m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00323)

Target Name	ATP-dependent translocase ABCB1 (ABCB1)
Gene Name	ABCB1
Chromosomal Location	7q21.12
Family	ABC transporter superfamily; ABCB family; Multidrug resistance exporter (TC 3;A;1;201) subfamily
Function	Translocates drugs and phospholipids across the membrane. Catalyzes the flop of phospholipids from the cytoplasmic to the exoplasmic leaflet of the apical membrane. Participates mainly to the flop of phosphatidylcholine, phosphatidylethanolamine, beta-D-glucosylceramides and sphingomyelins. Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells . Click to Show/Hide
Gene ID	5243
Uniprot ID	MDR1_HUMAN
HGNC ID	HGNC:40
KEGG ID	hsa:5243

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ABCB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP3*
Cell Line	ES-2 cell line	Homo sapiens
Treatment: siIGF2BP3 ES-2 cells Control: siControl ES-2 cells		GSE109604
Regulation		logFC: -1.30E+00 p-value: 4.65E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	ABC transporters			hsa02010
Cell Process	RNA stability
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	SW1463	Rectal adenocarcinoma	Homo sapiens	CVCL_1718
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×10⁶) into nude mice.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -1.24E+00 p-value: 2.14E-202
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Cell Process	Cell growth and death
	Cell apoptosis
In-vitro Model	ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Cell suspensions (2 × 10⁶ cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	m6A induced ERR-Gamma confers chemoresistance of cancer cells through upregulation of ATP-dependent translocase ABCB1 (ABCB1) and CPT1B.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Pathway Response	ABC transporters			hsa02010
	Fatty acid metabolism			hsa01212
	Fatty acid degradation			hsa00071
Cell Process	Fatty acid oxidation
In-vitro Model	()
	()
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Both sh-control and sh- ERRγ HepG2/ADR cells (5 × 10⁶ per mouse, n=5 for each group) were diluted in 200uL PBS + 200 uL Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient mice.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	ABC transporters			hsa02010
Cell Process	RNA stability
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	SW1463	Rectal adenocarcinoma	Homo sapiens	CVCL_1718
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×10⁶) into nude mice.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Cell Process	Cell growth and death
	Cell apoptosis
In-vitro Model	ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Cell suspensions (2 × 10⁶ cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.

Doxil [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer.
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	ABC transporters			hsa02010
Cell Process	RNA stability
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	SW1463	Rectal adenocarcinoma	Homo sapiens	CVCL_1718
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
In-vivo Model	HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×10⁶) into nude mice.
Experiment 2 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Cell growth and death
Cell Process	Cell apoptosis
In-vitro Model	ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Cell suspensions (2 × 10⁶ cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05307		Crosstalk Info
Epigenetic Regulator	A1BG antisense RNA 1 (A1BG-AS1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Breast cancer	Disease Info
Drug	Adriamycin	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00323)

ATP-dependent translocase ABCB1 (ABCB1)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002240		Click to Show/Hide the Full List
mod site	chr7:87610353-87610354:-		[6]
Sequence	TCCCAGCTACTCTGGAGGCCAAGATGGGAGGATCACTTAAG
Transcript ID List	ENST00000543898.5; rmsk_2296413; ENST00000265724.7; ENST00000416177.1; ENST00000476862.1
External Link	RMBase: RNA-editing_site_124881
mod ID: A2ISITE002241		Click to Show/Hide the Full List
mod site	chr7:87611323-87611324:-		[6]
Sequence	TAATGGGCACTCTGGGTGATAGGATCAATAGAAGCCCAAAC
Transcript ID List	ENST00000416177.1; ENST00000543898.5; ENST00000476862.1; ENST00000265724.7; rmsk_2296417
External Link	RMBase: RNA-editing_site_124882
mod ID: A2ISITE002242		Click to Show/Hide the Full List
mod site	chr7:87611655-87611656:-		[6]
Sequence	TAAAATACATGCTATTTTCTAGCAAAGACATGTAATCAACC
Transcript ID List	ENST00000543898.5; ENST00000265724.7; ENST00000416177.1; ENST00000476862.1; rmsk_2296417
External Link	RMBase: RNA-editing_site_124883
mod ID: A2ISITE002243		Click to Show/Hide the Full List
mod site	chr7:87613628-87613629:-		[6]
Sequence	TATTTGGCTCCCATTTGTAAATGAAAGCATGTGGTACTTAG
Transcript ID List	ENST00000416177.1; ENST00000543898.5; ENST00000265724.7; ENST00000476862.1
External Link	RMBase: RNA-editing_site_124884

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004159		Click to Show/Hide the Full List
mod site	chr7:87516517-87516518:-
Sequence	GACAGCTACAGCACGGAAGGCCTAATGCCGGTGAGTTTGAT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000622132.4; ENST00000488737.6; ENST00000543898.5; ENST00000483831.1; ENST00000265724.7; ENST00000475929.5; ENST00000496821.5
External Link	RMBase: m5C_site_39781

N6-methyladenosine (m6A)

In total 27 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080698		Click to Show/Hide the Full List
mod site	chr7:87503842-87503843:-		[7]
Sequence	ACTGGAGTCATCTTGTCCAAACTGCCTGTGAATATATCTTC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000622132.4
External Link	RMBase: m6A_site_763675
mod ID: M6ASITE080699		Click to Show/Hide the Full List
mod site	chr7:87503873-87503874:-		[7]
Sequence	AGTGTCTATAATAAAACTAAACTTTCATGTGACTGGAGTCA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000543898.5; ENST00000488737.6; ENST00000265724.7; ENST00000622132.4
External Link	RMBase: m6A_site_763676
mod ID: M6ASITE080700		Click to Show/Hide the Full List
mod site	chr7:87503878-87503879:-		[7]
Sequence	CATAAAGTGTCTATAATAAAACTAAACTTTCATGTGACTGG
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000622132.4; ENST00000488737.6; ENST00000543898.5; ENST00000265724.7
External Link	RMBase: m6A_site_763677
mod ID: M6ASITE080701		Click to Show/Hide the Full List
mod site	chr7:87503958-87503959:-		[7]
Sequence	GTTTATATTTTCCCATTTGGACTGTAACTGACTGCCTTGCT
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000488737.6; ENST00000265724.7; ENST00000622132.4; ENST00000543898.5
External Link	RMBase: m6A_site_763678
mod ID: M6ASITE080702		Click to Show/Hide the Full List
mod site	chr7:87504040-87504041:-		[7]
Sequence	GGAGAGAAATCATAGTTTAAACTGCATTATAAATTTTATAA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000543898.5; ENST00000488737.6; ENST00000265724.7; ENST00000622132.4
External Link	RMBase: m6A_site_763679
mod ID: M6ASITE080703		Click to Show/Hide the Full List
mod site	chr7:87504072-87504073:-		[8]
Sequence	TTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; CD8T; Huh7
Seq Type List	MAZTER-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List	ENST00000543898.5; ENST00000265724.7; ENST00000622132.4; ENST00000488737.6
External Link	RMBase: m6A_site_763680
mod ID: M6ASITE080704		Click to Show/Hide the Full List
mod site	chr7:87504084-87504085:-		[7]
Sequence	GAGACTTCGTAATTAAAGGAACAGAGTGAGAGACATCATCA
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000622132.4; ENST00000488737.6; ENST00000265724.7; ENST00000543898.5
External Link	RMBase: m6A_site_763681
mod ID: M6ASITE080705		Click to Show/Hide the Full List
mod site	chr7:87504101-87504102:-		[7]
Sequence	CAAGTTCAGAGTCTTCAGAGACTTCGTAATTAAAGGAACAG
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000265724.7; ENST00000543898.5; ENST00000622132.4; ENST00000488737.6
External Link	RMBase: m6A_site_763682
mod ID: M6ASITE080706		Click to Show/Hide the Full List
mod site	chr7:87504167-87504168:-		[7]
Sequence	TTATTCAAAGTTAAAAGCAAACACTTACAGAATTATGAAGA
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000491360.1; ENST00000622132.4; ENST00000543898.5; ENST00000265724.7; ENST00000488737.6
External Link	RMBase: m6A_site_763683
mod ID: M6ASITE080707		Click to Show/Hide the Full List
mod site	chr7:87504241-87504242:-		[9]
Sequence	CTGGAACAAAGCGCCAGTGAACTCTGACTGTATGAGATGTT
Motif Score	3.373380952
Cell/Tissue List	HEK293T; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000488737.6; ENST00000543898.5; ENST00000622132.4; ENST00000265724.7; ENST00000491360.1
External Link	RMBase: m6A_site_763684
mod ID: M6ASITE080708		Click to Show/Hide the Full List
mod site	chr7:87504256-87504257:-		[9]
Sequence	TGGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGAACTCTG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000491360.1; ENST00000543898.5; ENST00000265724.7; ENST00000488737.6; ENST00000622132.4
External Link	RMBase: m6A_site_763685
mod ID: M6ASITE080709		Click to Show/Hide the Full List
mod site	chr7:87504363-87504364:-		[9]
Sequence	GTCCACCATCCAGAATGCAGACTTAATAGTGGTGTTTCAGA
Motif Score	3.319380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000265724.7; ENST00000622132.4; ENST00000488737.6; ENST00000543898.5; ENST00000491360.1
External Link	RMBase: m6A_site_763686
mod ID: M6ASITE080710		Click to Show/Hide the Full List
mod site	chr7:87505910-87505911:-		[10]
Sequence	AAGCCACGTCAGCTCTGGATACAGAAAGTGAAAAGGTAAGA
Motif Score	2.110482143
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000475929.5; ENST00000622132.4; ENST00000543898.5; ENST00000488737.6; ENST00000491360.1; ENST00000265724.7
External Link	RMBase: m6A_site_763687
mod ID: M6ASITE080711		Click to Show/Hide the Full List
mod site	chr7:87520778-87520779:-		[10]
Sequence	TCAGAGTTTGCAGGTACCATACAGGTAATAACCGCTGAAGA
Motif Score	2.110482143
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000265724.7; ENST00000483831.1; ENST00000543898.5; ENST00000622132.4; ENST00000496821.5; ENST00000488737.6
External Link	RMBase: m6A_site_763688
mod ID: M6ASITE080712		Click to Show/Hide the Full List
mod site	chr7:87544998-87544999:-		[10]
Sequence	ATATTTCTTATTTATTTTAGACAGCAGGAAATGAAGTTGAA
Motif Score	2.897386905
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000265724.7; ENST00000622132.4; ENST00000543898.5
External Link	RMBase: m6A_site_763689
mod ID: M6ASITE080713		Click to Show/Hide the Full List
mod site	chr7:87545870-87545871:-		[10]
Sequence	GCATTTACTTCAAACTTGTCACAATGCAGGTATAGTTTAAC
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000622132.4; ENST00000543898.5; ENST00000265724.7
External Link	RMBase: m6A_site_763690
mod ID: M6ASITE080714		Click to Show/Hide the Full List
mod site	chr7:87550279-87550280:-		[11]
Sequence	GTAGATCTTGAAGGGTCTGAACCTGAAGGTGCAGAGTGGGC
Motif Score	2.930744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000543898.5; ENST00000265724.7; ENST00000622132.4
External Link	RMBase: m6A_site_763691
mod ID: M6ASITE080715		Click to Show/Hide the Full List
mod site	chr7:87553879-87553880:-		[10]
Sequence	TTGGGATAAAGAAAGCTATTACAGCCAATATTTCTATAGGT
Motif Score	2.07285119
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000543898.5; ENST00000265724.7; ENST00000622132.4
External Link	RMBase: m6A_site_763692
mod ID: M6ASITE080716		Click to Show/Hide the Full List
mod site	chr7:87566799-87566800:-		[10]
Sequence	GCACGATGTTGGGGAGCTTAACACCCGACTTACAGAGTAAG
Motif Score	2.168095238
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000543898.5; ENST00000622132.4; ENST00000265724.7
External Link	RMBase: m6A_site_763693
mod ID: M6ASITE080717		Click to Show/Hide the Full List
mod site	chr7:87566888-87566889:-		[11]
Sequence	TGGTGCCTGGCAGCTGGAAGACAAATACACAAAATTAGAAA
Motif Score	2.897386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000265724.7; ENST00000622132.4; ENST00000543898.5
External Link	RMBase: m6A_site_763694
mod ID: M6ASITE080718		Click to Show/Hide the Full List
mod site	chr7:87570180-87570181:-		[11]
Sequence	CTTCATGAATCTGGAGGAAGACATGACCAGGTAATTAGACA
Motif Score	2.897386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000622132.4; ENST00000543898.5; ENST00000265724.7
External Link	RMBase: m6A_site_763695
mod ID: M6ASITE080719		Click to Show/Hide the Full List
mod site	chr7:87585525-87585526:-		[11]
Sequence	TTTAGAAGATCTGATGTCAAACATCACTAATAGAAGTAAGT
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000265724.7; ENST00000543898.5; ENST00000622132.4
External Link	RMBase: m6A_site_763696
mod ID: M6ASITE080720		Click to Show/Hide the Full List
mod site	chr7:87595789-87595790:-		[12]
Sequence	AAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTC
Motif Score	2.185083333
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000543898.5; ENST00000622132.4; ENST00000265724.7; ENST00000416177.1
External Link	RMBase: m6A_site_763697
mod ID: M6ASITE080721		Click to Show/Hide the Full List
mod site	chr7:87600125-87600126:-		[13]
Sequence	GAAGAACTTTTTTAAACTGAACAATAAAAGGTAACTAGCTT
Motif Score	2.951386905
Cell/Tissue List	HepG2; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000622132.4; ENST00000543898.5; ENST00000416177.1; ENST00000265724.7
External Link	RMBase: m6A_site_763698
mod ID: M6ASITE080722		Click to Show/Hide the Full List
mod site	chr7:87600130-87600131:-		[13]
Sequence	AAGAAGAAGAACTTTTTTAAACTGAACAATAAAAGGTAACT
Motif Score	2.627720238
Cell/Tissue List	HepG2; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000543898.5; ENST00000265724.7; ENST00000622132.4; ENST00000416177.1
External Link	RMBase: m6A_site_763699
mod ID: M6ASITE080723		Click to Show/Hide the Full List
mod site	chr7:87600140-87600141:-		[13]
Sequence	TGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAACAATA
Motif Score	3.373380952
Cell/Tissue List	HepG2; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000622132.4; ENST00000416177.1; ENST00000543898.5; ENST00000265724.7
External Link	RMBase: m6A_site_763700
mod ID: M6ASITE080724		Click to Show/Hide the Full List
mod site	chr7:87600167-87600168:-		[13]
Sequence	CGGAATGGATCTTGAAGGGGACCGCAATGGAGGAGCAAAGA
Motif Score	3.622404762
Cell/Tissue List	HepG2; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000416177.1; ENST00000622132.4; ENST00000265724.7; ENST00000543898.5
External Link	RMBase: m6A_site_763701

Ref 1	Binding of RNA m6A by IGF2BP3 triggers chemoresistance of HCT8 cells via upregulation of ABCB1. Am J Cancer Res. 2021 Apr 15;11(4):1428-1445. eCollection 2021.
Ref 2	METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. Exp Mol Med. 2021 Jan;53(1):91-102. doi: 10.1038/s12276-020-00510-w. Epub 2021 Jan 8.
Ref 3	Pharmacokinetics and pharmacodynamics of saruplase, an unglycosylated single-chain urokinase-type plasminogen activator, in patients with acute myocardial infarction. Thromb Haemost. 1994 Nov;72(5):740-4.
Ref 4	DrugBank 5.0: a major update to the DrugBank database for 2018. Nucleic Acids Res. 2018 Jan 4;46(D1):D1074-D1082. (ID: DB11760)
Ref 5	FDA Label of Enasidenib. The 2020 official website of the U.S. Food and Drug Administration.
Ref 6	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 7	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 10	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 11	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 12	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 13	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map