m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00214)

Target Name	Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27)
Synonyms	Cyclin-dependent kinase inhibitor p27; p27Kip1; KIP1 Click to Show/Hide
Gene Name	CDKN1B
Chromosomal Location	12p13.1
Family	CDI family
Function	Important regulator of cell cycle progression. Inhibits the kinase activity of CDK2 bound to cyclin A, but has little inhibitory activity on CDK2 bound to SPDYA. Involved in G1 arrest. Potent inhibitor of cyclin E- and cyclin A-CDK2 complexes. Forms a complex with cyclin type D-CDK4 complexes and is involved in the assembly, stability, and modulation of CCND1-CDK4 complex activation. Acts either as an inhibitor or an activator of cyclin type D-CDK4 complexes depending on its phosphorylation state and/or stoichometry. Click to Show/Hide
Gene ID	1027
Uniprot ID	CDN1B_HUMAN
HGNC ID	HGNC:1785
KEGG ID	hsa:1027

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CDKN1B can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27), and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	The role of YTHDF2 in tumourigenesis and cisplatin-desensitising function by promoting the degradation of Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) mRNA in an m6 A-dependent manner. YTHDF2 exhibits tumour oncogenic and cisplatin-desensitising properties, which offer insight into the development of novel combination therapeutic strategies for intrahepatic cholangiocarcinoma.
Target Regulation	Down regulation
Responsed Disease	Intrahepatic cholangiocarcinoma		ICD-11: 2C12.10	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Arrest cell cycle at G0/G1 phase
In-vitro Model	HuCC-T1	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_0324
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
	HCCC-9810 (The intrahepatic cholangiocarcinoma cell lines (HCCC-9810) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
	HIBEC (The normal intrahepatic bile duct cell line (HIBEC) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
In-vivo Model	For tumour xenograft models, 1 × 10⁷ HuCC-T1 cells in knockdown group or control group were implanted into the right flank of 5-week-old female nude mice. The volumes of tumour were recorded every 4 days by calliper. The volumes were calculated as length × width2/2. For patient-derived xenograft (PDX) model (PDX0075), ICC tissues from a patient, who relapsed in 6 months after R0 resection and subsequent chemotherapy with cisplatin and gemcitabine, were diced into 3 mm³ pieces and transplanted subcutaneously into the right flank of 5-week-old female B-NDG mice.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	The role of YTHDF2 in tumourigenesis and cisplatin-desensitising function by promoting the degradation of Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) mRNA in an m6 A-dependent manner. YTHDF2 exhibits tumour oncogenic and cisplatin-desensitising properties, which offer insight into the development of novel combination therapeutic strategies for intrahepatic cholangiocarcinoma.
Responsed Disease	Intrahepatic cholangiocarcinoma [ICD-11: 2C12.10]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Arrest cell cycle at G0/G1 phase
In-vitro Model	HuCC-T1	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_0324
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
	HCCC-9810 (The intrahepatic cholangiocarcinoma cell lines (HCCC-9810) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
	HIBEC (The normal intrahepatic bile duct cell line (HIBEC) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
In-vivo Model	For tumour xenograft models, 1 × 10⁷ HuCC-T1 cells in knockdown group or control group were implanted into the right flank of 5-week-old female nude mice. The volumes of tumour were recorded every 4 days by calliper. The volumes were calculated as length × width2/2. For patient-derived xenograft (PDX) model (PDX0075), ICC tissues from a patient, who relapsed in 6 months after R0 resection and subsequent chemotherapy with cisplatin and gemcitabine, were diced into 3 mm³ pieces and transplanted subcutaneously into the right flank of 5-week-old female B-NDG mice.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27), and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Cisplatin [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27), and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.
Experiment 2 Reporting the m6A-centered Drug Response				[4]
Response Summary	The role of YTHDF2 in tumourigenesis and cisplatin-desensitising function by promoting the degradation of Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) mRNA in an m6 A-dependent manner. YTHDF2 exhibits tumour oncogenic and cisplatin-desensitising properties, which offer insight into the development of novel combination therapeutic strategies for intrahepatic cholangiocarcinoma.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Intrahepatic cholangiocarcinoma		ICD-11: 2C12.10	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
Cell Process	Arrest cell cycle at G0/G1 phase
In-vitro Model	HuCC-T1	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_0324
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
	HCCC-9810 (The intrahepatic cholangiocarcinoma cell lines (HCCC-9810) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
	HIBEC (The normal intrahepatic bile duct cell line (HIBEC) were purchased from Cellcook Co., Ltd. (Guangzhou, China).)
In-vivo Model	For tumour xenograft models, 1 × 10⁷ HuCC-T1 cells in knockdown group or control group were implanted into the right flank of 5-week-old female nude mice. The volumes of tumour were recorded every 4 days by calliper. The volumes were calculated as length × width2/2. For patient-derived xenograft (PDX) model (PDX0075), ICC tissues from a patient, who relapsed in 6 months after R0 resection and subsequent chemotherapy with cisplatin and gemcitabine, were diced into 3 mm³ pieces and transplanted subcutaneously into the right flank of 5-week-old female B-NDG mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00493		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00494		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00495		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00496		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00497		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00498		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00499		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00500		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Wilms tumor 1-associating protein (WTAP)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00501		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00502		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: ELAV-like protein 1 (ELAVL1)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00503		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00504		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 222 (MIR222)
Crosstalk relationship	A-to-I → m6A

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00214)

Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005422		Click to Show/Hide the Full List
mod site	chr12:12715355-12715356:+		[5]
Sequence	GAAAAACTAAAGAGGATGAGACCTCTTGCTTGATCCTAGGT
Transcript ID List	ENST00000477087.1
External Link	RMBase: RNA-editing_site_26991

N6-methyladenosine (m6A)

In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE010820		Click to Show/Hide the Full List
mod site	chr12:12717523-12717524:+		[6]
Sequence	AGAGCGGCTGGGTTCGCGGGACCCGCGGGCTTGCACCCGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; GM12878; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177624
mod ID: M6ASITE010821		Click to Show/Hide the Full List
mod site	chr12:12717547-12717548:+		[6]
Sequence	GCGGGCTTGCACCCGCCCAGACTCGGACGGGCTTTGCCACC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; GM12878; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177625
mod ID: M6ASITE010822		Click to Show/Hide the Full List
mod site	chr12:12717634-12717635:+		[6]
Sequence	AGTCCATTTGATCAGCGGAGACTCGGCGGCCGGGCCGGGGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; GM12878; MM6; peripheral-blood; GSC-11; HEK293T; iSLK; TREX; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177626
mod ID: M6ASITE010823		Click to Show/Hide the Full List
mod site	chr12:12717826-12717827:+		[6]
Sequence	CGAGAGAGGCGGTCGTGCAGACCCGGGAGAAAGATGTCAAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; A549; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000396340.1; ENST00000477087.1
External Link	RMBase: m6A_site_177627
mod ID: M6ASITE010824		Click to Show/Hide the Full List
mod site	chr12:12717930-12717931:+		[6]
Sequence	CAAGCCCTCGGCCTGCAGGAACCTCTTCGGCCCGGTGGACC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000396340.1; ENST00000477087.1; ENST00000228872.9; ENST00000442489.1
External Link	RMBase: m6A_site_177628
mod ID: M6ASITE010825		Click to Show/Hide the Full List
mod site	chr12:12717948-12717949:+		[6]
Sequence	GAACCTCTTCGGCCCGGTGGACCACGAAGAGTTAACCCGGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000396340.1; ENST00000228872.9; ENST00000442489.1; ENST00000477087.1
External Link	RMBase: m6A_site_177629
mod ID: M6ASITE010826		Click to Show/Hide the Full List
mod site	chr12:12717969-12717970:+		[6]
Sequence	CCACGAAGAGTTAACCCGGGACTTGGAGAAGCACTGCAGAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000396340.1; ENST00000477087.1; ENST00000442489.1; ENST00000228872.9
External Link	RMBase: m6A_site_177630
mod ID: M6ASITE010827		Click to Show/Hide the Full List
mod site	chr12:12717990-12717991:+		[6]
Sequence	CTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000442489.1; ENST00000228872.9; ENST00000477087.1; ENST00000396340.1
External Link	RMBase: m6A_site_177631
mod ID: M6ASITE010828		Click to Show/Hide the Full List
mod site	chr12:12718038-12718039:+		[7]
Sequence	GAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9; ENST00000396340.1; ENST00000442489.1; ENST00000477087.1
External Link	RMBase: m6A_site_177632
mod ID: M6ASITE010829		Click to Show/Hide the Full List
mod site	chr12:12718042-12718043:+		[6]
Sequence	TTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000442489.1; ENST00000396340.1; ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177633
mod ID: M6ASITE010830		Click to Show/Hide the Full List
mod site	chr12:12718108-12718109:+		[6]
Sequence	TTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000477087.1; ENST00000442489.1; ENST00000396340.1
External Link	RMBase: m6A_site_177634
mod ID: M6ASITE010831		Click to Show/Hide the Full List
mod site	chr12:12718218-12718219:+		[6]
Sequence	GGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000477087.1; ENST00000442489.1; ENST00000228872.9; ENST00000396340.1
External Link	RMBase: m6A_site_177635
mod ID: M6ASITE010832		Click to Show/Hide the Full List
mod site	chr12:12718233-12718234:+		[6]
Sequence	TGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000396340.1; ENST00000442489.1; ENST00000477087.1
External Link	RMBase: m6A_site_177636
mod ID: M6ASITE010833		Click to Show/Hide the Full List
mod site	chr12:12718241-12718242:+		[6]
Sequence	CGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000396340.1; ENST00000228872.9; ENST00000442489.1; ENST00000477087.1
External Link	RMBase: m6A_site_177637
mod ID: M6ASITE010834		Click to Show/Hide the Full List
mod site	chr12:12718254-12718255:+		[6]
Sequence	CCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000477087.1; ENST00000442489.1; ENST00000396340.1
External Link	RMBase: m6A_site_177638
mod ID: M6ASITE010835		Click to Show/Hide the Full List
mod site	chr12:12718839-12718840:+		[6]
Sequence	CTTAGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000477087.1; ENST00000228872.9; ENST00000442489.1; ENST00000396340.1
External Link	RMBase: m6A_site_177639
mod ID: M6ASITE010836		Click to Show/Hide the Full List
mod site	chr12:12718856-12718857:+		[6]
Sequence	AAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000442489.1; ENST00000477087.1; ENST00000396340.1
External Link	RMBase: m6A_site_177640
mod ID: M6ASITE010837		Click to Show/Hide the Full List
mod site	chr12:12718946-12718947:+		[8]
Sequence	TCAGAAGACGTCAAACGTAAACAGCTCGGTGGGTTGATCAC
Motif Score	2.20572619
Cell/Tissue List	CD34; HEK293T; HeLa; A549; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000442489.1; ENST00000477087.1; ENST00000396340.1; ENST00000228872.9
External Link	RMBase: m6A_site_177641
mod ID: M6ASITE010838		Click to Show/Hide the Full List
mod site	chr12:12721127-12721128:+		[9]
Sequence	TTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000442489.1; ENST00000396340.1; ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177642
mod ID: M6ASITE010839		Click to Show/Hide the Full List
mod site	chr12:12721141-12721142:+		[6]
Sequence	TCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; brain; hESC-HEK293T; hNPCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000396340.1; ENST00000442489.1; ENST00000228872.9; ENST00000477087.1
External Link	RMBase: m6A_site_177643
mod ID: M6ASITE010840		Click to Show/Hide the Full List
mod site	chr12:12721164-12721165:+		[6]
Sequence	TCCTGTATAAGCACTGAAAAACAACAACACAATAACACTAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; hNPCs; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000442489.1; ENST00000228872.9; ENST00000396340.1; ENST00000477087.1
External Link	RMBase: m6A_site_177644
mod ID: M6ASITE010841		Click to Show/Hide the Full List
mod site	chr12:12721178-12721179:+		[7]
Sequence	TGAAAAACAACAACACAATAACACTAAAATTTTAGGCACTC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396340.1; ENST00000477087.1; ENST00000442489.1; ENST00000228872.9
External Link	RMBase: m6A_site_177645
mod ID: M6ASITE010842		Click to Show/Hide the Full List
mod site	chr12:12721180-12721181:+		[9]
Sequence	AAAAACAACAACACAATAACACTAAAATTTTAGGCACTCTT
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000477087.1; ENST00000228872.9; ENST00000442489.1; ENST00000396340.1
External Link	RMBase: m6A_site_177646
mod ID: M6ASITE010843		Click to Show/Hide the Full List
mod site	chr12:12721271-12721272:+		[9]
Sequence	TTCCTTATTTGCTTCATTGTACTACCTGTGTATATAGTTTT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9; ENST00000442489.1; ENST00000396340.1
External Link	RMBase: m6A_site_177647
mod ID: M6ASITE010844		Click to Show/Hide the Full List
mod site	chr12:12721274-12721275:+		[9]
Sequence	CTTATTTGCTTCATTGTACTACCTGTGTATATAGTTTTTAC
Motif Score	2.05802381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000442489.1; ENST00000228872.9; ENST00000396340.1
External Link	RMBase: m6A_site_177648
mod ID: M6ASITE010845		Click to Show/Hide the Full List
mod site	chr12:12721307-12721308:+		[7]
Sequence	GTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396340.1; ENST00000228872.9
External Link	RMBase: m6A_site_177649
mod ID: M6ASITE010846		Click to Show/Hide the Full List
mod site	chr12:12721313-12721314:+		[6]
Sequence	ACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; BGC823; hNPCs; hESCs; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000396340.1
External Link	RMBase: m6A_site_177650
mod ID: M6ASITE010847		Click to Show/Hide the Full List
mod site	chr12:12721348-12721349:+		[6]
Sequence	GGGCAGGGTGGGGCTGAGGAACTGACGTGGAGCGGGGTATG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; BGC823; hESCs; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000228872.9; ENST00000396340.1
External Link	RMBase: m6A_site_177651
mod ID: M6ASITE010848		Click to Show/Hide the Full List
mod site	chr12:12721483-12721484:+		[6]
Sequence	ATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; liver
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177652
mod ID: M6ASITE010849		Click to Show/Hide the Full List
mod site	chr12:12721522-12721523:+		[6]
Sequence	AAAAAATCACAAAAATTTGAACACTGGCTAAAGATAATTGC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177653
mod ID: M6ASITE010850		Click to Show/Hide the Full List
mod site	chr12:12721554-12721555:+		[7]
Sequence	GATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177654
mod ID: M6ASITE010851		Click to Show/Hide the Full List
mod site	chr12:12721652-12721653:+		[6]
Sequence	TTTTTAAAAAAGCAACAGAAACCTATCCTCACTGCCCTCCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177655
mod ID: M6ASITE010852		Click to Show/Hide the Full List
mod site	chr12:12721662-12721663:+		[9]
Sequence	AGCAACAGAAACCTATCCTCACTGCCCTCCCCAGTCTCTCT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177656
mod ID: M6ASITE010853		Click to Show/Hide the Full List
mod site	chr12:12721813-12721814:+		[7]
Sequence	TGCTTTTATTAAATTTGTTGACAAAATTTTCTCATTTTCTT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177657
mod ID: M6ASITE010854		Click to Show/Hide the Full List
mod site	chr12:12721837-12721838:+		[9]
Sequence	AATTTTCTCATTTTCTTTTCACTTCGGGCTGTGTAAACACA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177658
mod ID: M6ASITE010855		Click to Show/Hide the Full List
mod site	chr12:12721853-12721854:+		[7]
Sequence	TTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177659
mod ID: M6ASITE010856		Click to Show/Hide the Full List
mod site	chr12:12721910-12721911:+		[7]
Sequence	AAAGATCTGTAAGTAACTTCACATTAAAAAATGAAATATTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177660
mod ID: M6ASITE010857		Click to Show/Hide the Full List
mod site	chr12:12721946-12721947:+		[9]
Sequence	TATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177661
mod ID: M6ASITE010858		Click to Show/Hide the Full List
mod site	chr12:12722008-12722009:+		[7]
Sequence	AGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177662
mod ID: M6ASITE010859		Click to Show/Hide the Full List
mod site	chr12:12722047-12722048:+		[6]
Sequence	AATGGATACTACATCTTTAAACAGTATTTCATTGCCTGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177663
mod ID: M6ASITE010860		Click to Show/Hide the Full List
mod site	chr12:12722076-12722077:+		[6]
Sequence	CATTGCCTGTGTATGGAAAAACCATTTGAAGTGTACCTGTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177664
mod ID: M6ASITE010861		Click to Show/Hide the Full List
mod site	chr12:12722098-12722099:+		[7]
Sequence	CATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177665
mod ID: M6ASITE010862		Click to Show/Hide the Full List
mod site	chr12:12722114-12722115:+		[6]
Sequence	GTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAAC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177666
mod ID: M6ASITE010863		Click to Show/Hide the Full List
mod site	chr12:12722116-12722117:+		[9]
Sequence	GTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTT
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177667
mod ID: M6ASITE010864		Click to Show/Hide the Full List
mod site	chr12:12722167-12722168:+		[6]
Sequence	AAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177668
mod ID: M6ASITE010865		Click to Show/Hide the Full List
mod site	chr12:12722174-12722175:+		[7]
Sequence	TTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177669
mod ID: M6ASITE010866		Click to Show/Hide the Full List
mod site	chr12:12722278-12722279:+		[9]
Sequence	CTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177670
mod ID: M6ASITE010867		Click to Show/Hide the Full List
mod site	chr12:12722331-12722332:+		[7]
Sequence	AAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177671
mod ID: M6ASITE010868		Click to Show/Hide the Full List
mod site	chr12:12722356-12722357:+		[6]
Sequence	TTAAGTAATCAATAAAGAAAACTTCCATAGCTATTCATTGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228872.9
External Link	RMBase: m6A_site_177672

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000012		Click to Show/Hide the Full List
mod site	chr12:12721335-12721336:+		[10]
Sequence	TTTGGGGAAGGGAGGGCAGGGTGGGGCTGAGGAACTGACGT
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000396340.1; ENST00000228872.9
External Link	RMBase: m7G_site_196

Ref 1	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 2	Structural determinants of P-glycoprotein-mediated transport of glucocorticoids. Pharm Res. 2003 Nov;20(11):1794-803. doi: 10.1023/b:pham.0000003377.39548.f6.
Ref 3	YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nat Commun. 2019 Oct 25;10(1):4892. doi: 10.1038/s41467-019-12801-6.
Ref 4	YTHDF2 promotes intrahepatic cholangiocarcinoma progression and desensitises cisplatin treatment by increasing CDKN1B mRNA degradation. Clin Transl Med. 2022 Jun;12(6):e848. doi: 10.1002/ctm2.848.
Ref 5	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map