m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00323)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ABCB1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP3 | ||
| Cell Line | ES-2 cell line | Homo sapiens |
|
Treatment: siIGF2BP3 ES-2 cells
Control: siControl ES-2 cells
|
GSE109604 | |
| Regulation |
![]() ![]() |
logFC: -1.30E+00 p-value: 4.65E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Responsed Drug | Doxil | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| Cell Process | RNA stability | |||
| In-vitro Model | DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| HCT 15 | Colon adenocarcinoma | Homo sapiens | CVCL_0292 | |
| HCT 8 | Colon adenocarcinoma | Homo sapiens | CVCL_2478 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| SW1463 | Rectal adenocarcinoma | Homo sapiens | CVCL_1718 | |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 | |
| In-vivo Model | HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×106) into nude mice. | |||
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Caco-2 cell line | Homo sapiens |
|
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
|
GSE167075 | |
| Regulation |
![]() ![]() |
logFC: -1.24E+00 p-value: 2.14E-202 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Doxil | Approved | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Colorectal cancer [ICD-11: 2B91]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Doxil | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| Cell Process | RNA stability | |||
| In-vitro Model | DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| HCT 15 | Colon adenocarcinoma | Homo sapiens | CVCL_0292 | |
| HCT 8 | Colon adenocarcinoma | Homo sapiens | CVCL_2478 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| SW1463 | Rectal adenocarcinoma | Homo sapiens | CVCL_1718 | |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 | |
| In-vivo Model | HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×106) into nude mice. | |||
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Doxil | Approved | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
Doxil
[Approved]
| In total 2 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | IGF2BP3, directly bound to the m6A-modified region of ATP-dependent translocase ABCB1 (ABCB1) mRNA, thereby promoting the stability and expression of ABCB1 mRNA. The expression of IGF2BP3 and ABCB1 was strongly correlated with DOX sensitivity. Targeting IGF2BP3 was an important chemotherapeutic strategy for preventing MDR development in colorectal cancer. | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| Cell Process | RNA stability | |||
| In-vitro Model | DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| HCT 15 | Colon adenocarcinoma | Homo sapiens | CVCL_0292 | |
| HCT 8 | Colon adenocarcinoma | Homo sapiens | CVCL_2478 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| SW1463 | Rectal adenocarcinoma | Homo sapiens | CVCL_1718 | |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 | |
| In-vivo Model | HCT8/T xenografts derived from shNC or shIGF2BP3-1 HCT8/T cells were established through subcutaneous inoculation of cells (6×106) into nude mice. | |||
| Experiment 2 Reporting the m6A-centered Drug Response | [2] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of ATP-dependent translocase ABCB1 (ABCB1) and BCRP, and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05307 | ||
| Epigenetic Regulator | A1BG antisense RNA 1 (A1BG-AS1) | |
| Regulated Target | Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Drug | Adriamycin | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00323)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE002240 | Click to Show/Hide the Full List | ||
| mod site | chr7:87610353-87610354:- | [6] | |
| Sequence | TCCCAGCTACTCTGGAGGCCAAGATGGGAGGATCACTTAAG | ||
| Transcript ID List | ENST00000543898.5; rmsk_2296413; ENST00000265724.7; ENST00000416177.1; ENST00000476862.1 | ||
| External Link | RMBase: RNA-editing_site_124881 | ||
| mod ID: A2ISITE002241 | Click to Show/Hide the Full List | ||
| mod site | chr7:87611323-87611324:- | [6] | |
| Sequence | TAATGGGCACTCTGGGTGATAGGATCAATAGAAGCCCAAAC | ||
| Transcript ID List | ENST00000416177.1; ENST00000543898.5; ENST00000476862.1; ENST00000265724.7; rmsk_2296417 | ||
| External Link | RMBase: RNA-editing_site_124882 | ||
| mod ID: A2ISITE002242 | Click to Show/Hide the Full List | ||
| mod site | chr7:87611655-87611656:- | [6] | |
| Sequence | TAAAATACATGCTATTTTCTAGCAAAGACATGTAATCAACC | ||
| Transcript ID List | ENST00000543898.5; ENST00000265724.7; ENST00000416177.1; ENST00000476862.1; rmsk_2296417 | ||
| External Link | RMBase: RNA-editing_site_124883 | ||
| mod ID: A2ISITE002243 | Click to Show/Hide the Full List | ||
| mod site | chr7:87613628-87613629:- | [6] | |
| Sequence | TATTTGGCTCCCATTTGTAAATGAAAGCATGTGGTACTTAG | ||
| Transcript ID List | ENST00000416177.1; ENST00000543898.5; ENST00000265724.7; ENST00000476862.1 | ||
| External Link | RMBase: RNA-editing_site_124884 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 27 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE080698 | Click to Show/Hide the Full List | ||
| mod site | chr7:87503842-87503843:- | [7] | |
| Sequence | ACTGGAGTCATCTTGTCCAAACTGCCTGTGAATATATCTTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763675 | ||
| mod ID: M6ASITE080699 | Click to Show/Hide the Full List | ||
| mod site | chr7:87503873-87503874:- | [7] | |
| Sequence | AGTGTCTATAATAAAACTAAACTTTCATGTGACTGGAGTCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000488737.6; ENST00000265724.7; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763676 | ||
| mod ID: M6ASITE080700 | Click to Show/Hide the Full List | ||
| mod site | chr7:87503878-87503879:- | [7] | |
| Sequence | CATAAAGTGTCTATAATAAAACTAAACTTTCATGTGACTGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000488737.6; ENST00000543898.5; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763677 | ||
| mod ID: M6ASITE080701 | Click to Show/Hide the Full List | ||
| mod site | chr7:87503958-87503959:- | [7] | |
| Sequence | GTTTATATTTTCCCATTTGGACTGTAACTGACTGCCTTGCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000488737.6; ENST00000265724.7; ENST00000622132.4; ENST00000543898.5 | ||
| External Link | RMBase: m6A_site_763678 | ||
| mod ID: M6ASITE080702 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504040-87504041:- | [7] | |
| Sequence | GGAGAGAAATCATAGTTTAAACTGCATTATAAATTTTATAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000488737.6; ENST00000265724.7; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763679 | ||
| mod ID: M6ASITE080703 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504072-87504073:- | [8] | |
| Sequence | TTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T; CD8T; Huh7 | ||
| Seq Type List | MAZTER-seq; m6A-CLIP/IP; MeRIP-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000265724.7; ENST00000622132.4; ENST00000488737.6 | ||
| External Link | RMBase: m6A_site_763680 | ||
| mod ID: M6ASITE080704 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504084-87504085:- | [7] | |
| Sequence | GAGACTTCGTAATTAAAGGAACAGAGTGAGAGACATCATCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000488737.6; ENST00000265724.7; ENST00000543898.5 | ||
| External Link | RMBase: m6A_site_763681 | ||
| mod ID: M6ASITE080705 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504101-87504102:- | [7] | |
| Sequence | CAAGTTCAGAGTCTTCAGAGACTTCGTAATTAAAGGAACAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000543898.5; ENST00000622132.4; ENST00000488737.6 | ||
| External Link | RMBase: m6A_site_763682 | ||
| mod ID: M6ASITE080706 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504167-87504168:- | [7] | |
| Sequence | TTATTCAAAGTTAAAAGCAAACACTTACAGAATTATGAAGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000491360.1; ENST00000622132.4; ENST00000543898.5; ENST00000265724.7; ENST00000488737.6 | ||
| External Link | RMBase: m6A_site_763683 | ||
| mod ID: M6ASITE080707 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504241-87504242:- | [9] | |
| Sequence | CTGGAACAAAGCGCCAGTGAACTCTGACTGTATGAGATGTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000488737.6; ENST00000543898.5; ENST00000622132.4; ENST00000265724.7; ENST00000491360.1 | ||
| External Link | RMBase: m6A_site_763684 | ||
| mod ID: M6ASITE080708 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504256-87504257:- | [9] | |
| Sequence | TGGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGAACTCTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000491360.1; ENST00000543898.5; ENST00000265724.7; ENST00000488737.6; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763685 | ||
| mod ID: M6ASITE080709 | Click to Show/Hide the Full List | ||
| mod site | chr7:87504363-87504364:- | [9] | |
| Sequence | GTCCACCATCCAGAATGCAGACTTAATAGTGGTGTTTCAGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000622132.4; ENST00000488737.6; ENST00000543898.5; ENST00000491360.1 | ||
| External Link | RMBase: m6A_site_763686 | ||
| mod ID: M6ASITE080710 | Click to Show/Hide the Full List | ||
| mod site | chr7:87505910-87505911:- | [10] | |
| Sequence | AAGCCACGTCAGCTCTGGATACAGAAAGTGAAAAGGTAAGA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000475929.5; ENST00000622132.4; ENST00000543898.5; ENST00000488737.6; ENST00000491360.1; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763687 | ||
| mod ID: M6ASITE080711 | Click to Show/Hide the Full List | ||
| mod site | chr7:87520778-87520779:- | [10] | |
| Sequence | TCAGAGTTTGCAGGTACCATACAGGTAATAACCGCTGAAGA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000483831.1; ENST00000543898.5; ENST00000622132.4; ENST00000496821.5; ENST00000488737.6 | ||
| External Link | RMBase: m6A_site_763688 | ||
| mod ID: M6ASITE080712 | Click to Show/Hide the Full List | ||
| mod site | chr7:87544998-87544999:- | [10] | |
| Sequence | ATATTTCTTATTTATTTTAGACAGCAGGAAATGAAGTTGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000622132.4; ENST00000543898.5 | ||
| External Link | RMBase: m6A_site_763689 | ||
| mod ID: M6ASITE080713 | Click to Show/Hide the Full List | ||
| mod site | chr7:87545870-87545871:- | [10] | |
| Sequence | GCATTTACTTCAAACTTGTCACAATGCAGGTATAGTTTAAC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000543898.5; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763690 | ||
| mod ID: M6ASITE080714 | Click to Show/Hide the Full List | ||
| mod site | chr7:87550279-87550280:- | [11] | |
| Sequence | GTAGATCTTGAAGGGTCTGAACCTGAAGGTGCAGAGTGGGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000265724.7; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763691 | ||
| mod ID: M6ASITE080715 | Click to Show/Hide the Full List | ||
| mod site | chr7:87553879-87553880:- | [10] | |
| Sequence | TTGGGATAAAGAAAGCTATTACAGCCAATATTTCTATAGGT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000265724.7; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763692 | ||
| mod ID: M6ASITE080716 | Click to Show/Hide the Full List | ||
| mod site | chr7:87566799-87566800:- | [10] | |
| Sequence | GCACGATGTTGGGGAGCTTAACACCCGACTTACAGAGTAAG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000622132.4; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763693 | ||
| mod ID: M6ASITE080717 | Click to Show/Hide the Full List | ||
| mod site | chr7:87566888-87566889:- | [11] | |
| Sequence | TGGTGCCTGGCAGCTGGAAGACAAATACACAAAATTAGAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000622132.4; ENST00000543898.5 | ||
| External Link | RMBase: m6A_site_763694 | ||
| mod ID: M6ASITE080718 | Click to Show/Hide the Full List | ||
| mod site | chr7:87570180-87570181:- | [11] | |
| Sequence | CTTCATGAATCTGGAGGAAGACATGACCAGGTAATTAGACA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000543898.5; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763695 | ||
| mod ID: M6ASITE080719 | Click to Show/Hide the Full List | ||
| mod site | chr7:87585525-87585526:- | [11] | |
| Sequence | TTTAGAAGATCTGATGTCAAACATCACTAATAGAAGTAAGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000265724.7; ENST00000543898.5; ENST00000622132.4 | ||
| External Link | RMBase: m6A_site_763696 | ||
| mod ID: M6ASITE080720 | Click to Show/Hide the Full List | ||
| mod site | chr7:87595789-87595790:- | [12] | |
| Sequence | AAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000622132.4; ENST00000265724.7; ENST00000416177.1 | ||
| External Link | RMBase: m6A_site_763697 | ||
| mod ID: M6ASITE080721 | Click to Show/Hide the Full List | ||
| mod site | chr7:87600125-87600126:- | [13] | |
| Sequence | GAAGAACTTTTTTAAACTGAACAATAAAAGGTAACTAGCTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000543898.5; ENST00000416177.1; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763698 | ||
| mod ID: M6ASITE080722 | Click to Show/Hide the Full List | ||
| mod site | chr7:87600130-87600131:- | [13] | |
| Sequence | AAGAAGAAGAACTTTTTTAAACTGAACAATAAAAGGTAACT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000543898.5; ENST00000265724.7; ENST00000622132.4; ENST00000416177.1 | ||
| External Link | RMBase: m6A_site_763699 | ||
| mod ID: M6ASITE080723 | Click to Show/Hide the Full List | ||
| mod site | chr7:87600140-87600141:- | [13] | |
| Sequence | TGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAACAATA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000622132.4; ENST00000416177.1; ENST00000543898.5; ENST00000265724.7 | ||
| External Link | RMBase: m6A_site_763700 | ||
| mod ID: M6ASITE080724 | Click to Show/Hide the Full List | ||
| mod site | chr7:87600167-87600168:- | [13] | |
| Sequence | CGGAATGGATCTTGAAGGGGACCGCAATGGAGGAGCAAAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000416177.1; ENST00000622132.4; ENST00000265724.7; ENST00000543898.5 | ||
| External Link | RMBase: m6A_site_763701 | ||
References



