differentiation, required for optimal IRF4 binding to IL4 promoter and for IRF4-dependent IL4 transcription. Binds to the consensus DNA sequence 5'-GRRGGNRGAG-3'. May also participate in the transcription of IL5, IL13, GATA3, CCR3, CCR4 and MAF (By similarity).
    Click to Show/Hide
Gene ID 114548
Uniprot ID
NLRP3_HUMAN
HGNC ID
HGNC:16400
KEGG ID
hsa:114548
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NLRP3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LX2 cell line Homo sapiens
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
GSE207909
Regulation
logFC: 8.32E-01
p-value: 1.76E-06
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between NLRP3 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 7.81E+00 GSE60213
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In the in vivo atherosclerosis model,partial ligation of the carotid artery led to plaque formation and up-regulation of METTL3 and NLRP1, with down-regulation of KLF4; knockdown of METTL3 via repetitive shRNA administration prevented the atherogenic process, NACHT, LRR and PYD domains-containing protein 3 (NLRP3) up-regulation, and KLF4 down-regulation. Collectively, it has demonstrated that METTL3 serves a central role in the atherogenesis induced by oscillatory stress and disturbed blood flow.
Target Regulation Up regulation
Responsed Disease Atherosclerosis ICD-11: BD40.Z
In-vitro Model MAEC Normal Mus musculus CVCL_U411
HUVEC-C Normal Homo sapiens CVCL_2959
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary TFA could ameliorate HG-induced pyroptosis and injury in podocytes by targeting METTL3-dependent m6A modification via the regulation of NACHT, LRR and PYD domains-containing protein 3 (NLRP3)-inflammasome activation and PTEN/PI3K/Akt signaling. This study provides a better understanding of how TFA can protect podocytes in diabetic kidney disease (DKD).
Target Regulation Down regulation
Responsed Disease Chronic kidney disease ICD-11: GB61.Z
Pathway Response PI3K-Akt signaling pathway hsa04151
In-vitro Model MPC-5 Normal Mus musculus CVCL_AS87
YTH domain-containing family protein 1 (YTHDF1) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [11]
Response Summary YTHDF1 promotes pro-inflammatory IL-1-Beta production in macrophages during bacterial infections. YTHDF1 overexpression promotes NACHT, LRR and PYD domains-containing protein 3 (NLRP3) translation.YTHDF1 participates in inflammatory responses and subsequent injuries, serving as a new potential therapeutic target in clinical treatment of inflammatory diseases.
Target Regulation Up regulation
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
In-vivo Model Female C57BL/6 mice (6-8 weeks) were intraperitoneally injected with 2 ml 3% sterile sodium thioglycolate solution. After 3 days, the cells in the abdominal cavity were collected, centrifugated and maintained in DMEM with 10% (vol/vol) FBS.
Atherosclerosis [ICD-11: BD40]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary In the in vivo atherosclerosis model,partial ligation of the carotid artery led to plaque formation and up-regulation of METTL3 and NLRP1, with down-regulation of KLF4; knockdown of METTL3 via repetitive shRNA administration prevented the atherogenic process, NACHT, LRR and PYD domains-containing protein 3 (NLRP3) up-regulation, and KLF4 down-regulation. Collectively, it has demonstrated that METTL3 serves a central role in the atherogenesis induced by oscillatory stress and disturbed blood flow.
Responsed Disease Atherosclerosis [ICD-11: BD40.Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
In-vitro Model MAEC Normal Mus musculus CVCL_U411
HUVEC-C Normal Homo sapiens CVCL_2959
Chronic kidney disease [ICD-11: GB61]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary TFA could ameliorate HG-induced pyroptosis and injury in podocytes by targeting METTL3-dependent m6A modification via the regulation of NACHT, LRR and PYD domains-containing protein 3 (NLRP3)-inflammasome activation and PTEN/PI3K/Akt signaling. This study provides a better understanding of how TFA can protect podocytes in diabetic kidney disease (DKD).
Responsed Disease Chronic kidney disease [ICD-11: GB61.Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response PI3K-Akt signaling pathway hsa04151
In-vitro Model MPC-5 Normal Mus musculus CVCL_AS87
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Methyltransferase-like 14 (METTL14)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00482
Epigenetic Regulator Fat mass and obesity-associated protein (FTO)
Regulated Target hsa-mir-22
Crosstalk relationship m6Am → m6A
Histone modification
m6A Regulator: Wilms tumor 1-associating protein (WTAP)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03095
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Diabetic nephropathy
Drug SETDB1-TTD-IN-1
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03107
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Lung cancer
Drug Gefitinib
Crosstalk ID: M6ACROT03109
Regulated Target Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship Histone modification → m6A
Disease Lung cancer
Drug Gefitinib
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03108
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Lung cancer
Drug Gefitinib
Crosstalk ID: M6ACROT03110
Regulated Target Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship Histone modification → m6A
Disease Lung cancer
Drug Gefitinib
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03154
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05161
Epigenetic Regulator hsa-miR-1208
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Osteoarthritis
Crosstalk ID: M6ACROT05223
Epigenetic Regulator MIR570 host gene (MIR570HG)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Lung cancer
Drug Gefitinib
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05224
Epigenetic Regulator MIR570 host gene (MIR570HG)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Lung cancer
Drug Gefitinib
m6A Regulator: Methyltransferase-like 14 (METTL14)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05329
Epigenetic Regulator hsa-miR-26a-5p
Regulated Target Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship ncRNA → m6A
Disease Intervertebral disc degeneration
m6A Regulator: Insulin-like growth factor-binding protein 2 (IGFBP2)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05330
Epigenetic Regulator hsa-miR-26a-5p
Regulated Target Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship ncRNA → m6A
Disease Intervertebral disc degeneration
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00605)
NACHT, LRR and PYD domains-containing protein 3 (NLRP3)
N6-methyladenosine (m6A)
In total 54 m6A sequence/site(s) in this target gene
mod ID: M6ASITE095116 Click to Show/Hide the Full List
mod site chr1:247418706-247418707:+ [12]
Sequence TTATATCTCTCAAAGTGGAGACTTTAAAAAAGACTCATCCG
Motif Score 3.319380952
Cell/Tissue List GM12878; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000366497.6; ENST00000391828.7; ENST00000366496.6; ENST00000474792.1; ENST00000336119.7; ENST00000348069.6
External Link RMBase: m6A_site_89494
mod ID: M6ASITE095117 Click to Show/Hide the Full List
mod site chr1:247418718-247418719:+ [12]
Sequence AAGTGGAGACTTTAAAAAAGACTCATCCGTGTGCCGTGTTC
Motif Score 3.319380952
Cell/Tissue List GM12878; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000366497.6; ENST00000336119.7; ENST00000391828.7; ENST00000366496.6; ENST00000348069.6; ENST00000474792.1
External Link RMBase: m6A_site_89495
mod ID: M6ASITE095118 Click to Show/Hide the Full List
mod site chr1:247418761-247418762:+ [12]
Sequence TGCCTGGTATCTTAGTGTGGACCGAAGCCTAAGGACCCTGA
Motif Score 3.622404762
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336119.7; ENST00000474792.1; ENST00000348069.6; ENST00000643234.1; ENST00000366496.6; ENST00000366497.6; ENST00000391828.7
External Link RMBase: m6A_site_89496
mod ID: M6ASITE095119 Click to Show/Hide the Full List
mod site chr1:247418775-247418776:+ [12]
Sequence GTGTGGACCGAAGCCTAAGGACCCTGAAAACAGCTGCAGAT
Motif Score 3.622404762
Cell/Tissue List GM12878; CD8T; MM6; peripheral-blood; iSLK; endometrial; NB4
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000348069.6; ENST00000391828.7; ENST00000643234.1; ENST00000474792.1; ENST00000366496.6; ENST00000366497.6; ENST00000336119.7
External Link RMBase: m6A_site_89497
mod ID: M6ASITE095120 Click to Show/Hide the Full List
mod site chr1:247418784-247418785:+ [12]
Sequence GAAGCCTAAGGACCCTGAAAACAGCTGCAGATGAAGATGGC
Motif Score 2.20572619
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336119.7; ENST00000391828.7; ENST00000366496.6; ENST00000643234.1; ENST00000348069.6; ENST00000366497.6; ENST00000474792.1
External Link RMBase: m6A_site_89498
mod ID: M6ASITE095121 Click to Show/Hide the Full List
mod site chr1:247418840-247418841:+ [13]
Sequence GCTGGCCAGGTACCTGGAGGACCTGGAGGATGTGGACTTGA
Motif Score 3.622404762
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000474792.1; ENST00000391827.2; ENST00000348069.6; ENST00000643234.1; ENST00000391828.7; ENST00000366496.6; ENST00000336119.7; ENST00000366497.6
External Link RMBase: m6A_site_89499
mod ID: M6ASITE095122 Click to Show/Hide the Full List
mod site chr1:247418855-247418856:+ [13]
Sequence GGAGGACCTGGAGGATGTGGACTTGAAGAAATTTAAGATGC
Motif Score 4.065041667
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366497.6; ENST00000643234.1; ENST00000366496.6; ENST00000336119.7; ENST00000391828.7; ENST00000348069.6; ENST00000474792.1; ENST00000391827.2
External Link RMBase: m6A_site_89500
mod ID: M6ASITE095123 Click to Show/Hide the Full List
mod site chr1:247418885-247418886:+ [13]
Sequence ATTTAAGATGCACTTAGAGGACTATCCTCCCCAGAAGGGCT
Motif Score 4.065041667
Cell/Tissue List CD34; GM12878; CD8T; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4; AML
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq; miCLIP
Transcript ID List ENST00000391828.7; ENST00000474792.1; ENST00000366496.6; ENST00000348069.6; ENST00000391827.2; ENST00000336119.7; ENST00000643234.1; ENST00000366497.6
External Link RMBase: m6A_site_89501
mod ID: M6ASITE095124 Click to Show/Hide the Full List
mod site chr1:247418929-247418930:+ [13]
Sequence TCCCCCTCCCGAGGGGTCAGACAGAGAAGGCAGACCATGTG
Motif Score 2.897386905
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000474792.1; ENST00000643234.1; ENST00000391827.2; ENST00000348069.6; ENST00000336119.7; ENST00000366496.6; ENST00000366497.6; ENST00000391828.7
External Link RMBase: m6A_site_89502
mod ID: M6ASITE095125 Click to Show/Hide the Full List
mod site chr1:247418942-247418943:+ [13]
Sequence GGGTCAGACAGAGAAGGCAGACCATGTGGATCTAGCCACGC
Motif Score 2.876744048
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000643234.1; ENST00000366497.6; ENST00000642259.1; ENST00000366496.6; ENST00000336119.7; ENST00000348069.6; ENST00000391828.7; ENST00000391827.2; ENST00000474792.1
External Link RMBase: m6A_site_89503
mod ID: M6ASITE095126 Click to Show/Hide the Full List
mod site chr1:247419038-247419039:+ [13]
Sequence CGCTGCGATCAACAGGAGAGACCTTTATGAGAAAGCAAAAA
Motif Score 2.876744048
Cell/Tissue List CD34; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391827.2; ENST00000366497.6; ENST00000366496.6; ENST00000643234.1; ENST00000474792.1; ENST00000642259.1; ENST00000348069.6; ENST00000391828.7; ENST00000336119.7
External Link RMBase: m6A_site_89504
mod ID: M6ASITE095127 Click to Show/Hide the Full List
mod site chr1:247423277-247423278:+ [13]
Sequence CACTGTGATATGCCAGGAAGACAGCATTGAAGAGGAGTGGA
Motif Score 2.897386905
Cell/Tissue List CD34; MM6; peripheral-blood; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391828.7; ENST00000336119.7; ENST00000643234.1; ENST00000391827.2; ENST00000474792.1; ENST00000642259.1; ENST00000366497.6; ENST00000366496.6; ENST00000348069.6
External Link RMBase: m6A_site_89505
mod ID: M6ASITE095128 Click to Show/Hide the Full List
mod site chr1:247423900-247423901:+ [13]
Sequence CAGATTCCAGTGCATTGAAGACAGGAATGCCCGTCTGGGTG
Motif Score 2.897386905
Cell/Tissue List CD34; peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000643234.1; ENST00000336119.7; ENST00000642259.1; ENST00000474792.1; ENST00000366497.6; ENST00000366496.6; ENST00000391827.2; ENST00000348069.6; ENST00000391828.7
External Link RMBase: m6A_site_89506
mod ID: M6ASITE095129 Click to Show/Hide the Full List
mod site chr1:247424019-247424020:+ [14]
Sequence AGCTTCTGGCCATCGGCAAGACCAAGACGTGTGAGAGCCCC
Motif Score 2.876744048
Cell/Tissue List MM6; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000348069.6; ENST00000643234.1; ENST00000391828.7; ENST00000366496.6; ENST00000642259.1; ENST00000336119.7; ENST00000366497.6; ENST00000391827.2; ENST00000474792.1
External Link RMBase: m6A_site_89507
mod ID: M6ASITE095130 Click to Show/Hide the Full List
mod site chr1:247424139-247424140:+ [12]
Sequence GGGCGGCAGGGATTGGGAAAACAATCCTGGCCAGGAAGATG
Motif Score 2.20572619
Cell/Tissue List GM12878; MM6; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000642259.1; ENST00000366497.6; ENST00000391828.7; ENST00000643234.1; ENST00000336119.7; ENST00000391827.2; ENST00000366496.6; ENST00000474792.1; ENST00000348069.6
External Link RMBase: m6A_site_89508
mod ID: M6ASITE095131 Click to Show/Hide the Full List
mod site chr1:247424167-247424168:+ [12]
Sequence GGCCAGGAAGATGATGTTGGACTGGGCGTCGGGGACACTCT
Motif Score 4.065041667
Cell/Tissue List GM12878; CD8T; MM6; peripheral-blood; TIME; iSLK; endometrial; NB4; AML
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq; miCLIP
Transcript ID List ENST00000336119.7; ENST00000366496.6; ENST00000366497.6; ENST00000391828.7; ENST00000642259.1; ENST00000391827.2; ENST00000348069.6; ENST00000474792.1; ENST00000643234.1
External Link RMBase: m6A_site_89509
mod ID: M6ASITE095132 Click to Show/Hide the Full List
mod site chr1:247424181-247424182:+ [12]
Sequence TGTTGGACTGGGCGTCGGGGACACTCTACCAAGACAGGTTT
Motif Score 3.643047619
Cell/Tissue List GM12878; MM6; peripheral-blood; TIME; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000391827.2; ENST00000366497.6; ENST00000474792.1; ENST00000391828.7; ENST00000336119.7; ENST00000643234.1; ENST00000348069.6; ENST00000366496.6; ENST00000642259.1
External Link RMBase: m6A_site_89510
mod ID: M6ASITE095133 Click to Show/Hide the Full List
mod site chr1:247424194-247424195:+ [12]
Sequence GTCGGGGACACTCTACCAAGACAGGTTTGACTATCTGTTCT
Motif Score 2.897386905
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000391828.7; ENST00000348069.6; ENST00000643234.1; ENST00000336119.7; ENST00000366496.6; ENST00000642259.1; ENST00000391827.2; ENST00000474792.1; ENST00000366497.6
External Link RMBase: m6A_site_89511
mod ID: M6ASITE095134 Click to Show/Hide the Full List
mod site chr1:247424263-247424264:+ [12]
Sequence GACACAGAGGAGCCTGGGGGACCTGATCATGAGCTGCTGCC
Motif Score 3.622404762
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000474792.1; ENST00000391828.7; ENST00000348069.6; ENST00000642259.1; ENST00000366496.6; ENST00000366497.6; ENST00000643234.1; ENST00000336119.7; ENST00000391827.2
External Link RMBase: m6A_site_89512
mod ID: M6ASITE095135 Click to Show/Hide the Full List
mod site chr1:247424293-247424294:+ [12]
Sequence GAGCTGCTGCCCCGACCCAAACCCACCCATCCACAAGATCG
Motif Score 2.185083333
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; TIME; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000391827.2; ENST00000474792.1; ENST00000642259.1; ENST00000366497.6; ENST00000348069.6; ENST00000366496.6; ENST00000391828.7; ENST00000336119.7; ENST00000643234.1
External Link RMBase: m6A_site_89513
mod ID: M6ASITE095136 Click to Show/Hide the Full List
mod site chr1:247424321-247424322:+ [12]
Sequence ATCCACAAGATCGTGAGAAAACCCTCCAGAATCCTCTTCCT
Motif Score 2.185083333
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; TIME; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000348069.6; ENST00000474792.1; ENST00000366496.6; ENST00000643234.1; ENST00000336119.7; ENST00000391828.7; ENST00000366497.6; ENST00000391827.2; ENST00000642259.1
External Link RMBase: m6A_site_89514
mod ID: M6ASITE095137 Click to Show/Hide the Full List
mod site chr1:247424377-247424378:+ [15]
Sequence TGAGCTGCAAGGTGCCTTTGACGAGCACATAGGACCGCTCT
Motif Score 2.833690476
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000336119.7; ENST00000391827.2; ENST00000348069.6; ENST00000366496.6; ENST00000391828.7; ENST00000643234.1; ENST00000366497.6; ENST00000642259.1; ENST00000474792.1
External Link RMBase: m6A_site_89515
mod ID: M6ASITE095138 Click to Show/Hide the Full List
mod site chr1:247424390-247424391:+ [12]
Sequence GCCTTTGACGAGCACATAGGACCGCTCTGCACTGACTGGCA
Motif Score 3.622404762
Cell/Tissue List GM12878; MM6; peripheral-blood; iSLK; TIME; endometrial; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000474792.1; ENST00000643234.1; ENST00000391827.2; ENST00000336119.7; ENST00000642259.1; ENST00000366496.6; ENST00000348069.6; ENST00000366497.6; ENST00000391828.7
External Link RMBase: m6A_site_89516
mod ID: M6ASITE095139 Click to Show/Hide the Full List
mod site chr1:247424428-247424429:+ [12]
Sequence GCAGAAGGCCGAGCGGGGAGACATTCTCCTGAGCAGCCTCA
Motif Score 2.897386905
Cell/Tissue List GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000348069.6; ENST00000366497.6; ENST00000642259.1; ENST00000474792.1; ENST00000391828.7; ENST00000643234.1; ENST00000336119.7; ENST00000366496.6; ENST00000391827.2
External Link RMBase: m6A_site_89517
mod ID: M6ASITE095140 Click to Show/Hide the Full List
mod site chr1:247424495-247424496:+ [12]
Sequence TCTCTGCTCATCACCACGAGACCTGTGGCCCTGGAGAAACT
Motif Score 2.876744048
Cell/Tissue List GM12878; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000643234.1; ENST00000348069.6; ENST00000391828.7; ENST00000642259.1; ENST00000366497.6; ENST00000336119.7; ENST00000391827.2; ENST00000474792.1; ENST00000366496.6
External Link RMBase: m6A_site_89518
mod ID: M6ASITE095141 Click to Show/Hide the Full List
mod site chr1:247424513-247424514:+ [12]
Sequence AGACCTGTGGCCCTGGAGAAACTGCAGCACTTGCTGGACCA
Motif Score 2.627720238
Cell/Tissue List GM12878; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000642259.1; ENST00000366497.6; ENST00000336119.7; ENST00000391828.7; ENST00000391827.2; ENST00000348069.6; ENST00000643234.1; ENST00000474792.1; ENST00000366496.6
External Link RMBase: m6A_site_89519
mod ID: M6ASITE095142 Click to Show/Hide the Full List
mod site chr1:247424530-247424531:+ [12]
Sequence GAAACTGCAGCACTTGCTGGACCATCCTCGGCATGTGGAGA
Motif Score 3.622404762
Cell/Tissue List GM12878; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000642259.1; ENST00000348069.6; ENST00000366496.6; ENST00000391827.2; ENST00000643234.1; ENST00000391828.7; ENST00000336119.7; ENST00000474792.1; ENST00000366497.6
External Link RMBase: m6A_site_89520
mod ID: M6ASITE095143 Click to Show/Hide the Full List
mod site chr1:247424705-247424706:+ [15]
Sequence TGCTGGATCGTGTGCACTGGACTGAAACAGCAGATGGAGAG
Motif Score 4.065041667
Cell/Tissue List CD8T; MM6; peripheral-blood; endometrial; NB4; AML
Seq Type List m6A-CLIP/IP; m6A-seq; miCLIP
Transcript ID List ENST00000643234.1; ENST00000336119.7; ENST00000642259.1; ENST00000391827.2; ENST00000366497.6; ENST00000348069.6; ENST00000474792.1; ENST00000391828.7; ENST00000366496.6
External Link RMBase: m6A_site_89521
mod ID: M6ASITE095144 Click to Show/Hide the Full List
mod site chr1:247424711-247424712:+ [14]
Sequence ATCGTGTGCACTGGACTGAAACAGCAGATGGAGAGTGGCAA
Motif Score 2.20572619
Cell/Tissue List MM6; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391828.7; ENST00000474792.1; ENST00000366497.6; ENST00000391827.2; ENST00000348069.6; ENST00000366496.6; ENST00000642259.1; ENST00000643234.1; ENST00000336119.7
External Link RMBase: m6A_site_89522
mod ID: M6ASITE095145 Click to Show/Hide the Full List
mod site chr1:247424745-247424746:+ [14]
Sequence GTGGCAAGAGCCTTGCCCAGACATCCAAGACCACCACCGCG
Motif Score 2.897386905
Cell/Tissue List MM6; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391828.7; ENST00000642259.1; ENST00000366497.6; ENST00000643234.1; ENST00000336119.7; ENST00000391827.2; ENST00000474792.1; ENST00000366496.6; ENST00000348069.6
External Link RMBase: m6A_site_89523
mod ID: M6ASITE095146 Click to Show/Hide the Full List
mod site chr1:247424754-247424755:+ [14]
Sequence GCCTTGCCCAGACATCCAAGACCACCACCGCGGTGTACGTC
Motif Score 2.876744048
Cell/Tissue List MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000643234.1; ENST00000642259.1; ENST00000336119.7; ENST00000366496.6; ENST00000348069.6; ENST00000391827.2; ENST00000474792.1; ENST00000391828.7; ENST00000366497.6
External Link RMBase: m6A_site_89524
mod ID: M6ASITE095147 Click to Show/Hide the Full List
mod site chr1:247424878-247424879:+ [13]
Sequence GGCTGCAGATGGAATCTGGAACCAGAAAATCCTGTTTGAGG
Motif Score 2.930744048
Cell/Tissue List CD34; MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000366496.6; ENST00000336119.7; ENST00000642259.1; ENST00000348069.6; ENST00000643234.1; ENST00000391827.2; ENST00000474792.1; ENST00000366497.6; ENST00000391828.7
External Link RMBase: m6A_site_89525
mod ID: M6ASITE095148 Click to Show/Hide the Full List
mod site chr1:247424921-247424922:+ [13]
Sequence TCCGACCTCAGGAATCATGGACTGCAGAAGGCGGATGTGTC
Motif Score 4.065041667
Cell/Tissue List CD34; MM6; peripheral-blood; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391827.2; ENST00000336119.7; ENST00000391828.7; ENST00000366497.6; ENST00000366496.6; ENST00000642259.1; ENST00000348069.6; ENST00000643234.1; ENST00000474792.1
External Link RMBase: m6A_site_89526
mod ID: M6ASITE095149 Click to Show/Hide the Full List
mod site chr1:247424959-247424960:+ [13]
Sequence GTCTGCTTTCCTGAGGATGAACCTGTTCCAAAAGGAAGTGG
Motif Score 2.930744048
Cell/Tissue List CD34; MM6; peripheral-blood; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000366497.6; ENST00000366496.6; ENST00000336119.7; ENST00000643234.1; ENST00000348069.6; ENST00000474792.1; ENST00000391828.7; ENST00000642259.1; ENST00000391827.2
External Link RMBase: m6A_site_89527
mod ID: M6ASITE095150 Click to Show/Hide the Full List
mod site chr1:247424980-247424981:+ [12]
Sequence CCTGTTCCAAAAGGAAGTGGACTGCGAGAAGTTCTACAGCT
Motif Score 4.065041667
Cell/Tissue List GM12878; MM6; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000391827.2; ENST00000366497.6; ENST00000643234.1; ENST00000474792.1; ENST00000336119.7; ENST00000348069.6; ENST00000642259.1; ENST00000391828.7; ENST00000366496.6
External Link RMBase: m6A_site_89528
mod ID: M6ASITE095151 Click to Show/Hide the Full List
mod site chr1:247425133-247425134:+ [12]
Sequence CGTGACAGTCCTTCTGGAAAACTATGGCAAATTCGAAAAGG
Motif Score 2.627720238
Cell/Tissue List GM12878; CD8T; MM6; peripheral-blood; NB4
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000391828.7; ENST00000391827.2; ENST00000474792.1; ENST00000643234.1; ENST00000336119.7; ENST00000366497.6; ENST00000348069.6; ENST00000366496.6; ENST00000642259.1
External Link RMBase: m6A_site_89529
mod ID: M6ASITE095152 Click to Show/Hide the Full List
mod site chr1:247425196-247425197:+ [12]
Sequence TTTCCTCTTTGGCCTGGTAAACCAGGAGAGGACCTCCTACT
Motif Score 2.185083333
Cell/Tissue List GM12878; MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000391828.7; ENST00000474792.1; ENST00000336119.7; ENST00000348069.6; ENST00000391827.2; ENST00000366496.6; ENST00000643234.1; ENST00000366497.6; ENST00000642259.1
External Link RMBase: m6A_site_89530
mod ID: M6ASITE095153 Click to Show/Hide the Full List
mod site chr1:247425207-247425208:+ [12]
Sequence GCCTGGTAAACCAGGAGAGGACCTCCTACTTGGAGAAGAAA
Motif Score 3.622404762
Cell/Tissue List GM12878; MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000643234.1; ENST00000348069.6; ENST00000366497.6; ENST00000391828.7; ENST00000391827.2; ENST00000336119.7; ENST00000366496.6; ENST00000642259.1; ENST00000474792.1
External Link RMBase: m6A_site_89531
mod ID: M6ASITE095154 Click to Show/Hide the Full List
mod site chr1:247425364-247425365:+ [13]
Sequence GTACGAGATGCAGGAGGAGGACTTCGTGCAAAGGGCCATGG
Motif Score 4.065041667
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000348069.6; ENST00000391828.7; ENST00000336119.7; ENST00000643234.1; ENST00000366496.6; ENST00000366497.6; ENST00000474792.1; ENST00000391827.2; ENST00000642259.1
External Link RMBase: m6A_site_89532
mod ID: M6ASITE095155 Click to Show/Hide the Full List
mod site chr1:247425385-247425386:+ [13]
Sequence CTTCGTGCAAAGGGCCATGGACTATTTCCCCAAGATTGAGA
Motif Score 4.065041667
Cell/Tissue List CD34; GM12878; CD8T; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4; AML
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq; miCLIP
Transcript ID List ENST00000643234.1; ENST00000348069.6; ENST00000642259.1; ENST00000366496.6; ENST00000391827.2; ENST00000366497.6; ENST00000336119.7; ENST00000391828.7; ENST00000474792.1
External Link RMBase: m6A_site_89533
mod ID: M6ASITE095156 Click to Show/Hide the Full List
mod site chr1:247425427-247425428:+ [13]
Sequence CAATCTCTCCACCAGAATGGACCACATGGTTTCTTCCTTTT
Motif Score 3.622404762
Cell/Tissue List CD34; GM12878; CD8T; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000474792.1; ENST00000366497.6; ENST00000348069.6; ENST00000643234.1; ENST00000391827.2; ENST00000642259.1; ENST00000336119.7; ENST00000366496.6; ENST00000391828.7
External Link RMBase: m6A_site_89534
mod ID: M6ASITE095157 Click to Show/Hide the Full List
mod site chr1:247425457-247425458:+ [13]
Sequence TTCTTCCTTTTGCATTGAGAACTGTCATCGGGTGGAGTCAC
Motif Score 3.373380952
Cell/Tissue List CD34; GM12878; MM6; CD4T; peripheral-blood; iSLK; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000391828.7; ENST00000348069.6; ENST00000366497.6; ENST00000391827.2; ENST00000642259.1; ENST00000336119.7; ENST00000643234.1; ENST00000474792.1; ENST00000366496.6
External Link RMBase: m6A_site_89535
mod ID: M6ASITE095158 Click to Show/Hide the Full List
mod site chr1:247425607-247425608:+ [14]
Sequence CTGTTCTCATGGGTAAGGAAACTCGGCTTCCAGGTGCTTCC
Motif Score 2.627720238
Cell/Tissue List MM6; peripheral-blood; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000348069.6; ENST00000391828.7; ENST00000366497.6; ENST00000474792.1; ENST00000336119.7; ENST00000642259.1; ENST00000391827.2; ENST00000366496.6; ENST00000643234.1
External Link RMBase: m6A_site_89536
mod ID: M6ASITE095159 Click to Show/Hide the Full List
mod site chr1:247425741-247425742:+ [16]
Sequence GCCACCACTGTCTGTTTGAGACTCCTTCATGAGCAAAGATT
Motif Score 3.319380952
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000391827.2; ENST00000348069.6; ENST00000474792.1; ENST00000366496.6; ENST00000642259.1; ENST00000336119.7; ENST00000366497.6; ENST00000643234.1; ENST00000391828.7
External Link RMBase: m6A_site_89537
mod ID: M6ASITE095160 Click to Show/Hide the Full List
mod site chr1:247429592-247429593:+ [16]
Sequence TCTAATTCCTAGATTGGTGAACAGCCACCTCACTTCCAGTT
Motif Score 2.951386905
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000348069.6; ENST00000643234.1; ENST00000391828.7; ENST00000366497.6; ENST00000391827.2; ENST00000642259.1; ENST00000366496.6; ENST00000336119.7
External Link RMBase: m6A_site_89538
mod ID: M6ASITE095161 Click to Show/Hide the Full List
mod site chr1:247429667-247429668:+ [16]
Sequence CCAGAGTCTAACTGAATTGGACCTCAGTGACAATTCTCTGG
Motif Score 3.622404762
Cell/Tissue List peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000643234.1; ENST00000348069.6; ENST00000642259.1; ENST00000391827.2; ENST00000366497.6; ENST00000391828.7; ENST00000336119.7; ENST00000366496.6
External Link RMBase: m6A_site_89539
mod ID: M6ASITE095162 Click to Show/Hide the Full List
mod site chr1:247429691-247429692:+ [16]
Sequence CAGTGACAATTCTCTGGGGGACCCAGGGATGAGAGTGTTGT
Motif Score 3.622404762
Cell/Tissue List peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000391827.2; ENST00000642259.1; ENST00000336119.7; ENST00000643234.1; ENST00000348069.6; ENST00000366496.6; ENST00000391828.7; ENST00000366497.6
External Link RMBase: m6A_site_89540
mod ID: M6ASITE095163 Click to Show/Hide the Full List
mod site chr1:247434185-247434186:+ [16]
Sequence CCAGAAGCTGGTGGAGCTGGACCTGAGTGACAACGCCCTCG
Motif Score 3.622404762
Cell/Tissue List peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000348069.6; ENST00000366496.6; ENST00000336119.7; ENST00000643234.1; ENST00000391827.2; ENST00000642259.1; ENST00000366497.6; ENST00000391828.7
External Link RMBase: m6A_site_89541
mod ID: M6ASITE095164 Click to Show/Hide the Full List
mod site chr1:247434222-247434223:+ [16]
Sequence CTCGGTGACTTCGGAATCAGACTTCTGTGTGTGGGACTGAA
Motif Score 3.319380952
Cell/Tissue List peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000336119.7; ENST00000366496.6; ENST00000391828.7; ENST00000366497.6; ENST00000348069.6; ENST00000642259.1; ENST00000643234.1; ENST00000391827.2
External Link RMBase: m6A_site_89542
mod ID: M6ASITE095165 Click to Show/Hide the Full List
mod site chr1:247434237-247434238:+ [16]
Sequence ATCAGACTTCTGTGTGTGGGACTGAAGCACCTGTTGTGCAA
Motif Score 4.065041667
Cell/Tissue List peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000642259.1; ENST00000366496.6; ENST00000348069.6; ENST00000366497.6; ENST00000391828.7; ENST00000391827.2; ENST00000643234.1; ENST00000336119.7
External Link RMBase: m6A_site_89543
mod ID: M6ASITE095166 Click to Show/Hide the Full List
mod site chr1:247436047-247436048:+ [17]
Sequence ACCAGCCATTCCCTGACCAGACTCTATGTGGGGGAGAATGC
Motif Score 3.319380952
Cell/Tissue List MM6
Seq Type List m6A-seq
Transcript ID List ENST00000391828.7; ENST00000366496.6; ENST00000348069.6; ENST00000336119.7; ENST00000642259.1; ENST00000643234.1; ENST00000391827.2; ENST00000366497.6
External Link RMBase: m6A_site_89544
mod ID: M6ASITE095167 Click to Show/Hide the Full List
mod site chr1:247448596-247448597:+ [13]
Sequence TGCGATCCATCCAGGCCAAGACCACAGCTCTGTGATCCTTC
Motif Score 2.876744048
Cell/Tissue List CD34; MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000366496.6; ENST00000642259.1; ENST00000366497.6; ENST00000348069.6; ENST00000336119.7; ENST00000391828.7
External Link RMBase: m6A_site_89545
mod ID: M6ASITE095168 Click to Show/Hide the Full List
mod site chr1:247448701-247448702:+ [14]
Sequence TTTACGCCAGGGTGAGGAAGACACCAGGACAATGACAGCAT
Motif Score 2.897386905
Cell/Tissue List MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000642259.1; ENST00000391828.7; ENST00000366496.6; ENST00000348069.6; ENST00000366497.6; ENST00000336119.7
External Link RMBase: m6A_site_89546
mod ID: M6ASITE095169 Click to Show/Hide the Full List
mod site chr1:247448709-247448710:+ [14]
Sequence AGGGTGAGGAAGACACCAGGACAATGACAGCATCGGGTGTT
Motif Score 3.643047619
Cell/Tissue List MM6; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000348069.6; ENST00000336119.7; ENST00000391828.7; ENST00000366497.6; ENST00000366496.6; ENST00000642259.1
External Link RMBase: m6A_site_89547