m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00451)

Target Name	Transcriptional coactivator YAP1 (YAP1)
Synonyms	Yes-associated protein 1; Protein yorkie homolog; Yes-associated protein YAP65 homolog; YAP65 Click to Show/Hide
Gene Name	YAP1
Chromosomal Location	11q22.1
Family	YAP1 family
Function	Transcriptional regulator which can act both as a coactivator and a corepressor and is the critical downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Plays a key role in tissue tension and 3D tissue shape by regulating cortical actomyosin network formation. Acts via ARHGAP18, a Rho GTPase activating protein that suppresses F-actin polymerization. Plays a key role in controlling cell proliferation in response to cell contact. Phosphorylation of YAP1 by LATS1/2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration . The presence of TEAD transcription factors are required for it to stimulate gene expression, cell growth, anchorage-independent growth, and epithelial mesenchymal transition (EMT) induction. Suppresses ciliogenesis via acting as a transcriptional corepressor of the TEAD4 target genes AURKA and PLK1. In conjunction with WWTR1, involved in the regulation of TGFB1-dependent SMAD2 and SMAD3 nuclear accumulation (By similarity); [Isoform 2]: Activates the C-terminal fragment (CTF) of ERBB4 (isoform 3). Click to Show/Hide
Gene ID	10413
Uniprot ID	YAP1_HUMAN
HGNC ID	HGNC:16262
KEGG ID	hsa:10413

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

YAP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LNCaP cell line	Homo sapiens
Treatment: shMETTL3 LNCaP cells Control: shControl LNCaP cells		GSE147884
Regulation		logFC: 6.80E-01 p-value: 6.99E-58
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between YAP1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.22E+00	GSE60213

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The expression of m6A and METTL3 was upregulated in human gastric cancer tissues and gastric cancer cell lines. m6A methyltransferase METTL3 promoted the proliferation and migration of gastric cancer cells through the m6A modification of Transcriptional coactivator YAP1 (YAP1).
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Cell Process	Cell proliferation
Cell Process	Cell metastasis
In-vitro Model	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3-induced circ1662 promoted colorectal cancer cell invasion and migration by accelerating Transcriptional coactivator YAP1 (YAP1) nuclear transport. Circ1662 enhanced CRC invasion and migration depending on YAP1 and SMAD3. This result implies that circ1662 is a new prognostic and therapeutic marker for CRC metastasis.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell invasion
Cell Process	Cell migration
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
In-vivo Model	BALB/c nude mice (4 weeks old) were acquired from Vital River Laboratory (Beijing, China). HCT116 cells with stable circ1662 expression (2 × 10⁶ in 100 L of PBS) were injected via the tail vein. After 45 days, the mice were sacrificed. The lung metastatic carcinoma specimens were processed into paraffin-embedded sections for subsequent H&E staining and IHC.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	m6A methylation plays a key role in VM formation in HCC. METTL3 and Transcriptional coactivator YAP1 (YAP1) could be potential therapeutic targets via impairing VM formation in anti-metastatic strategies.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell migration and invasion
In-vitro Model	Homo sapiens (SK-HEP-1-Luc (luciferase labeled) cells were obtained from OBIO (Shanghai, China).)
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	1 × 10⁷ SK-HEP-1-Luc-shControl or SK-HEP-1-Luc-shMETTL3 stable cells were suspended in 300 uL of PBS and injected orthotopically into the left liver lobe of nude mice.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shNC AGS		GSE166972
Regulation		logFC: 3.89E+00 p-value: 1.09E-02
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between YAP1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.35E+00	GSE63591

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Target Regulation	Up regulation
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	YTHDF1 knockdown alleviated the progression of renal fibrosis both in cultured cells induced by transforming growth factor-beta administration and in the UUO mouse model. Transcriptional coactivator YAP1 (YAP1) was accordingly down-regulated when YTHDF1 was inhibited.
Target Regulation	Up regulation
Responsed Disease	Kidney disorders		ICD-11: GB90	Disease Info

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	GSC11 cell line	Homo sapiens
Treatment: siYTHDF2 GSC11 cells Control: siControl GSC11 cells		GSE142825
Regulation		logFC: 7.52E-01 p-value: 2.51E-07
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between YAP1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.34E+00	GSE49339

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	YTHDF2 knockdown significantly increases the total YAP expression, but inhibits TGF-beta/Smad signaling, indicating that YTHDF2 regulates EMT probably via Transcriptional coactivator YAP1 (YAP1) signaling. YTHDF2 is a new predictive biomarker of development of pancreatic cancer.
Target Regulation	Down regulation
Responsed Disease	Pancreatic cancer		ICD-11: 2C10	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	Epithelial-mesenchymal transition
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	PaTu 8988s	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1846
	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	Cerebral cortex	Mus musculus
Treatment: METTL3 (f/f, Emx1-cre) cerebral cortex Control: Wild type cerebral cortex		GSE154992
Regulation		logFC: 6.87E-01 p-value: 5.76E-08
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[8]
Response Summary	Stable knockdown of FTO inhibited OSCC cell viability, colony formation, and tumor growth. Further, FTO depletion increased Transcriptional coactivator YAP1 (YAP1) m6A modification at mRNA 3'-untranslated region, accelerating the degradation of YAP1 mRNA, a well-documented oncogene promoting OSCC progression.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma	ICD-11: 2B6E.0	Disease Info
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene			[9]
Response Summary	FTO down-expressed in myocardial IRI mice and hypoxia/reoxygenation (H/R)-induced cardiomyocytes. Moreover, FTO uninstalled the methylation of Transcriptional coactivator YAP1 (YAP1) mRNA, and enforced the stability of Yap1 mRNA.The study reveals the role of FTO in H/R-induced myocardial cell injury via m6A-dependent manner, which provided a new approach to improve myocardial IRI.
Target Regulation	Up regulation
Responsed Disease	Ischemic heart disease	ICD-11: BA40-BA6Z	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	Neonatal rat ventricular cardiomyocytes (Primary myocyte cells)
In-vivo Model	After anesthesia (50 mg/kg pentobarbital sodium, intraperitoneal injection), the left thorax was cut to expose the heart, and the left anterior descending (LAD) coronary artery was ligated by 7/0 sterile suture. Myocardial ischemia was induced by 30 min of LAD coronary artery ligation and following 2 h of reperfusion. Sham group mice underwent the same surgical procedure without LAD coronary artery ligation.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: 1.32E+00 p-value: 8.59E-29
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[10]
Response Summary	METTL14 promotes renal ischemic reperfusion injury via suppressing Transcriptional coactivator YAP1 (YAP1).
Target Regulation	Down regulation
Responsed Disease	Injury of kidney		ICD-11: NB92.0	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell proliferation and metastasis
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	143B cell line	Homo sapiens
Treatment: siALKBH5 transfected 143B cells Control: siControl 143B cells		GSE154528
Regulation		logFC: -6.56E-01 p-value: 3.77E-04
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Target Regulation	Down regulation
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	m6A demethylase ALKBH5 inhibits tumor growth and metastasis by reducing YTHDFs-mediated Transcriptional coactivator YAP1 (YAP1) expression and inhibiting miR-107/LATS2-mediated YAP activity in non-small cell lung cancer.
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Cell Process	Cell proliferation
	Cell invasion
	Cell migration
	Cell EMT
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	For the experiments, mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into indicated groups (five mice per group). To assess the in vivo effects of cycloleucine, the xenografted tumors had reached approximately 5 mm in diameter from mice and then these xenografted mice were feed with Vehicle or cycloleucine (25 mg/kg twice weekly) and tumor volume were measured every 3 day. Tumor volume was estimated as 0.5 × a² × b (where a and b represent a tumors short and long diameter, respectively). Mice were euthanized after 7 weeks and the tumors were measured a final time.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	ALKBH5-mediated m6A demethylation improved the mRNA stability of YTH N6-methyladenosine RNA-binding protein 1 (YTHDF1), thereby increasing its expression, which consequently promoted the translation of Transcriptional coactivator YAP1 (YAP1).This finding suggests a novel potential therapeutic strategy for myocardial infarction cardiac regeneration.
Target Regulation	Up regulation
Responsed Disease	Acute myocardial infarction		ICD-11: BA41	Disease Info
In-vivo Model	Cas9 and sgRNA were microinjected into the fertilized eggs of C57BL/6J mice, which were then transplanted to obtain positive F0 mice. The statuses of F0 mice were confirmed by PCR and sequencing. Next, positive F0 mice were mated with C57BL/6J mice to yield stable F1 generation mice. F1 and F2 transgenic mice were used in this study.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between YAP1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.33E+00	GSE86214

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Eukaryotic initiation factor 3 (EIF3A) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[11]
Response Summary	YTHDF1 promoted Transcriptional coactivator YAP1 (YAP1) mRNA translation by interacting with eIF3a in NSCLC.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	3 to 5-week old female BALB/c athymic (NU/NU) nude mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into indicated groups (five mice per group). To assess the in vivo effects of cycloleucine, the xenografted tumors had reached approximately 5 mm in diameter from mice and then these xenografted mice were feed with Vehicle or cycloleucine (25 mg/kg twice weekly) and tumor volume were measured every 3 day.

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[13]
Response Summary	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of Transcriptional coactivator YAP1 (YAP1), thus affecting the cell cycle of colorectal cancer, inhibiting cell apoptosis, and promoting proliferation.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell apoptosis
In-vitro Model	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of YAP, thus affecting the cell cycle of CRC, inhibiting cell apoptosis, and promoting proliferation.

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[20]
Response Summary	High YTHDC2 was strongly positively correlated with high Transcriptional coactivator YAP1 (YAP1) in clinical GC tissues, YTHDC2 is a novel oncogene in GC, which provides the theoretical basis for the strategy of targeting YTHDC2 for GC patients.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
In-vitro Model	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	They were subcutaneously and caudal vein injected with YTHDC2 knockout AGS cells, respectively. After 7 weeks, the mice were sacrificed and tumor size and lung metastasis nodules were recorded.

Osteosarcoma [ICD-11: 2B51]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.
Experiment 2 Reporting the m6A-centered Disease Response				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.
Experiment 3 Reporting the m6A-centered Disease Response				[5]
Response Summary	ALKBH5 is an anti-tumor factor or a pro-apoptotic factor, acting at least partially by suppressing Transcriptional coactivator YAP1 (YAP1) expression through dual mechanisms with direct m6A methylation of YAP and indirect downregulation of YAP level due to methylation of pre-miR-181b-1. Further results revealed that m6A methylated pre-miR-181b-1 was subsequently recognized by m6A-binding protein YTHDF2 to mediate RNA degradation. However, methylated YAP transcripts were recognized by YTHDF1 to promote its translation. ALKBH5 overexpression was considered a new approach of replacement therapy for osteosarcoma treatment.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Cell Process	Cell growth
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
In-vivo Model	Three-week-old BABL/c female nude mice were randomized into three groups. 5 × 10⁶ 143B cells were subcutaneously injected in mice, and the tumor volume was assessed every 2 weeks. Eight weeks after injection, the animals were killed. The xenograft tumors were harvested and the tumor volumes were calculated by the standard formula: length × width²/2.

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[8]
Response Summary	Stable knockdown of FTO inhibited OSCC cell viability, colony formation, and tumor growth. Further, FTO depletion increased Transcriptional coactivator YAP1 (YAP1) m6A modification at mRNA 3'-untranslated region, accelerating the degradation of YAP1 mRNA, a well-documented oncogene promoting OSCC progression.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Up regulation

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The expression of m6A and METTL3 was upregulated in human gastric cancer tissues and gastric cancer cell lines. m6A methyltransferase METTL3 promoted the proliferation and migration of gastric cancer cells through the m6A modification of Transcriptional coactivator YAP1 (YAP1).
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
Cell Process	Cell metastasis
In-vitro Model	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
Experiment 2 Reporting the m6A-centered Disease Response				[20]
Response Summary	High YTHDC2 was strongly positively correlated with high Transcriptional coactivator YAP1 (YAP1) in clinical GC tissues, YTHDC2 is a novel oncogene in GC, which provides the theoretical basis for the strategy of targeting YTHDC2 for GC patients.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	They were subcutaneously and caudal vein injected with YTHDC2 knockout AGS cells, respectively. After 7 weeks, the mice were sacrificed and tumor size and lung metastasis nodules were recorded.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[13]
Response Summary	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of Transcriptional coactivator YAP1 (YAP1), thus affecting the cell cycle of colorectal cancer, inhibiting cell apoptosis, and promoting proliferation.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell apoptosis
In-vitro Model	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of YAP, thus affecting the cell cycle of CRC, inhibiting cell apoptosis, and promoting proliferation.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3-induced circ1662 promoted colorectal cancer cell invasion and migration by accelerating Transcriptional coactivator YAP1 (YAP1) nuclear transport. Circ1662 enhanced CRC invasion and migration depending on YAP1 and SMAD3. This result implies that circ1662 is a new prognostic and therapeutic marker for CRC metastasis.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell invasion
Cell Process	Cell migration
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
In-vivo Model	BALB/c nude mice (4 weeks old) were acquired from Vital River Laboratory (Beijing, China). HCT116 cells with stable circ1662 expression (2 × 10⁶ in 100 L of PBS) were injected via the tail vein. After 45 days, the mice were sacrificed. The lung metastatic carcinoma specimens were processed into paraffin-embedded sections for subsequent H&E staining and IHC.

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	YTHDF2 knockdown significantly increases the total YAP expression, but inhibits TGF-beta/Smad signaling, indicating that YTHDF2 regulates EMT probably via Transcriptional coactivator YAP1 (YAP1) signaling. YTHDF2 is a new predictive biomarker of development of pancreatic cancer.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	Epithelial-mesenchymal transition
In-vitro Model	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	PaTu 8988s	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1846
	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	m6A methylation plays a key role in VM formation in HCC. METTL3 and Transcriptional coactivator YAP1 (YAP1) could be potential therapeutic targets via impairing VM formation in anti-metastatic strategies.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell migration and invasion
In-vitro Model	Homo sapiens (SK-HEP-1-Luc (luciferase labeled) cells were obtained from OBIO (Shanghai, China).)
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	1 × 10⁷ SK-HEP-1-Luc-shControl or SK-HEP-1-Luc-shMETTL3 stable cells were suspended in 300 uL of PBS and injected orthotopically into the left liver lobe of nude mice.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 5 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[11]
Response Summary	YTHDF1 promoted Transcriptional coactivator YAP1 (YAP1) mRNA translation by interacting with eIF3a in NSCLC.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Eukaryotic initiation factor 3 (EIF3A)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	3 to 5-week old female BALB/c athymic (NU/NU) nude mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into indicated groups (five mice per group). To assess the in vivo effects of cycloleucine, the xenografted tumors had reached approximately 5 mm in diameter from mice and then these xenografted mice were feed with Vehicle or cycloleucine (25 mg/kg twice weekly) and tumor volume were measured every 3 day.
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 3 Reporting the m6A-centered Disease Response				[11]
Response Summary	m6A demethylase ALKBH5 inhibits tumor growth and metastasis by reducing YTHDFs-mediated Transcriptional coactivator YAP1 (YAP1) expression and inhibiting miR-107/LATS2-mediated YAP activity in non-small cell lung cancer.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Cell Process	Cell proliferation
	Cell invasion
	Cell migration
	Cell EMT
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	For the experiments, mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into indicated groups (five mice per group). To assess the in vivo effects of cycloleucine, the xenografted tumors had reached approximately 5 mm in diameter from mice and then these xenografted mice were feed with Vehicle or cycloleucine (25 mg/kg twice weekly) and tumor volume were measured every 3 day. Tumor volume was estimated as 0.5 × a² × b (where a and b represent a tumors short and long diameter, respectively). Mice were euthanized after 7 weeks and the tumors were measured a final time.
Experiment 4 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 5 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Ischemic heart disease [ICD-11: BA40-BA6Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[9]
Response Summary	FTO down-expressed in myocardial IRI mice and hypoxia/reoxygenation (H/R)-induced cardiomyocytes. Moreover, FTO uninstalled the methylation of Transcriptional coactivator YAP1 (YAP1) mRNA, and enforced the stability of Yap1 mRNA.The study reveals the role of FTO in H/R-induced myocardial cell injury via m6A-dependent manner, which provided a new approach to improve myocardial IRI.
Responsed Disease	Ischemic heart disease [ICD-11: BA40-BA6Z]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis
In-vitro Model	Neonatal rat ventricular cardiomyocytes (Primary myocyte cells)
In-vivo Model	After anesthesia (50 mg/kg pentobarbital sodium, intraperitoneal injection), the left thorax was cut to expose the heart, and the left anterior descending (LAD) coronary artery was ligated by 7/0 sterile suture. Myocardial ischemia was induced by 30 min of LAD coronary artery ligation and following 2 h of reperfusion. Sham group mice underwent the same surgical procedure without LAD coronary artery ligation.

Acute myocardial infarction [ICD-11: BA41]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[12]
Response Summary	ALKBH5-mediated m6A demethylation improved the mRNA stability of YTH N6-methyladenosine RNA-binding protein 1 (YTHDF1), thereby increasing its expression, which consequently promoted the translation of Transcriptional coactivator YAP1 (YAP1).This finding suggests a novel potential therapeutic strategy for myocardial infarction cardiac regeneration.
Responsed Disease	Acute myocardial infarction [ICD-11: BA41]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)	ERASER	Regulator Info
Target Regulation	Up regulation
In-vivo Model	Cas9 and sgRNA were microinjected into the fertilized eggs of C57BL/6J mice, which were then transplanted to obtain positive F0 mice. The statuses of F0 mice were confirmed by PCR and sequencing. Next, positive F0 mice were mated with C57BL/6J mice to yield stable F1 generation mice. F1 and F2 transgenic mice were used in this study.

Kidney disorders [ICD-11: GB90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[6]
Response Summary	YTHDF1 knockdown alleviated the progression of renal fibrosis both in cultured cells induced by transforming growth factor-beta administration and in the UUO mouse model. Transcriptional coactivator YAP1 (YAP1) was accordingly down-regulated when YTHDF1 was inhibited.
Responsed Disease	Kidney disorders [ICD-11: GB90]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation

Urinary/pelvic organs injury [ICD-11: NB92]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[10]
Response Summary	METTL14 promotes renal ischemic reperfusion injury via suppressing Transcriptional coactivator YAP1 (YAP1).
Responsed Disease	Injury of kidney [ICD-11: NB92.0]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell proliferation and metastasis
In-vitro Model	HK2	Normal	Acipenser baerii	CVCL_YE28

Cisplatin [Approved]

Drug Info

In total 3 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 2 Reporting the m6A-centered Drug Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.
Experiment 3 Reporting the m6A-centered Drug Response				[4]
Response Summary	METTL3, YTHDF3, YTHDF1, and eIF3b directly promoted YAP translation through an interaction with the translation initiation machinery. METTL3 knockdown inhibits tumor growth and enhances sensitivity to DDP in vivo.m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-Transcriptional coactivator YAP1 (YAP1) axis to induce Non-small cell lung cancer drug resistance and metastasis.
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Metabolic
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
In-vivo Model	Mice were injected with 5 × 10⁶ lung cancer cells with stably expression of relevant plasmids and randomly divided into two groups (five mice per group) after the diameter of the xenografted tumors had reached approximately 5 mm in diameter. Xenografted mice were then administrated with PBS or DDP (3 mg/kg per day) for three times a week, and tumor volume were measured every second day.

Temozolomide [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[13]
Response Summary	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of Transcriptional coactivator YAP1 (YAP1), thus affecting the cell cycle of colorectal cancer, inhibiting cell apoptosis, and promoting proliferation.
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell apoptosis
In-vitro Model	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	IGF2BP2 activates the expression of ErbB2 by recognizing the m6A of YAP, thus affecting the cell cycle of CRC, inhibiting cell apoptosis, and promoting proliferation.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03139		Crosstalk Info
Epigenetic Regulator	Lysine-specific histone demethylase 1A (KDM1A)
Regulated Target	Histone H3 lysine 4 dimethylation (H3K4me2)
Crosstalk relationship	Histone modification → m6A
Disease	Triple-negative breast cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03140		Crosstalk Info
Epigenetic Regulator	Lysine-specific histone demethylase 1A (KDM1A)
Regulated Target	Histone H3 lysine 4 dimethylation (H3K4me2)
Crosstalk relationship	Histone modification → m6A
Disease	Triple-negative breast cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03555		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03600		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03658		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05091		Crosstalk Info
Epigenetic Regulator	piR-31115
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Triple-negative breast cancer	Disease Info
Crosstalk ID: M6ACROT05190		Crosstalk Info
Epigenetic Regulator	Circ_PACRGL
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Drug	Trans-3,5,4'-trimethoxystilbene	Drug Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05092		Crosstalk Info
Epigenetic Regulator	piR31115
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Triple-negative breast cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00451)

Transcriptional coactivator YAP1 (YAP1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000166		Click to Show/Hide the Full List
mod site	chr11:102223685-102223686:+
Sequence	TGGGACTCAAAATCCAGTGTCTTCTCCCGGGATGTCTCAGG
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000629586.2; ENST00000529029.1; ENST00000282441.10; ENST00000524575.5; ENST00000531439.5; ENST00000526343.5; ENST00000615667.4; ENST00000345877.6; ENST00000537274.5
External Link	RMBase: ac4C_site_359

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005167		Click to Show/Hide the Full List
mod site	chr11:102165002-102165003:+		[21]
Sequence	AAAGTGTTGGGATTACAGGCATGAGCCACCATGTCCAGCCG
Transcript ID List	ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000282441.10; ENST00000537274.5; ENST00000526594.1; ENST00000531439.5; ENST00000526343.5; ENST00000629586.2
External Link	RMBase: RNA-editing_site_24811
mod ID: A2ISITE005168		Click to Show/Hide the Full List
mod site	chr11:102172566-102172567:+		[21]
Sequence	TGGCAGCTTTTCTGGGGATTACATGTGTGAGCCACCACACT
Transcript ID List	ENST00000629586.2; ENST00000526594.1; ENST00000345877.6; ENST00000526343.5; ENST00000615667.4; ENST00000524575.5; ENST00000531439.5; ENST00000537274.5; ENST00000282441.10
External Link	RMBase: RNA-editing_site_24812
mod ID: A2ISITE005169		Click to Show/Hide the Full List
mod site	chr11:102180188-102180189:+		[21]
Sequence	CCGGCTAATTTTGTAGTTTTAGTAGAGATGGGGTTTCACCA
Transcript ID List	ENST00000629586.2; ENST00000537274.5; ENST00000345877.6; ENST00000531439.5; ENST00000524575.5; ENST00000526343.5; ENST00000615667.4; ENST00000282441.10; ENST00000526594.1
External Link	RMBase: RNA-editing_site_24813
mod ID: A2ISITE005170		Click to Show/Hide the Full List
mod site	chr11:102212118-102212119:+		[21]
Sequence	GTATAAAGACATCACTCAGTATCTGAACACTAGACGCTGTT
Transcript ID List	ENST00000615667.4; ENST00000524575.5; ENST00000531439.5; ENST00000629586.2; ENST00000526343.5; ENST00000282441.10; ENST00000537274.5; ENST00000529029.1; ENST00000345877.6
External Link	RMBase: RNA-editing_site_24814

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005325		Click to Show/Hide the Full List
mod site	chr11:102110831-102110832:+		[22]
Sequence	CTGGGTCAGGGGGTGCGCGTCGGGGGAGGCAGAAGCCATGG
Cell/Tissue List	HeLa; T24
Seq Type List	m5C-RIP-seq; Bisulfite-seq
Transcript ID List	ENST00000345877.6; ENST00000537274.5; ENST00000282441.10; ENST00000526343.5; ENST00000615667.4
External Link	RMBase: m5C_site_8882
mod ID: M5CSITE005326		Click to Show/Hide the Full List
mod site	chr11:102231157-102231158:+		[22]
Sequence	TCTGATGAATTGGAAAGGAGCAAACCAGAAATGGCTTTATT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000345877.6; ENST00000615667.4; ENST00000282441.10; ENST00000537274.5
External Link	RMBase: m5C_site_8883
mod ID: M5CSITE005327		Click to Show/Hide the Full List
mod site	chr11:102231162-102231163:+		[22]
Sequence	TGAATTGGAAAGGAGCAAACCAGAAATGGCTTTATTTTCTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000345877.6; ENST00000615667.4
External Link	RMBase: m5C_site_8884

N6-methyladenosine (m6A)

In total 95 m6A sequence/site(s) in this target gene
mod ID: M6ASITE008157		Click to Show/Hide the Full List
mod site	chr11:102110496-102110497:+		[23]
Sequence	AGAAAGGGAGGAAGGAAGGAACAAGAAAAGGAAATAAAGAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615667.4; ENST00000526343.5; ENST00000282441.10; rmsk_3640863; ENST00000537274.5; ENST00000345877.6
External Link	RMBase: m6A_site_160909
mod ID: M6ASITE008158		Click to Show/Hide the Full List
mod site	chr11:102110638-102110639:+		[23]
Sequence	TCCCGAGGCGCAGCCGCCAGACCAGTGGAGCCGGGGCGCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; U2OS; H1A; H1B; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537274.5; ENST00000615667.4; ENST00000345877.6; ENST00000282441.10; ENST00000526343.5
External Link	RMBase: m6A_site_160910
mod ID: M6ASITE008159		Click to Show/Hide the Full List
mod site	chr11:102110728-102110729:+		[23]
Sequence	CCCCGGCCCTGAGAGCGAGGACAGCGCCGCCCGGCCCGCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; U2OS; GSC-11; HEK293T; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526343.5; ENST00000345877.6; ENST00000615667.4; ENST00000282441.10; ENST00000537274.5
External Link	RMBase: m6A_site_160911
mod ID: M6ASITE008160		Click to Show/Hide the Full List
mod site	chr11:102110943-102110944:+		[23]
Sequence	GGGCAGGGCCCGCCGTCCGGACCCGGGCAACCGGCACCCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000345877.6; ENST00000526343.5; ENST00000629586.2; ENST00000531439.5; ENST00000615667.4
External Link	RMBase: m6A_site_160912
mod ID: M6ASITE008161		Click to Show/Hide the Full List
mod site	chr11:102111026-102111027:+		[23]
Sequence	GATCGTGCACGTCCGCGGGGACTCGGAGACCGACCTGGAGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531439.5; ENST00000345877.6; ENST00000526343.5; ENST00000629586.2; ENST00000615667.4; ENST00000282441.10; ENST00000537274.5
External Link	RMBase: m6A_site_160913
mod ID: M6ASITE008162		Click to Show/Hide the Full List
mod site	chr11:102111034-102111035:+		[23]
Sequence	ACGTCCGCGGGGACTCGGAGACCGACCTGGAGGCGCTCTTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000531439.5; ENST00000615667.4; ENST00000345877.6; ENST00000629586.2; ENST00000526343.5
External Link	RMBase: m6A_site_160914
mod ID: M6ASITE008163		Click to Show/Hide the Full List
mod site	chr11:102111068-102111069:+		[23]
Sequence	GCTCTTCAACGCCGTCATGAACCCCAAGACGGCCAACGTGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615667.4; ENST00000629586.2; ENST00000345877.6; ENST00000537274.5; ENST00000282441.10; ENST00000526343.5; ENST00000531439.5
External Link	RMBase: m6A_site_160915
mod ID: M6ASITE008164		Click to Show/Hide the Full List
mod site	chr11:102111094-102111095:+		[23]
Sequence	AGACGGCCAACGTGCCCCAGACCGTGCCCATGAGGCTCCGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000345877.6; ENST00000526343.5; ENST00000629586.2; ENST00000537274.5; ENST00000615667.4; ENST00000282441.10; ENST00000531439.5
External Link	RMBase: m6A_site_160916
mod ID: M6ASITE008165		Click to Show/Hide the Full List
mod site	chr11:102112625-102112626:+		[23]
Sequence	TGTATAGTCTCCTGTCGGAGACCAAAGGGTTTTGGAACTCA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000524575.5; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5; ENST00000531439.5; ENST00000282441.10; ENST00000526343.5; ENST00000629586.2
External Link	RMBase: m6A_site_160917
mod ID: M6ASITE008166		Click to Show/Hide the Full List
mod site	chr11:102112641-102112642:+		[23]
Sequence	GGAGACCAAAGGGTTTTGGAACTCAGAAAAAATCACTTAAC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000345877.6; ENST00000537274.5; ENST00000526343.5; ENST00000524575.5; ENST00000531439.5; ENST00000282441.10; ENST00000629586.2
External Link	RMBase: m6A_site_160918
mod ID: M6ASITE008167		Click to Show/Hide the Full List
mod site	chr11:102112726-102112727:+		[24]
Sequence	CAATTTAGCTGCTTGCCTAAACACTTCAATTTGTCTTAGGT
Motif Score	2.20572619
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000526343.5; ENST00000524575.5; ENST00000615667.4; ENST00000531439.5; ENST00000537274.5; ENST00000345877.6; ENST00000629586.2; ENST00000282441.10
External Link	RMBase: m6A_site_160919
mod ID: M6ASITE008168		Click to Show/Hide the Full List
mod site	chr11:102114242-102114243:+		[23]
Sequence	TGGGAGCTGTTTCTCCTGGGACACTGACCCCCACTGGAGTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000531439.5; ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000537274.5; ENST00000282441.10; ENST00000526343.5; ENST00000629586.2
External Link	RMBase: m6A_site_160920
mod ID: M6ASITE008169		Click to Show/Hide the Full List
mod site	chr11:102114365-102114366:+		[23]
Sequence	CAGGTTGGGAGATGGCAAAGACATCTTCTGGTCAGAGATAC
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000629586.2; ENST00000526343.5; ENST00000615667.4; ENST00000524575.5; ENST00000345877.6; ENST00000531439.5
External Link	RMBase: m6A_site_160921
mod ID: M6ASITE008170		Click to Show/Hide the Full List
mod site	chr11:102162468-102162469:+		[23]
Sequence	GTCTTAGTCACATCGATCAGACAACAACATGGCAGGACCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000531439.5; ENST00000526343.5; ENST00000526594.1; ENST00000629586.2; ENST00000537274.5; ENST00000345877.6; ENST00000282441.10; ENST00000615667.4; ENST00000524575.5
External Link	RMBase: m6A_site_160922
mod ID: M6ASITE008171		Click to Show/Hide the Full List
mod site	chr11:102162484-102162485:+		[23]
Sequence	TCAGACAACAACATGGCAGGACCCCAGGAAGGCCATGCTGT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000531439.5; ENST00000524575.5; ENST00000526343.5; ENST00000345877.6; ENST00000282441.10; ENST00000537274.5; ENST00000629586.2; ENST00000526594.1; ENST00000615667.4
External Link	RMBase: m6A_site_160923
mod ID: M6ASITE008172		Click to Show/Hide the Full List
mod site	chr11:102162559-102162560:+		[23]
Sequence	AGTGCAGCAGAATATGATGAACTCGGCTTCAGGTGAGTGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000531439.5; ENST00000629586.2; ENST00000526594.1; ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000526343.5
External Link	RMBase: m6A_site_160924
mod ID: M6ASITE008173		Click to Show/Hide the Full List
mod site	chr11:102186039-102186040:+		[23]
Sequence	CCTCTTCCTGATGGATGGGAACAAGCCATGACTCAGGATGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000524575.5; ENST00000526343.5; ENST00000531439.5; ENST00000345877.6; ENST00000629586.2; ENST00000282441.10; ENST00000526594.1; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160925
mod ID: M6ASITE008174		Click to Show/Hide the Full List
mod site	chr11:102186077-102186078:+		[23]
Sequence	TGGAGAAATTTACTATATAAACCATAAGAACAAGACCACCT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000526343.5; ENST00000531439.5; ENST00000537274.5; ENST00000615667.4; ENST00000345877.6; ENST00000282441.10; ENST00000526594.1; ENST00000524575.5; ENST00000629586.2
External Link	RMBase: m6A_site_160926
mod ID: M6ASITE008175		Click to Show/Hide the Full List
mod site	chr11:102186086-102186087:+		[23]
Sequence	TTACTATATAAACCATAAGAACAAGACCACCTCTTGGCTAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000526343.5; ENST00000526594.1; ENST00000282441.10; ENST00000524575.5; ENST00000531439.5; ENST00000629586.2; ENST00000537274.5; ENST00000529029.1; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160927
mod ID: M6ASITE008176		Click to Show/Hide the Full List
mod site	chr11:102186091-102186092:+		[23]
Sequence	ATATAAACCATAAGAACAAGACCACCTCTTGGCTAGACCCA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000526343.5; ENST00000529029.1; ENST00000345877.6; ENST00000531439.5; ENST00000282441.10; ENST00000524575.5; ENST00000526594.1; ENST00000537274.5; ENST00000629586.2; ENST00000615667.4
External Link	RMBase: m6A_site_160928
mod ID: M6ASITE008177		Click to Show/Hide the Full List
mod site	chr11:102186107-102186108:+		[23]
Sequence	CAAGACCACCTCTTGGCTAGACCCAAGGCTTGACCCTCGTT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000526343.5; ENST00000345877.6; ENST00000524575.5; ENST00000615667.4; ENST00000526594.1; ENST00000537274.5; ENST00000529029.1; ENST00000282441.10; ENST00000629586.2; ENST00000531439.5
External Link	RMBase: m6A_site_160929
mod ID: M6ASITE008178		Click to Show/Hide the Full List
mod site	chr11:102186149-102186150:+		[23]
Sequence	TGGTAAAGGTTCATCTCAAAACCTTTTTAGATGCTTTTGGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000282441.10; ENST00000526594.1; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5; ENST00000524575.5; ENST00000629586.2; ENST00000531439.5; ENST00000526343.5; ENST00000529029.1
External Link	RMBase: m6A_site_160930
mod ID: M6ASITE008179		Click to Show/Hide the Full List
mod site	chr11:102205898-102205899:+		[23]
Sequence	TCTTTTCATTTCAGCCATGAACCAGAGAATCAGTCAGAGTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1299; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000629586.2; ENST00000531439.5; ENST00000529029.1; ENST00000526343.5; ENST00000345877.6; ENST00000282441.10; ENST00000537274.5; ENST00000524575.5
External Link	RMBase: m6A_site_160931
mod ID: M6ASITE008180		Click to Show/Hide the Full List
mod site	chr11:102205929-102205930:+		[23]
Sequence	AGTCAGAGTGCTCCAGTGAAACAGCCACCACCCCTGGCTCC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; kidney; H1299; endometrial
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000524575.5; ENST00000526343.5; ENST00000282441.10; ENST00000529029.1; ENST00000345877.6; ENST00000629586.2; ENST00000537274.5; ENST00000531439.5; ENST00000615667.4
External Link	RMBase: m6A_site_160932
mod ID: M6ASITE008181		Click to Show/Hide the Full List
mod site	chr11:102206052-102206053:+		[23]
Sequence	AAGGAGAGGCTGCGGCTGAAACAGCAAGAACTGCTTCGGCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; H1299; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000629586.2; ENST00000526343.5; ENST00000529029.1; ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000537274.5; ENST00000531439.5
External Link	RMBase: m6A_site_160933
mod ID: M6ASITE008182		Click to Show/Hide the Full List
mod site	chr11:102206061-102206062:+		[23]
Sequence	CTGCGGCTGAAACAGCAAGAACTGCTTCGGCAGGTGAGGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000629586.2; ENST00000524575.5; ENST00000282441.10; ENST00000526343.5; ENST00000529029.1; ENST00000615667.4; ENST00000531439.5; ENST00000537274.5; ENST00000345877.6
External Link	RMBase: m6A_site_160934
mod ID: M6ASITE008183		Click to Show/Hide the Full List
mod site	chr11:102223648-102223649:+		[25]
Sequence	CCCTGCGTAGCCAGTTACCAACACTGGAGCAGGATGGTGGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000345877.6; ENST00000615667.4; ENST00000629586.2; ENST00000524575.5; ENST00000282441.10; ENST00000537274.5; ENST00000531439.5; ENST00000526343.5; ENST00000529029.1
External Link	RMBase: m6A_site_160935
mod ID: M6ASITE008184		Click to Show/Hide the Full List
mod site	chr11:102223669-102223670:+		[23]
Sequence	CACTGGAGCAGGATGGTGGGACTCAAAATCCAGTGTCTTCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526343.5; ENST00000529029.1; ENST00000531439.5; ENST00000282441.10; ENST00000629586.2; ENST00000345877.6; ENST00000524575.5; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160936
mod ID: M6ASITE008185		Click to Show/Hide the Full List
mod site	chr11:102223714-102223715:+		[23]
Sequence	GGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000531439.5; ENST00000524575.5; ENST00000529029.1; ENST00000282441.10; ENST00000629586.2; ENST00000345877.6; ENST00000526343.5; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160937
mod ID: M6ASITE008186		Click to Show/Hide the Full List
mod site	chr11:102227002-102227003:+		[23]
Sequence	TTAACTTGAGTCTAGTGCAGACCTGTCTCCTCGCCCACCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000282441.10; ENST00000629586.2; ENST00000531439.5; ENST00000529029.1; ENST00000524575.5; ENST00000528834.1; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5; ENST00000526343.5
External Link	RMBase: m6A_site_160938
mod ID: M6ASITE008187		Click to Show/Hide the Full List
mod site	chr11:102227079-102227080:+		[23]
Sequence	TGGAGAATTGAGGCCTTGGGACAAGTAAGTTGTATGGGTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000345877.6; ENST00000529029.1; ENST00000524575.5; ENST00000528834.1; ENST00000526343.5; ENST00000537274.5; ENST00000629586.2; ENST00000282441.10; ENST00000531439.5
External Link	RMBase: m6A_site_160939
mod ID: M6ASITE008188		Click to Show/Hide the Full List
mod site	chr11:102227500-102227501:+		[23]
Sequence	CTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; BGC823; HepG2; U2OS
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000528834.1; ENST00000537274.5; ENST00000282441.10; ENST00000531439.5; ENST00000345877.6; ENST00000526343.5; ENST00000629586.2; ENST00000615667.4; ENST00000529029.1; ENST00000524575.5
External Link	RMBase: m6A_site_160940
mod ID: M6ASITE008189		Click to Show/Hide the Full List
mod site	chr11:102227507-102227508:+		[23]
Sequence	GATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; BGC823; HepG2; U2OS; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629586.2; ENST00000537274.5; ENST00000528834.1; ENST00000524575.5; ENST00000526343.5; ENST00000345877.6; ENST00000615667.4; ENST00000529029.1; ENST00000282441.10; ENST00000531439.5
External Link	RMBase: m6A_site_160941
mod ID: M6ASITE008190		Click to Show/Hide the Full List
mod site	chr11:102227538-102227539:+		[23]
Sequence	GCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; BGC823; HepG2; U2OS; A549; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526343.5; ENST00000529029.1; ENST00000282441.10; ENST00000537274.5; ENST00000629586.2; ENST00000524575.5; ENST00000528834.1; ENST00000531439.5; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160942
mod ID: M6ASITE008191		Click to Show/Hide the Full List
mod site	chr11:102227557-102227558:+		[23]
Sequence	AACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; kidney; BGC823; HepG2; U2OS; A549; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000629586.2; ENST00000537274.5; ENST00000531439.5; ENST00000529029.1; ENST00000526343.5; ENST00000345877.6; ENST00000524575.5; ENST00000615667.4; ENST00000528834.1; ENST00000282441.10
External Link	RMBase: m6A_site_160943
mod ID: M6ASITE008192		Click to Show/Hide the Full List
mod site	chr11:102229732-102229733:+		[26]
Sequence	AACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGA
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000629586.2; ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000528834.1; ENST00000526343.5; ENST00000529029.1; ENST00000537274.5; ENST00000282441.10; ENST00000531439.5
External Link	RMBase: m6A_site_160944
mod ID: M6ASITE008193		Click to Show/Hide the Full List
mod site	chr11:102229740-102229741:+		[23]
Sequence	CACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629586.2; ENST00000529029.1; ENST00000528834.1; ENST00000531439.5; ENST00000345877.6; ENST00000615667.4; ENST00000524575.5; ENST00000537274.5; ENST00000526343.5; ENST00000282441.10
External Link	RMBase: m6A_site_160945
mod ID: M6ASITE008194		Click to Show/Hide the Full List
mod site	chr11:102229752-102229753:+		[23]
Sequence	ACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615667.4; ENST00000282441.10; ENST00000524575.5; ENST00000526343.5; ENST00000345877.6; ENST00000629586.2; ENST00000537274.5; ENST00000529029.1; ENST00000531439.5; ENST00000528834.1
External Link	RMBase: m6A_site_160946
mod ID: M6ASITE008195		Click to Show/Hide the Full List
mod site	chr11:102229775-102229776:+		[23]
Sequence	ACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000528834.1; ENST00000524575.5; ENST00000345877.6; ENST00000531439.5; ENST00000615667.4; ENST00000529029.1; ENST00000537274.5; ENST00000282441.10; ENST00000629586.2; ENST00000526343.5
External Link	RMBase: m6A_site_160947
mod ID: M6ASITE008196		Click to Show/Hide the Full List
mod site	chr11:102229785-102229786:+		[23]
Sequence	CATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537274.5; ENST00000345877.6; ENST00000282441.10; ENST00000528834.1; ENST00000615667.4; ENST00000529029.1; ENST00000526343.5; ENST00000629586.2; ENST00000531439.5; ENST00000524575.5
External Link	RMBase: m6A_site_160948
mod ID: M6ASITE008197		Click to Show/Hide the Full List
mod site	chr11:102229793-102229794:+		[23]
Sequence	GGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000526343.5; ENST00000529029.1; ENST00000282441.10; ENST00000629586.2; ENST00000615667.4; ENST00000531439.5; ENST00000528834.1; ENST00000345877.6; ENST00000524575.5; ENST00000537274.5
External Link	RMBase: m6A_site_160949
mod ID: M6ASITE008198		Click to Show/Hide the Full List
mod site	chr11:102229815-102229816:+		[23]
Sequence	ACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000528834.1; ENST00000524575.5; ENST00000537274.5; ENST00000531439.5; ENST00000282441.10; ENST00000529029.1; ENST00000615667.4; ENST00000526343.5; ENST00000629586.2; ENST00000345877.6
External Link	RMBase: m6A_site_160950
mod ID: M6ASITE008199		Click to Show/Hide the Full List
mod site	chr11:102229866-102229867:+		[25]
Sequence	GCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000524575.5; ENST00000529029.1; ENST00000615667.4; ENST00000528834.1; ENST00000282441.10; ENST00000537274.5; ENST00000629586.2; ENST00000345877.6; ENST00000526343.5; ENST00000531439.5
External Link	RMBase: m6A_site_160952
mod ID: M6ASITE008200		Click to Show/Hide the Full List
mod site	chr11:102229878-102229879:+		[25]
Sequence	GAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000531439.5; ENST00000629586.2; ENST00000524575.5; ENST00000282441.10; ENST00000526343.5; ENST00000537274.5; ENST00000528834.1; ENST00000345877.6; ENST00000615667.4; ENST00000529029.1
External Link	RMBase: m6A_site_160953
mod ID: M6ASITE008201		Click to Show/Hide the Full List
mod site	chr11:102229928-102229929:+		[25]
Sequence	TAGATAAAGAAAGCTTTCTTACATGGTTATAGAGCCCTCAG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000345877.6; ENST00000531439.5; ENST00000526343.5; ENST00000528834.1; ENST00000529029.1; ENST00000615667.4; ENST00000282441.10; ENST00000537274.5; ENST00000524575.5; ENST00000629586.2
External Link	RMBase: m6A_site_160955
mod ID: M6ASITE008202		Click to Show/Hide the Full List
mod site	chr11:102229953-102229954:+		[23]
Sequence	GTTATAGAGCCCTCAGGCAGACTGAATTCTAAATCTGTGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000524575.5; ENST00000531439.5; ENST00000526343.5; ENST00000615667.4; ENST00000537274.5; ENST00000345877.6; ENST00000528834.1; ENST00000529029.1; ENST00000282441.10
External Link	RMBase: m6A_site_160956
mod ID: M6ASITE008203		Click to Show/Hide the Full List
mod site	chr11:102229986-102229987:+		[23]
Sequence	TCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATTTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000526343.5; ENST00000524575.5; ENST00000528834.1; ENST00000615667.4; ENST00000529029.1; ENST00000537274.5; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_160957
mod ID: M6ASITE008204		Click to Show/Hide the Full List
mod site	chr11:102230049-102230050:+		[23]
Sequence	GCTAATACAGAAAAAGATGAACAAACGTCCAGCAAGATACT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000529029.1; ENST00000282441.10; ENST00000615667.4; ENST00000526343.5; ENST00000528834.1; ENST00000537274.5; ENST00000345877.6; ENST00000524575.5
External Link	RMBase: m6A_site_160959
mod ID: M6ASITE008205		Click to Show/Hide the Full List
mod site	chr11:102230053-102230054:+		[27]
Sequence	ATACAGAAAAAGATGAACAAACGTCCAGCAAGATACTTTAA
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000529029.1; ENST00000615667.4; ENST00000345877.6; ENST00000524575.5; ENST00000528834.1; ENST00000282441.10; ENST00000537274.5; ENST00000526343.5
External Link	RMBase: m6A_site_160960
mod ID: M6ASITE008206		Click to Show/Hide the Full List
mod site	chr11:102230132-102230133:+		[26]
Sequence	ATGTATTGCTGACCTCTTTCACAGTTGGCTCTAAAGAATCA
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000526343.5; ENST00000282441.10; ENST00000524575.5; ENST00000529029.1; ENST00000528834.1; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160962
mod ID: M6ASITE008207		Click to Show/Hide the Full List
mod site	chr11:102230163-102230164:+		[23]
Sequence	TAAAGAATCAAAAGAAAAAAACTTTTTATTTCTTTTGCTAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000345877.6; ENST00000537274.5; ENST00000529029.1; ENST00000615667.4; ENST00000282441.10; ENST00000526343.5; ENST00000528834.1
External Link	RMBase: m6A_site_160963
mod ID: M6ASITE008208		Click to Show/Hide the Full List
mod site	chr11:102230188-102230189:+		[23]
Sequence	TTATTTCTTTTGCTATTAAAACTACTGTTCATTTTGGGGGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615667.4; ENST00000537274.5; ENST00000529029.1; ENST00000345877.6; ENST00000282441.10; ENST00000526343.5; ENST00000528834.1
External Link	RMBase: m6A_site_160964
mod ID: M6ASITE008209		Click to Show/Hide the Full List
mod site	chr11:102230294-102230295:+		[23]
Sequence	CATTTTAACTAAATACTCAGACTTAGAAGTCAGATGCTTCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000529029.1; ENST00000537274.5; ENST00000282441.10; ENST00000345877.6; ENST00000528834.1; ENST00000615667.4; ENST00000526343.5
External Link	RMBase: m6A_site_160968
mod ID: M6ASITE008210		Click to Show/Hide the Full List
mod site	chr11:102230375-102230376:+		[23]
Sequence	TTCCTTTGTCCAGTGGAAAAACATGATTTACTGGTCTGACA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000529029.1; ENST00000528834.1; ENST00000537274.5; ENST00000526343.5; ENST00000615667.4; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_160969
mod ID: M6ASITE008211		Click to Show/Hide the Full List
mod site	chr11:102230393-102230394:+		[25]
Sequence	AAACATGATTTACTGGTCTGACAAGCCAAAAATGTTATATC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000528834.1; ENST00000529029.1; ENST00000345877.6; ENST00000537274.5; ENST00000282441.10; ENST00000526343.5; ENST00000615667.4
External Link	RMBase: m6A_site_160970
mod ID: M6ASITE008212		Click to Show/Hide the Full List
mod site	chr11:102230455-102230456:+		[23]
Sequence	GATTTGAAGAGATAGCTGAAACCAAGGCTGAAGACTGTTTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615667.4; ENST00000537274.5; ENST00000526343.5; ENST00000529029.1; ENST00000528834.1; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_160971
mod ID: M6ASITE008213		Click to Show/Hide the Full List
mod site	chr11:102230468-102230469:+		[23]
Sequence	AGCTGAAACCAAGGCTGAAGACTGTTTTACTTTCAGTATTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000529029.1; ENST00000526343.5; ENST00000615667.4; ENST00000282441.10; ENST00000537274.5; ENST00000528834.1; ENST00000345877.6
External Link	RMBase: m6A_site_160972
mod ID: M6ASITE008214		Click to Show/Hide the Full List
mod site	chr11:102230517-102230518:+		[26]
Sequence	TCCTAGTGCTATCATTAGTCACATAATGACCTTGATTTTAT
Motif Score	2.047297619
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000345877.6; ENST00000526343.5; ENST00000537274.5; ENST00000529029.1; ENST00000615667.4
External Link	RMBase: m6A_site_160973
mod ID: M6ASITE008215		Click to Show/Hide the Full List
mod site	chr11:102230525-102230526:+		[27]
Sequence	CTATCATTAGTCACATAATGACCTTGATTTTATTTTAGGAG
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000526343.5; ENST00000529029.1; ENST00000537274.5; ENST00000615667.4; ENST00000282441.10; ENST00000345877.6
External Link	RMBase: m6A_site_160974
mod ID: M6ASITE008216		Click to Show/Hide the Full List
mod site	chr11:102230561-102230562:+		[23]
Sequence	AGGAGCTTATAAGGCATGAGACAATTTCCATATAAATATAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; fibroblasts; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000345877.6; ENST00000526343.5; ENST00000529029.1; ENST00000615667.4
External Link	RMBase: m6A_site_160975
mod ID: M6ASITE008217		Click to Show/Hide the Full List
mod site	chr11:102230724-102230725:+		[23]
Sequence	GGTTGGTTGGTTTTGTCGGAACCTAGGCAAATGACCATATT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000282441.10; ENST00000615667.4; ENST00000537274.5; ENST00000345877.6
External Link	RMBase: m6A_site_160976
mod ID: M6ASITE008218		Click to Show/Hide the Full List
mod site	chr11:102230882-102230883:+		[23]
Sequence	ATATACATACACACACCCAAACATAACATTTATAATAGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000537274.5; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_160979
mod ID: M6ASITE008219		Click to Show/Hide the Full List
mod site	chr11:102230887-102230888:+		[25]
Sequence	CATACACACACCCAAACATAACATTTATAATAGTGTGGTAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160980
mod ID: M6ASITE008220		Click to Show/Hide the Full List
mod site	chr11:102230985-102230986:+		[25]
Sequence	GCTTTGTATGCATTTAGAATACATGACTAGTAGTTTATATT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160981
mod ID: M6ASITE008221		Click to Show/Hide the Full List
mod site	chr11:102230990-102230991:+		[27]
Sequence	GTATGCATTTAGAATACATGACTAGTAGTTTATATTTCACT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160982
mod ID: M6ASITE008222		Click to Show/Hide the Full List
mod site	chr11:102231345-102231346:+		[25]
Sequence	GTAGTTCTCATTTGTAATGAACACATTAACGACTAGATTAA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537274.5; ENST00000345877.6; ENST00000282441.10; ENST00000615667.4
External Link	RMBase: m6A_site_160983
mod ID: M6ASITE008223		Click to Show/Hide the Full List
mod site	chr11:102231394-102231395:+		[25]
Sequence	CTTCAAGATTGTTCTTACTTACAAGACTTGCTCCTACTTCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160984
mod ID: M6ASITE008224		Click to Show/Hide the Full List
mod site	chr11:102231399-102231400:+		[23]
Sequence	AGATTGTTCTTACTTACAAGACTTGCTCCTACTTCTATGCT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160985
mod ID: M6ASITE008225		Click to Show/Hide the Full List
mod site	chr11:102231624-102231625:+		[23]
Sequence	AAAGAGTATTTTTTAAAGGAACAAAACGAGCATGAATTAAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000615667.4; ENST00000345877.6; ENST00000537274.5
External Link	RMBase: m6A_site_160986
mod ID: M6ASITE008226		Click to Show/Hide the Full List
mod site	chr11:102231847-102231848:+		[25]
Sequence	AGATTTTTTTCCCCCCAATTACAAAATCTAAGTATTTTGGC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	rmsk_3641073; ENST00000615667.4; ENST00000282441.10; ENST00000345877.6; ENST00000537274.5
External Link	RMBase: m6A_site_160987
mod ID: M6ASITE008227		Click to Show/Hide the Full List
mod site	chr11:102232017-102232018:+		[23]
Sequence	CTAAGGCTTTTATTAAGAAAACAGCAGAAAGATTAAATCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000615667.4; ENST00000345877.6
External Link	RMBase: m6A_site_160988
mod ID: M6ASITE008228		Click to Show/Hide the Full List
mod site	chr11:102232099-102232100:+		[27]
Sequence	TAGAGTAGTAATGAAATTCTACCTAGAATGCAAAATTGGGT
Motif Score	2.05802381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000615667.4; ENST00000282441.10; ENST00000345877.6; ENST00000537274.5
External Link	RMBase: m6A_site_160989
mod ID: M6ASITE008229		Click to Show/Hide the Full List
mod site	chr11:102232129-102232130:+		[25]
Sequence	CAAAATTGGGTATATGAATTACATAGCATGTTGTTGGGATT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000615667.4; ENST00000282441.10; ENST00000537274.5; ENST00000345877.6
External Link	RMBase: m6A_site_160990
mod ID: M6ASITE008230		Click to Show/Hide the Full List
mod site	chr11:102232306-102232307:+		[23]
Sequence	GGTTGTGAAGATTTAGGGGGACCTTGATAGAGAACTTTATA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345877.6; ENST00000537274.5; ENST00000615667.4; ENST00000282441.10
External Link	RMBase: m6A_site_160991
mod ID: M6ASITE008231		Click to Show/Hide the Full List
mod site	chr11:102232319-102232320:+		[23]
Sequence	TAGGGGGACCTTGATAGAGAACTTTATAAACTTCTTTCTCT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345877.6; ENST00000537274.5; ENST00000615667.4; ENST00000282441.10
External Link	RMBase: m6A_site_160992
mod ID: M6ASITE008232		Click to Show/Hide the Full List
mod site	chr11:102232328-102232329:+		[23]
Sequence	CTTGATAGAGAACTTTATAAACTTCTTTCTCTTTAATAAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000615667.4; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_160993
mod ID: M6ASITE008233		Click to Show/Hide the Full List
mod site	chr11:102232349-102232350:+		[23]
Sequence	CTTCTTTCTCTTTAATAAAGACTTGTCTTACACCGTGCTGC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160994
mod ID: M6ASITE008234		Click to Show/Hide the Full List
mod site	chr11:102232358-102232359:+		[25]
Sequence	CTTTAATAAAGACTTGTCTTACACCGTGCTGCCATTAAAGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537274.5; ENST00000345877.6; ENST00000282441.10; ENST00000615667.4
External Link	RMBase: m6A_site_160995
mod ID: M6ASITE008235		Click to Show/Hide the Full List
mod site	chr11:102232409-102232410:+		[25]
Sequence	AGAGTTTCAGTCACCTAAGTACACCCACAAAACAATATGAA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000345877.6; ENST00000615667.4; ENST00000537274.5; ENST00000282441.10
External Link	RMBase: m6A_site_160996
mod ID: M6ASITE008236		Click to Show/Hide the Full List
mod site	chr11:102232420-102232421:+		[23]
Sequence	CACCTAAGTACACCCACAAAACAATATGAATATGGAGATCT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_160997
mod ID: M6ASITE008237		Click to Show/Hide the Full List
mod site	chr11:102232502-102232503:+		[27]
Sequence	TGTTGTAGCAGTACTGTGATACCTGGCACAGTGCTTTGATC
Motif Score	2.089839286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000537274.5; ENST00000345877.6; ENST00000282441.10; ENST00000615667.4
External Link	RMBase: m6A_site_160998
mod ID: M6ASITE008238		Click to Show/Hide the Full List
mod site	chr11:102232554-102232555:+		[23]
Sequence	TCTGTACTGACCTGAAGGAGACCTAAGAGTCCTTTCCCTTT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000537274.5; ENST00000282441.10; ENST00000345877.6
External Link	RMBase: m6A_site_160999
mod ID: M6ASITE008239		Click to Show/Hide the Full List
mod site	chr11:102232718-102232719:+		[23]
Sequence	TTGAATTGCTTTTACAATAAACCAATTTTATAATCTTTAAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000345877.6; ENST00000615667.4; ENST00000282441.10
External Link	RMBase: m6A_site_161000
mod ID: M6ASITE008240		Click to Show/Hide the Full List
mod site	chr11:102232753-102232754:+		[27]
Sequence	TTTAAATTTATCAACTTTTTACATTTGTGTTATTTTCAGTC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000345877.6; ENST00000615667.4
External Link	RMBase: m6A_site_161001
mod ID: M6ASITE008241		Click to Show/Hide the Full List
mod site	chr11:102232790-102232791:+		[27]
Sequence	AGTCAGGGCTTCTTAGATCTACTTATGGTTGATGGAGCACA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000537274.5; ENST00000615667.4; ENST00000282441.10; ENST00000345877.6
External Link	RMBase: m6A_site_161002
mod ID: M6ASITE008242		Click to Show/Hide the Full List
mod site	chr11:102232808-102232809:+		[25]
Sequence	CTACTTATGGTTGATGGAGCACATTGATTTGGAGTTTCAGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000615667.4; ENST00000345877.6; ENST00000537274.5; ENST00000282441.10
External Link	RMBase: m6A_site_161003
mod ID: M6ASITE008243		Click to Show/Hide the Full List
mod site	chr11:102232892-102232893:+		[23]
Sequence	TGCCTTTAAAGGAAAAATGAACACAGGGAAGTGACTTTGCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000345877.6; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_161004
mod ID: M6ASITE008244		Click to Show/Hide the Full List
mod site	chr11:102232968-102232969:+		[23]
Sequence	ATACATGCCTTCTATATGGAACATGGCAGAAAGACTGAAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000615667.4; ENST00000345877.6; ENST00000282441.10
External Link	RMBase: m6A_site_161005
mod ID: M6ASITE008245		Click to Show/Hide the Full List
mod site	chr11:102232981-102232982:+		[23]
Sequence	ATATGGAACATGGCAGAAAGACTGAAAAATAACAGTAATTA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537274.5; ENST00000282441.10; ENST00000345877.6; ENST00000615667.4
External Link	RMBase: m6A_site_161006
mod ID: M6ASITE008246		Click to Show/Hide the Full List
mod site	chr11:102233039-102233040:+		[23]
Sequence	TCATACCAATCAGTGTTGAAACTCAAACATTGCAAAAGTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000615667.4; ENST00000282441.10; ENST00000345877.6; ENST00000537274.5
External Link	RMBase: m6A_site_161007
mod ID: M6ASITE008247		Click to Show/Hide the Full List
mod site	chr11:102233045-102233046:+		[23]
Sequence	CAATCAGTGTTGAAACTCAAACATTGCAAAAGTGGGTGGCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000345877.6; ENST00000615667.4
External Link	RMBase: m6A_site_161008
mod ID: M6ASITE008248		Click to Show/Hide the Full List
mod site	chr11:102233099-102233100:+		[25]
Sequence	AACACTTTTCTAGCGTTGGTACATCTGAGAAATGAGTGCTC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000345877.6; ENST00000282441.10; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_161009
mod ID: M6ASITE008249		Click to Show/Hide the Full List
mod site	chr11:102233178-102233179:+		[25]
Sequence	TTGTGGGTGTGCCTATCATAACAATTGTTTTCTGTATCTTG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282441.10; ENST00000537274.5; ENST00000345877.6; ENST00000615667.4
External Link	RMBase: m6A_site_161010
mod ID: M6ASITE008250		Click to Show/Hide the Full List
mod site	chr11:102233251-102233252:+		[25]
Sequence	ATTAGAGAATTCTTTAATGCACACTTGTCAAATATATATAT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537274.5; ENST00000615667.4; ENST00000282441.10; ENST00000345877.6
External Link	RMBase: m6A_site_161011
mod ID: M6ASITE008251		Click to Show/Hide the Full List
mod site	chr11:102233339-102233340:+		[25]
Sequence	TGCTCATATGTTAGGTACTTACATAAATTGTTACATTATTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000345877.6; ENST00000282441.10; ENST00000615667.4; ENST00000537274.5
External Link	RMBase: m6A_site_161012

Ref 1	m6A Methyltransferase 3 Promotes the Proliferation and Migration of Gastric Cancer Cells through the m6A Modification of YAP1. J Oncol. 2021 Aug 4;2021:8875424. doi: 10.1155/2021/8875424. eCollection 2021.
Ref 2	N6-methyladenosine-induced circ1662 promotes metastasis of colorectal cancer by accelerating YAP1 nuclear localization. Theranostics. 2021 Feb 25;11(9):4298-4315. doi: 10.7150/thno.51342. eCollection 2021.
Ref 3	RNA m6A methylation promotes the formation of vasculogenic mimicry in hepatocellular carcinoma via Hippo pathway. Angiogenesis. 2021 Feb;24(1):83-96. doi: 10.1007/s10456-020-09744-8. Epub 2020 Sep 13.
Ref 4	m(6)A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis. J Hematol Oncol. 2019 Dec 9;12(1):135. doi: 10.1186/s13045-019-0830-6.
Ref 5	ALKBH5 suppresses tumor progression via an m(6)A-dependent epigenetic silencing of pre-miR-181b-1/YAP signaling axis in osteosarcoma. Cell Death Dis. 2021 Jan 11;12(1):60. doi: 10.1038/s41419-020-03315-x.
Ref 6	Involvement of YTHDF1 in renal fibrosis progression via up-regulating YAP. FASEB J. 2022 Feb;36(2):e22144. doi: 10.1096/fj.202100172RR.
Ref 7	YTH domain family 2 orchestrates epithelial-mesenchymal transition/proliferation dichotomy in pancreatic cancer cells. Cell Cycle. 2017;16(23):2259-2271. doi: 10.1080/15384101.2017.1380125. Epub 2017 Nov 14.
Ref 8	FTO demethylates YAP mRNA promoting oral squamous cell carcinoma tumorigenesis. Neoplasma. 2022 Jan;69(1):71-79. doi: 10.4149/neo_2021_210716N967. Epub 2021 Nov 16.
Ref 9	m(6)A demethylase FTO regulates the apoptosis and inflammation of cardiomyocytes via YAP1 in ischemia-reperfusion injury. Bioengineered. 2022 Mar;13(3):5443-5452. doi: 10.1080/21655979.2022.2030572.
Ref 10	The N6-methyladenosine mRNA methylase METTL14 promotes renal ischemic reperfusion injury via suppressing YAP1. J Cell Biochem. 2020 Jan;121(1):524-533. doi: 10.1002/jcb.29258. Epub 2019 Jul 18.
Ref 11	m(6)A demethylase ALKBH5 inhibits tumor growth and metastasis by reducing YTHDFs-mediated YAP expression and inhibiting miR-107/LATS2-mediated YAP activity in NSCLC. Mol Cancer. 2020 Feb 27;19(1):40. doi: 10.1186/s12943-020-01161-1.
Ref 12	ALKBH5 regulates cardiomyocyte proliferation and heart regeneration by demethylating the mRNA of YTHDF1. Theranostics. 2021 Jan 1;11(6):3000-3016. doi: 10.7150/thno.47354. eCollection 2021.
Ref 13	IGF2BP2 promotes the progression of colorectal cancer through a YAP-dependent mechanism. Cancer Sci. 2021 Oct;112(10):4087-4099. doi: 10.1111/cas.15083. Epub 2021 Aug 3.
Ref 14	Clinical pipeline report, company report or official report of AbbVie.
Ref 15	AST1306, a novel irreversible inhibitor of the epidermal growth factor receptor 1 and 2, exhibits antitumor activity both in vitro and in vivo. PLoS One. 2011;6(7):e21487. doi: 10.1371/journal.pone.0021487. Epub 2011 Jul 18.
Ref 16	US patent application no. 6,867,039, Antisense modulation of dual specific phosphatase 5 expression.
Ref 17	Clinical pipeline report, company report or official report of Adagene.
Ref 18	The role of the efflux transporter P-glycoprotein in brain penetration of prednisolone. J Endocrinol. 2002 Oct;175(1):251-60. doi: 10.1677/joe.0.1750251.
Ref 19	US patent application no. 6,242,590, Antisense modulation of zinc finger protein-217 expression.
Ref 20	The N6-methyladenosine reader protein YTHDC2 promotes gastric cancer progression via enhancing YAP mRNA translation. Transl Oncol. 2022 Feb;16:101308. doi: 10.1016/j.tranon.2021.101308. Epub 2021 Dec 12.
Ref 21	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 22	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 23	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 24	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 25	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 26	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 27	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map