m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00404)

Target Name	Transcription factor SOX-2 (SOX2)
Gene Name	SOX2
Chromosomal Location	3q26.33
Function	Transcription factor that forms a trimeric complex with OCT4 on DNA and controls the expression of a number of genes involved in embryonic development such as YES1, FGF4, UTF1 and ZFP206 (By similarity). Binds to the proximal enhancer region of NANOG (By similarity). Critical for early embryogenesis and for embryonic stem cell pluripotency. Downstream SRRT target that mediates the promotion of neural stem cell self-renewal (By similarity). Keeps neural cells undifferentiated by counteracting the activity of proneural proteins and suppresses neuronal differentiation (By similarity). May function as a switch in neuronal development (By similarity). Click to Show/Hide
Gene ID	6657
Uniprot ID	SOX2_HUMAN
HGNC ID	HGNC:11195
KEGG ID	hsa:6657

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SOX2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: METTL3-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: 5.94E-01 p-value: 9.57E-57
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between SOX2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 6.08E+00	GSE60213

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	GBM tumors have elevated levels of METTL3 transcripts and silencing METTL3 in U87/TIC inhibited tumor growth in an intracranial orthotopic mouse model with prolonged mice survival. The exogenous overexpression of 3'UTR-less Transcription factor SOX-2 (SOX2) significantly alleviated the inhibition of neurosphere formation observed in METTL3 silenced GSCs.
Target Regulation	Up regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
Cell Process	DNA repair
Cell Process	Nucleotide excision repair (hsa03420)
In-vitro Model	Mouse immortalized astrocytes (A type of glial cell)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3, acting as an oncogene, maintained Transcription factor SOX-2 (SOX2) expression through an m6A-IGF2BP2-dependent mechanism in CRC cells, and indicated a potential biomarker panel for prognostic prediction in Colorectal carcinoma.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
Cell Process	Cell self-renewal
	Stem cell frequency
	Cell migration
In-vitro Model	CCD-112CoN	Normal	Homo sapiens	CVCL_6382
	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	LS174T	Colon adenocarcinoma	Homo sapiens	CVCL_1384
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Knockdown of METTL3 downregulated protein levels of Transcription factor SOX-2 (SOX2), CD133 and CD44 in MCF-7 cells. METTL3 is upregulated in breast cancer, and it promotes the stemness and malignant progression of BCa through mediating m6A modification on SOX2 mRNA.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	A549 cell line	Homo sapiens
Treatment: IGF2BP1 knockout A549 cells Control: Wild type A549 cells		GSE146546
Regulation		logFC: -2.55E+00 p-value: 6.23E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	Dysregulation of IGF2BP1 by PADI2/MEK1/ERK signaling results in abnormal accumulation of oncogenic Transcription factor SOX-2 (SOX2) expression, therefore supporting the malignant state of EC.
Target Regulation	Up regulation
Responsed Disease	Endometrial cancer		ICD-11: 2C76	Disease Info
Cell Process	RNA stability
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
In-vitro Model	ECC-1	Endometrial Cancer	Homo sapiens	CVCL_7260
In-vivo Model	Nude mice were subcutaneously injected with 1 × 10⁷ PADI2 depleted or IGF2BP1 depleted Ishikawa cells on the left flanks, and the corresponding control cells on the right flanks.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	human pluripotent stem cells	Homo sapiens
Treatment: hILO ALKBH5knockout cells Control: hILO wild type cells		GSE163945
Regulation		logFC: -1.63E+00 p-value: 3.34E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	HIF-dependent ALKBH5 expression increases in hypoxic TMEs, resulting in the demethylation of Transcription factor SOX-2 (SOX2) mRNA and the maintenance of the Endometrial cancer stem cells phenotype; these data indicate that ECSCs maintain their stemness by activating the HIF/ALKBH5/SOX2 axis under hypoxic conditions.
Target Regulation	Up regulation
Responsed Disease	Endometrial cancer		ICD-11: 2C76	Disease Info
Pathway Response	HIF-1 signaling pathway			hsa04066
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
In-vitro Model	EC cell line (Primary EC cells)
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293
	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	RL95-2	Endometrial adenosquamous carcinoma	Homo sapiens	CVCL_0505
In-vivo Model	A method of randomisation was used to determine the experimental groups. In total, 78 female BALB/c nu/nu mice (4-6-week-old) were selected at random and were divided into different groups. A total of 5 × 10⁶ ISK cells or 1 × 10⁴ ECSCisk were suspended in 100 uL of PBS and then were injected into the mice. After 2 weeks, the presence of tumours was examined. ISK cells (5 × 10⁶, 5 × 10⁵, 5 × 10⁴, 1 × 10⁴, or 1 × 10³) and ECSCisk (1 × 10⁴, 1 × 10³, 1 × 10², 10, or 1) were injected and analysed for their abilities to form xenograft tumours. After 4 weeks, subsequent experiments were performed.

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3, acting as an oncogene, maintained Transcription factor SOX-2 (SOX2) expression through an m6A-IGF2BP2-dependent mechanism in CRC cells, and indicated a potential biomarker panel for prognostic prediction in Colorectal carcinoma.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
Cell Process	Cell self-renewal
	Stem cell frequency
	Cell migration
In-vitro Model	CCD-112CoN	Normal	Homo sapiens	CVCL_6382
	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	LS174T	Colon adenocarcinoma	Homo sapiens	CVCL_1384
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	GBM tumors have elevated levels of METTL3 transcripts and silencing METTL3 in U87/TIC inhibited tumor growth in an intracranial orthotopic mouse model with prolonged mice survival. The exogenous overexpression of 3'UTR-less Transcription factor SOX-2 (SOX2) significantly alleviated the inhibition of neurosphere formation observed in METTL3 silenced GSCs.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Signaling pathways regulating pluripotency of stem cells		hsa04550
Cell Process	DNA repair
	Nucleotide excision repair (hsa03420)
In-vitro Model	Mouse immortalized astrocytes (A type of glial cell)

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3, acting as an oncogene, maintained Transcription factor SOX-2 (SOX2) expression through an m6A-IGF2BP2-dependent mechanism in CRC cells, and indicated a potential biomarker panel for prognostic prediction in Colorectal carcinoma.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
Cell Process	Cell self-renewal
	Stem cell frequency
	Cell migration
In-vitro Model	CCD-112CoN	Normal	Homo sapiens	CVCL_6382
	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	LS174T	Colon adenocarcinoma	Homo sapiens	CVCL_1384
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3, acting as an oncogene, maintained Transcription factor SOX-2 (SOX2) expression through an m6A-IGF2BP2-dependent mechanism in CRC cells, and indicated a potential biomarker panel for prognostic prediction in Colorectal carcinoma.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
Cell Process	Cell self-renewal
	Stem cell frequency
	Cell migration
In-vitro Model	CCD-112CoN	Normal	Homo sapiens	CVCL_6382
	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	LS174T	Colon adenocarcinoma	Homo sapiens	CVCL_1384
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	Knockdown of METTL3 downregulated protein levels of Transcription factor SOX-2 (SOX2), CD133 and CD44 in MCF-7 cells. METTL3 is upregulated in breast cancer, and it promotes the stemness and malignant progression of BCa through mediating m6A modification on SOX2 mRNA.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179

Endometrial cancer [ICD-11: 2C76]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	Dysregulation of IGF2BP1 by PADI2/MEK1/ERK signaling results in abnormal accumulation of oncogenic Transcription factor SOX-2 (SOX2) expression, therefore supporting the malignant state of EC.
Responsed Disease	Endometrial cancer [ICD-11: 2C76]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	ECC-1	Endometrial Cancer	Homo sapiens	CVCL_7260
In-vivo Model	Nude mice were subcutaneously injected with 1 × 10⁷ PADI2 depleted or IGF2BP1 depleted Ishikawa cells on the left flanks, and the corresponding control cells on the right flanks.
Experiment 2 Reporting the m6A-centered Disease Response				[5]
Response Summary	HIF-dependent ALKBH5 expression increases in hypoxic TMEs, resulting in the demethylation of Transcription factor SOX-2 (SOX2) mRNA and the maintenance of the Endometrial cancer stem cells phenotype; these data indicate that ECSCs maintain their stemness by activating the HIF/ALKBH5/SOX2 axis under hypoxic conditions.
Responsed Disease	Endometrial cancer [ICD-11: 2C76]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	HIF-1 signaling pathway			hsa04066
	Signaling pathways regulating pluripotency of stem cells			hsa04550
In-vitro Model	EC cell line (Primary EC cells)
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293
	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	RL95-2	Endometrial adenosquamous carcinoma	Homo sapiens	CVCL_0505
In-vivo Model	A method of randomisation was used to determine the experimental groups. In total, 78 female BALB/c nu/nu mice (4-6-week-old) were selected at random and were divided into different groups. A total of 5 × 10⁶ ISK cells or 1 × 10⁴ ECSCisk were suspended in 100 uL of PBS and then were injected into the mice. After 2 weeks, the presence of tumours was examined. ISK cells (5 × 10⁶, 5 × 10⁵, 5 × 10⁴, 1 × 10⁴, or 1 × 10³) and ECSCisk (1 × 10⁴, 1 × 10³, 1 × 10², 10, or 1) were injected and analysed for their abilities to form xenograft tumours. After 4 weeks, subsequent experiments were performed.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02034		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02037		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03293		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info
Crosstalk ID: M6ACROT03542		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03587		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

Non-coding RNA

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05097		Crosstalk Info
Epigenetic Regulator	MicroRNA 155 (MIR155)
Regulated Target	Hypoxia-inducible factor 1-alpha (HIF-1-Alpha/HIF1A)
Crosstalk relationship	ncRNA → m6A
Disease	Diabetic foot ulcers	Disease Info
Crosstalk ID: M6ACROT05886		Crosstalk Info
Epigenetic Regulator	SOX2 overlapping transcript (SOX2OT)
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	ncRNA → m6A
Disease	Glioblastoma	Disease Info
Drug	Temozolomide	Drug Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05271		Crosstalk Info
Epigenetic Regulator	Circ_VMP1
Regulated Target	hsa-miR-524-5p
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT05272		Crosstalk Info
Epigenetic Regulator	hsa-miR-524-5p
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Drug	Cisplatin	Drug Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05921		Crosstalk Info
Epigenetic Regulator	Circ_EPHB4
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00404)

Transcription factor SOX-2 (SOX2)

N6-methyladenosine (m6A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE063410		Click to Show/Hide the Full List
mod site	chr3:181712559-181712560:+		[13]
Sequence	CCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000325404.3; ENST00000646698.1; ENST00000628496.3; ENST00000498731.5; ENST00000595287.1; ENST00000593330.1; ENST00000642301.1; ENST00000491282.5; ENST00000595084.3; ENST00000492337.5; ENST00000466034.6; ENST00000627530.3; ENST00000596250.6; ENST00000629781.3; ENST00000646949.1; ENST00000629830.3; ENST00000629552.2; ENST00000600801.6; ENST00000626299.3; ENST00000498226.5; ENST00000597828.5; ENST00000645423.1; ENST00000600386.6; ENST00000593549.6; ENST00000628343.3; ENST00000646683.1; ENST00000642652.1; ENST00000477928.1; ENST00000485035.2; ENST00000626619.2; ENST00000469278.5; ENST00000493521.5; ENST00000476964.5; ENST00000630887.3; ENST00000628810.2; ENST00000600778.3; ENST00000645583.1; ENST00000646296.1; ENST00000646841.1; ENST00000598474.4; ENST00000627738.1; ENST00000599082.2; ENST00000597651.6; ENST00000627501.3; ENST00000629112.3; ENST00000642218.1; ENST00000630553.1; ENST00000643236.1
External Link	RMBase: m6A_site_619714

Ref 1	Essential role of METTL3-mediated m(6)A modification in glioma stem-like cells maintenance and radioresistance. Oncogene. 2018 Jan 25;37(4):522-533. doi: 10.1038/onc.2017.351. Epub 2017 Oct 9.
Ref 2	METTL3 facilitates tumor progression via an m(6)A-IGF2BP2-dependent mechanism in colorectal carcinoma. Mol Cancer. 2019 Jun 24;18(1):112. doi: 10.1186/s12943-019-1038-7.
Ref 3	The m6A methyltransferase METTL3 promotes the stemness and malignant progression of breast cancer by mediating m6A modification on SOX2. J BUON. 2021 Mar-Apr;26(2):444-449.
Ref 4	PADI2-Catalyzed MEK1 Citrullination Activates ERK1/2 and Promotes IGF2BP1-Mediated SOX2 mRNA Stability in Endometrial Cancer. Adv Sci (Weinh). 2021 Jan 29;8(6):2002831. doi: 10.1002/advs.202002831. eCollection 2021 Mar.
Ref 5	Hypoxia induces an endometrial cancer stem-like cell phenotype via HIF-dependent demethylation of SOX2 mRNA. Oncogenesis. 2020 Sep 11;9(9):81. doi: 10.1038/s41389-020-00265-z.
Ref 6	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 7	Clinical pipeline report, company report or official report of Genentech (2009).
Ref 8	Targeting estrogen receptor Alpha for degradation with PROTACs: A promising approach to overcome endocrine resistance. Eur J Med Chem. 2020 Nov 15;206:112689. doi: 10.1016/j.ejmech.2020.112689. Epub 2020 Aug 2.
Ref 9	Diabetic endothelial dysfunction: the role of poly(ADP-ribose) polymerase activation. Nat Med. 2001 Jan;7(1):108-13. doi: 10.1038/83241.
Ref 10	Contribution of down-regulation of intestinal and hepatic cytochrome P450 3A to increased absorption of cyclosporine A in a rat nephrosis model. J Pharmacol Exp Ther. 2008 Nov;327(2):592-9. doi: 10.1124/jpet.108.142091. Epub 2008 Aug 25.
Ref 11	Suppression of m6A mRNA modification by DNA hypermethylated ALKBH5 aggravates the oncological behavior of KRAS mutation/LKB1 loss lung cancer. Cell Death Dis. 2021 May 20;12(6):518. doi: 10.1038/s41419-021-03793-7.
Ref 12	Improved efficacy against malignant brain tumors with EGFRwt/EGFRvIII targeting immunotoxin and checkpoint inhibitor combinations. J Immunother Cancer. 2019 May 29;7(1):142. doi: 10.1186/s40425-019-0614-0.
Ref 13	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map