m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00196)
Target Name Apoptosis regulator Bcl-2 (BCL2)
Gene Name BCL2
Chromosomal Location 18q21.33
Family Bcl-2 family
Function
Suppresses apoptosis in a variety of cell systems including factor-dependent lymphohematopoietic and neural cells . Regulates cell death by controlling the mitochondrial membrane permeability. Appears to function in a feedback loop system with caspases. Inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor (APAF-1). Also acts as an inhibitor of autophagy: interacts with BECN1 and AMBRA1 during non-starvation conditions and inhibits their autophagy function. May attenuate inflammation by impairing NLRP1-inflammasome activation, hence CASP1 activation and IL1B release.
    Click to Show/Hide
Gene ID 596
Uniprot ID
BCL2_HUMAN
HGNC ID
HGNC:990
KEGG ID
hsa:596
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
BCL2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Th1 cell line Mus musculus
Treatment: METTL3 knockout splenic Th1 cells
Control: Wild type splenic Th1 cells
 GSE129648
Regulation
logFC: 7.38E-01
p-value: 3.55E-06
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between BCL2 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 6.70E+00 GSE60213
In total 6 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of BAX while rescuing Apoptosis regulator Bcl-2 (BCL2) expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Atg7 and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Target Regulation Down regulation
Responsed Disease Enterovirus ICD-11: 1A2Y
 Disease Info 
Pathway Response Autophagy hsa04140
Apoptosis hsa04210
Cell Process Cell proliferation and metastasis
Cell apoptosis
Cell autophagy
In-vitro Model Schwann cells (A type of glial cell that surrounds neurons)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, Apoptosis regulator Bcl-2 (BCL2) and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell differentiation and apoptosis
In-vitro Model HSPC (Human hematopoietic stem cell)
In-vivo Model 500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Target Regulation Up regulation
Responsed Disease B-cell lymphomas ICD-11: 2A86
 Disease Info 
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [4]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Apoptosis regulator Bcl-2 (BCL2) and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene [5]
Response Summary METTL3 regulated cellular growth, survival and migration in non-small cell lung cancer. METTL3 promoted non-small cell lung cancer progression by modulating the level of Apoptosis regulator Bcl-2 (BCL2).
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
BEAS-2B Normal Homo sapiens CVCL_0168
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model The mice were housed with filtered air, 12 h light/dark cycle, constant temperature (25℃), relative humidity (50±5%) and free access to food and water. In order to establish a human NSCLC xenograft model, 5×106 H1299, sh-METTL3-H1299 and METTL3 stably overexpressed H1299 cells (2×106 per mouse) were subcutaneously injected into mice. Tumor growth was observed daily. Tumor volume was calculated as follows: 0.5× (length × width2). At 24 days post-inoculation, the maximum diameter exhibited by a single subcutaneous tumor was 15 mm and mice were anesthetized by intraperitoneal administration of sodium pentobarbital (50 mg/kg), then sacrificed by cervical dislocation.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene [6]
Response Summary Apoptosis regulator Bcl-2 (BCL2) acted as the target of METTL3, thereby regulating the proliferation and apoptosis of breast cancer.
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model MCF-10A Normal Homo sapiens CVCL_0598
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-453 Breast adenocarcinoma Homo sapiens CVCL_0418
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
In-vivo Model Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Ftoflox/flox) and adipose-selective fto knockout (Fabp4-Cre Ftoflox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line NB4 cell line Homo sapiens
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
 GSE103494
Regulation
logFC: -6.55E-01
p-value: 1.57E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [7]
Response Summary Studies of the aberrant expression of m6A mediators in breast cancer revealed that they were associated with different BC subtypes and functions, such as proliferation, apoptosis, stemness, the cell cycle, migration, and metastasis, through several factors and signaling pathways, such as Apoptosis regulator Bcl-2 (BCL2) and the PI3K/Akt pathway, among others. Fat mass and obesity-associated protein (FTO) was identified as the first m6A demethylase, and a series of inhibitors that target FTO were reported to have potential for the treatment of BC by inhibiting cell proliferation and promoting apoptosis.
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell apoptosis
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1
Cell Line ES-2 cell line Homo sapiens
Treatment: siIGF2BP1 ES-2 cells
Control: siControl ES-2 cells
 GSE109604
Regulation
logFC: -7.97E-01
p-value: 9.99E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and Apoptosis regulator Bcl-2 (BCL2) in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line MDA-MB-231 Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells
Control: MDA-MB-231 cells
 GSE81164
Regulation
logFC: 6.46E-01
p-value: 1.74E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [9]
Response Summary Knocking down METTL14 could inhibit the development of atherosclerosis in high-fat diet-treated APOE mice. After transfection with si-METTL14, the Apoptosis regulator Bcl-2 (BCL2) expression level and the viability of ox-LDL-incubated cells increased, whereas the apoptosis rate and the expressions of Bax and cleaved caspase-3 decreased. However, the effect of METTL14 knockdown was reversed by p65 overexpression.
Target Regulation Down regulation
Responsed Disease Atherosclerosis ICD-11: BD40.Z
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HUVEC-C Normal Homo sapiens CVCL_2959
EA.hy 926 Normal Homo sapiens CVCL_3901
In-vivo Model The mice were randomly divided into control, Ad-sh-NC, and Ad-sh-METTL14 groups (10 mice per group). The mice in the control group were fed a normal diet, while the Ad-sh-NC and Ad-sh-METTL14 groups were fed a high-fat diet (20% fat and 0.25% cholesterol). Furthermore, 300 uL of constructed sh-NC or sh-METTL14 adenovirus was injected every 3 weeks into the caudal veins of mice from the Ad-sh-NC or Ad-sh-METTL14 groups, respectively. The constructed vectors were obtained from HanBio Technology Co., Ltd. (Shanghai, China). All mice were sacrificed after 24 weeks and the aortas were separated for further experiments.
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line CAG cell line Homo sapiens
Treatment: shALKBH5 CAG cells
Control: shNC CAG cells
 GSE180214
Regulation
logFC: -7.25E-01
p-value: 1.10E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [10]
Response Summary ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and Apoptosis regulator Bcl-2 (BCL2)-Beclin1 complex. ALKBH5 activated EGFR-PIK3CA-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Target Regulation Up regulation
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Autophagy hsa04140
In-vitro Model A2780 Ovarian endometrioid adenocarcinoma Homo sapiens CVCL_0134
CoC1 Ovarian adenocarcinoma Homo sapiens CVCL_6891
OVCAR-3 Ovarian serous adenocarcinoma Homo sapiens CVCL_0465
SK-OV-3 Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
In-vivo Model SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 106 cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between BCL2 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 2.25E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Target Regulation Up regulation
Responsed Disease B-cell lymphomas ICD-11: 2A86
 Disease Info 
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and Apoptosis regulator Bcl-2 (BCL2) in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [8]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and Apoptosis regulator Bcl-2 (BCL2) in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation Up regulation
Responsed Disease Myeloid leukaemia ICD-11: 2B33.1
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Enterovirus [ICD-11: 1A2Y]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of BAX while rescuing Apoptosis regulator Bcl-2 (BCL2) expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Atg7 and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Responsed Disease Enterovirus [ICD-11: 1A2Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Autophagy hsa04140
Apoptosis hsa04210
Cell Process Cell proliferation and metastasis
Cell apoptosis
Cell autophagy
In-vitro Model Schwann cells (A type of glial cell that surrounds neurons)
Acute myeloid leukaemia [ICD-11: 2A60]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 depletion in human myeloid leukemia cell lines induces cell differentiation and apoptosis and delays leukemia progression in recipient mice in vivo. Single-nucleotide-resolution mapping of m6A coupled with ribosome profiling reveals that m6A promotes the translation of c-MYC, Apoptosis regulator Bcl-2 (BCL2) and PTEN mRNAs in the human acute myeloid leukemia MOLM-13 cell line. Moreover, loss of METTL3 leads to increased levels of phosphorylated AKT.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell differentiation and apoptosis
In-vitro Model HSPC (Human hematopoietic stem cell)
In-vivo Model 500,000 selected cells were injected via tail vein or retro-orbital route into female NSG (6-8 week old) recipient mice that had been sublethally irradiated with 475 cGy one day before transplantation.
B-cell lymphomas [ICD-11: 2A86]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Responsed Disease B-cell lymphomas [ICD-11: 2A86]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Experiment 2 Reporting the m6A-centered Disease Response [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Responsed Disease B-cell lymphomas [ICD-11: 2A86]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Malignant haematopoietic neoplasm [ICD-11: 2B33]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [8]
Response Summary YBX1 selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and Apoptosis regulator Bcl-2 (BCL2) in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Responsed Disease Myeloid leukaemia [ICD-11: 2B33.1]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell apoptosis
In-vitro Model Leukemia stem cell line (Leukemia stem cell line)
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
MOLM-13 Adult acute myeloid leukemia Homo sapiens CVCL_2119
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
BV-173 Chronic myelogenous leukemia Homo sapiens CVCL_0181
NOMO-1 Adult acute monocytic leukemia Homo sapiens CVCL_1609
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KG-1a Adult acute myeloid leukemia Homo sapiens CVCL_1824
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [4]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Apoptosis regulator Bcl-2 (BCL2) and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [5]
Response Summary METTL3 regulated cellular growth, survival and migration in non-small cell lung cancer. METTL3 promoted non-small cell lung cancer progression by modulating the level of Apoptosis regulator Bcl-2 (BCL2).
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
BEAS-2B Normal Homo sapiens CVCL_0168
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model The mice were housed with filtered air, 12 h light/dark cycle, constant temperature (25℃), relative humidity (50±5%) and free access to food and water. In order to establish a human NSCLC xenograft model, 5×106 H1299, sh-METTL3-H1299 and METTL3 stably overexpressed H1299 cells (2×106 per mouse) were subcutaneously injected into mice. Tumor growth was observed daily. Tumor volume was calculated as follows: 0.5× (length × width2). At 24 days post-inoculation, the maximum diameter exhibited by a single subcutaneous tumor was 15 mm and mice were anesthetized by intraperitoneal administration of sodium pentobarbital (50 mg/kg), then sacrificed by cervical dislocation.
Breast cancer [ICD-11: 2C60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [7]
Response Summary Studies of the aberrant expression of m6A mediators in breast cancer revealed that they were associated with different BC subtypes and functions, such as proliferation, apoptosis, stemness, the cell cycle, migration, and metastasis, through several factors and signaling pathways, such as Apoptosis regulator Bcl-2 (BCL2) and the PI3K/Akt pathway, among others. Fat mass and obesity-associated protein (FTO) was identified as the first m6A demethylase, and a series of inhibitors that target FTO were reported to have potential for the treatment of BC by inhibiting cell proliferation and promoting apoptosis.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell apoptosis
Experiment 2 Reporting the m6A-centered Disease Response [6]
Response Summary Apoptosis regulator Bcl-2 (BCL2) acted as the target of METTL3, thereby regulating the proliferation and apoptosis of breast cancer.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model MCF-10A Normal Homo sapiens CVCL_0598
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-453 Breast adenocarcinoma Homo sapiens CVCL_0418
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
In-vivo Model Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Ftoflox/flox) and adipose-selective fto knockout (Fabp4-Cre Ftoflox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [10]
Response Summary ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and Apoptosis regulator Bcl-2 (BCL2)-Beclin1 complex. ALKBH5 activated EGFR-PIK3CA-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Up regulation
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Autophagy hsa04140
In-vitro Model A2780 Ovarian endometrioid adenocarcinoma Homo sapiens CVCL_0134
CoC1 Ovarian adenocarcinoma Homo sapiens CVCL_6891
OVCAR-3 Ovarian serous adenocarcinoma Homo sapiens CVCL_0465
SK-OV-3 Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
In-vivo Model SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 106 cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.
Atherosclerosis [ICD-11: BD40]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [9]
Response Summary Knocking down METTL14 could inhibit the development of atherosclerosis in high-fat diet-treated APOE mice. After transfection with si-METTL14, the Apoptosis regulator Bcl-2 (BCL2) expression level and the viability of ox-LDL-incubated cells increased, whereas the apoptosis rate and the expressions of Bax and cleaved caspase-3 decreased. However, the effect of METTL14 knockdown was reversed by p65 overexpression.
Responsed Disease Atherosclerosis [ICD-11: BD40.Z]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HUVEC-C Normal Homo sapiens CVCL_2959
EA.hy 926 Normal Homo sapiens CVCL_3901
In-vivo Model The mice were randomly divided into control, Ad-sh-NC, and Ad-sh-METTL14 groups (10 mice per group). The mice in the control group were fed a normal diet, while the Ad-sh-NC and Ad-sh-METTL14 groups were fed a high-fat diet (20% fat and 0.25% cholesterol). Furthermore, 300 uL of constructed sh-NC or sh-METTL14 adenovirus was injected every 3 weeks into the caudal veins of mice from the Ad-sh-NC or Ad-sh-METTL14 groups, respectively. The constructed vectors were obtained from HanBio Technology Co., Ltd. (Shanghai, China). All mice were sacrificed after 24 weeks and the aortas were separated for further experiments.
Dentofacial anomalies [ICD-11: DA0E]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Responsed Disease Temporomandibular joint disorders [ICD-11: DA0E.8]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Experiment 2 Reporting the m6A-centered Disease Response [3]
Response Summary Mettl3 inhibitor, S-adenosylhomocysteine promoted the apoptosis and autophagy of chondrocytes with inflammation in vitro and aggravated the degeneration of chondrocytes and subchondral bone in monosodium iodoacetate (MIA) induced temporomandibular joint osteoarthritis mice in vivo. Bcl2 protein interacted with Beclin1 protein in chondrocytes induced by TNF-alpha stimulation. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through m6A/Ythdf1/Apoptosis regulator Bcl-2 (BCL2) signal axis which provides promising therapeutic strategy for temporomandibular joint osteoarthritis.
Responsed Disease Temporomandibular joint disorders [ICD-11: DA0E.8]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
In-vitro Model ATDC-5 Mouse teratocarcinoma Mus musculus CVCL_3894
In-vivo Model For MIA + SAH control, S-adenosylhomocysteine (SAH), Mettl3 inhibitor (10 mg/kg) (MCE, NJ, USA) was injected intraperitoneally before MIA injection and maintained twice a week until mice were sacrificed.
Meclofenamic acid [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [7]
Response Summary Studies of the aberrant expression of m6A mediators in breast cancer revealed that they were associated with different BC subtypes and functions, such as proliferation, apoptosis, stemness, the cell cycle, migration, and metastasis, through several factors and signaling pathways, such as Apoptosis regulator Bcl-2 (BCL2) and the PI3K/Akt pathway, among others. Fat mass and obesity-associated protein (FTO) was identified as the first m6A demethylase, and a series of inhibitors that target FTO were reported to have potential for the treatment of BC by inhibiting cell proliferation and promoting apoptosis.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell apoptosis
R-2HG [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [7]
Response Summary Studies of the aberrant expression of m6A mediators in breast cancer revealed that they were associated with different BC subtypes and functions, such as proliferation, apoptosis, stemness, the cell cycle, migration, and metastasis, through several factors and signaling pathways, such as Apoptosis regulator Bcl-2 (BCL2) and the PI3K/Akt pathway, among others. Fat mass and obesity-associated protein (FTO) was identified as the first m6A demethylase, and a series of inhibitors that target FTO were reported to have potential for the treatment of BC by inhibiting cell proliferation and promoting apoptosis.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell apoptosis
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02123
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Drug Celastrol
 Drug Info 
Crosstalk ID: M6ACROT02132
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Drug Celastrol
 Drug Info 
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03634
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00196)
Apoptosis regulator Bcl-2 (BCL2)
Adenosine-to-Inosine editing (A-to-I)
In total 23 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008682 Click to Show/Hide the Full List
mod site chr18:63192681-63192682:- [19]
Sequence TTGGAGCTGATGCAATGGCAAGTGCTGTGGCCGTGGTATCC
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63837
mod ID: A2ISITE008683 Click to Show/Hide the Full List
mod site chr18:63211745-63211746:- [19]
Sequence ACACAGCTTGCAGCCACAGTAGGACAATGCCAAGTCCAATG
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63838
mod ID: A2ISITE008684 Click to Show/Hide the Full List
mod site chr18:63234217-63234218:- [20]
Sequence GGGAGAGCATCAGAATAAATAGCTAATGCATACGGAGCTTA
Transcript ID List ENST00000398117.1; ENST00000333681.5; rmsk_4883120
External Link RMBase: RNA-editing_site_63839
mod ID: A2ISITE008685 Click to Show/Hide the Full List
mod site chr18:63240081-63240082:- [20]
Sequence TGGGAGGATTGCTTGAGCCCAGGAGGGAGAGATTGTAGTGA
Transcript ID List ENST00000398117.1; ENST00000333681.5; rmsk_4883129
External Link RMBase: RNA-editing_site_63840
mod ID: A2ISITE008686 Click to Show/Hide the Full List
mod site chr18:63246507-63246508:- [19]
Sequence TCATGAGACCTGGTGGTTTTATAAAGGGGAGTTTGCCTGCA
Transcript ID List ENST00000333681.5; ENST00000398117.1; rmsk_4883138
External Link RMBase: RNA-editing_site_63841
mod ID: A2ISITE008687 Click to Show/Hide the Full List
mod site chr18:63246532-63246533:- [19]
Sequence GTGCTGTTGTGATAATGAATAAGTCTCATGAGACCTGGTGG
Transcript ID List ENST00000333681.5; ENST00000398117.1; rmsk_4883138
External Link RMBase: RNA-editing_site_63842
mod ID: A2ISITE008688 Click to Show/Hide the Full List
mod site chr18:63246587-63246588:- [19]
Sequence TGTCATGGGAGGGAGCGGGTAGGATGTAATTGAATCATGGG
Transcript ID List ENST00000398117.1; rmsk_4883138; ENST00000333681.5
External Link RMBase: RNA-editing_site_63843
mod ID: A2ISITE008689 Click to Show/Hide the Full List
mod site chr18:63246626-63246627:- [19]
Sequence CAAATTTCATCTTGGATCGTAGCTCCCACAATTCCCACATG
Transcript ID List rmsk_4883138; ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63844
mod ID: A2ISITE008690 Click to Show/Hide the Full List
mod site chr18:63252485-63252486:- [19]
Sequence TCCCACCGGGTTCCTCCCACAGCATGTGGGAATTGTGGGAG
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63845
mod ID: A2ISITE008691 Click to Show/Hide the Full List
mod site chr18:63252517-63252518:- [19]
Sequence GCAGAAAGACCTACCACCATAATTCAATTGCCTCCCACCGG
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63846
mod ID: A2ISITE008692 Click to Show/Hide the Full List
mod site chr18:63252580-63252581:- [20]
Sequence AGGGAACTCCCATTTTTAAAACCATCACATCTTGTGAGACT
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63847
mod ID: A2ISITE008693 Click to Show/Hide the Full List
mod site chr18:63252581-63252582:- [20]
Sequence CAGGGAACTCCCATTTTTAAAACCATCACATCTTGTGAGAC
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63848
mod ID: A2ISITE008694 Click to Show/Hide the Full List
mod site chr18:63252804-63252805:- [19]
Sequence TCAAATTTACAAAGTGTATTAGTCTGTTTTCACGCTGTTGA
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63849
mod ID: A2ISITE008695 Click to Show/Hide the Full List
mod site chr18:63277421-63277422:- [20]
Sequence CAGGCTGGTCTCAAATGCCTAACCTTGAGTGATTTTCCTTC
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63850
mod ID: A2ISITE008696 Click to Show/Hide the Full List
mod site chr18:63296330-63296331:- [20]
Sequence CACTCCAGCCTGGATGACAGAGTGAGACCTTGTCTCAAAAA
Transcript ID List rmsk_4883223; ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63851
mod ID: A2ISITE008697 Click to Show/Hide the Full List
mod site chr18:63299836-63299837:- [20]
Sequence CTGGGCTTGAAGGATACATAAGAGTTTGTTCAAAAAAAAAA
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63852
mod ID: A2ISITE008698 Click to Show/Hide the Full List
mod site chr18:63299837-63299838:- [19]
Sequence CCTGGGCTTGAAGGATACATAAGAGTTTGTTCAAAAAAAAA
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63853
mod ID: A2ISITE008699 Click to Show/Hide the Full List
mod site chr18:63299839-63299840:- [20]
Sequence GGCCTGGGCTTGAAGGATACATAAGAGTTTGTTCAAAAAAA
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63854
mod ID: A2ISITE008700 Click to Show/Hide the Full List
mod site chr18:63299841-63299842:- [19]
Sequence TTGGCCTGGGCTTGAAGGATACATAAGAGTTTGTTCAAAAA
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63855
mod ID: A2ISITE008701 Click to Show/Hide the Full List
mod site chr18:63299870-63299871:- [20]
Sequence TAAGGATGGTTTCACAGAGAAGGTGCCGTTTGGCCTGGGCT
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63856
mod ID: A2ISITE008702 Click to Show/Hide the Full List
mod site chr18:63299875-63299876:- [19]
Sequence AAAGTTAAGGATGGTTTCACAGAGAAGGTGCCGTTTGGCCT
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: RNA-editing_site_63857
mod ID: A2ISITE008703 Click to Show/Hide the Full List
mod site chr18:63300391-63300392:- [19]
Sequence TTTTTTGAACAAACTCTTACATATCCTTCAAGCCCAGGCCA
Transcript ID List ENST00000398117.1; ENST00000333681.5; rmsk_4883235
External Link RMBase: RNA-editing_site_63858
mod ID: A2ISITE008704 Click to Show/Hide the Full List
mod site chr18:63300393-63300394:- [19]
Sequence TTTTTTTTGAACAAACTCTTACATATCCTTCAAGCCCAGGC
Transcript ID List rmsk_4883235; ENST00000333681.5; ENST00000398117.1
External Link RMBase: RNA-editing_site_63859
N6-methyladenosine (m6A)
In total 92 m6A sequence/site(s) in this target gene
mod ID: M6ASITE037566 Click to Show/Hide the Full List
mod site chr18:63123857-63123858:- [21]
Sequence GAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGT
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403695
mod ID: M6ASITE037567 Click to Show/Hide the Full List
mod site chr18:63123894-63123895:- [21]
Sequence TGAGACTATTAATAAATAAGACTGTAGTGTAGATACTGAGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403696
mod ID: M6ASITE037568 Click to Show/Hide the Full List
mod site chr18:63123910-63123911:- [21]
Sequence TCAATCAAGAAAATTCTGAGACTATTAATAAATAAGACTGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; endometrial; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403697
mod ID: M6ASITE037569 Click to Show/Hide the Full List
mod site chr18:63123957-63123958:- [21]
Sequence GCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; MM6; CD4T; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403698
mod ID: M6ASITE037570 Click to Show/Hide the Full List
mod site chr18:63124013-63124014:- [21]
Sequence AGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; MM6; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1; rmsk_4882956
External Link RMBase: m6A_site_403699
mod ID: M6ASITE037571 Click to Show/Hide the Full List
mod site chr18:63124041-63124042:- [21]
Sequence TACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; CD8T; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List rmsk_4882956; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403700
mod ID: M6ASITE037572 Click to Show/Hide the Full List
mod site chr18:63124119-63124120:- [21]
Sequence TTGGACAACCATGACCTTGGACAATCATGAAATATGCATCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; hNPCs; GM12878; CD8T
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List rmsk_4882956; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403701
mod ID: M6ASITE037573 Click to Show/Hide the Full List
mod site chr18:63124135-63124136:- [21]
Sequence ATTCTGTTCCATGTCTTTGGACAACCATGACCTTGGACAAT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; GM12878
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List rmsk_4882956; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403702
mod ID: M6ASITE037574 Click to Show/Hide the Full List
mod site chr18:63124205-63124206:-
Sequence ATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAAT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403703
mod ID: M6ASITE037575 Click to Show/Hide the Full List
mod site chr18:63124475-63124476:- [21]
Sequence ATGTGATGCCTCTGCGAAGAACCTTGTGTGACAAATGAGAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403704
mod ID: M6ASITE037576 Click to Show/Hide the Full List
mod site chr18:63124511-63124512:- [21]
Sequence CAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403705
mod ID: M6ASITE037577 Click to Show/Hide the Full List
mod site chr18:63124527-63124528:- [21]
Sequence AAGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403706
mod ID: M6ASITE037578 Click to Show/Hide the Full List
mod site chr18:63125266-63125267:- [22]
Sequence AGCACCTCAATTTAGTTCAAACAAGACGCCAACATTCTCTC
Motif Score 2.20572619
Cell/Tissue List MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403707
mod ID: M6ASITE037579 Click to Show/Hide the Full List
mod site chr18:63125331-63125332:- [21]
Sequence AGATTTGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403708
mod ID: M6ASITE037580 Click to Show/Hide the Full List
mod site chr18:63125448-63125449:- [21]
Sequence AAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTC
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; MM6; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403709
mod ID: M6ASITE037581 Click to Show/Hide the Full List
mod site chr18:63125458-63125459:- [21]
Sequence AAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; MM6; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403710
mod ID: M6ASITE037582 Click to Show/Hide the Full List
mod site chr18:63125493-63125494:- [21]
Sequence ATGCACTTTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCC
Motif Score 3.643047619
Cell/Tissue List HeLa; MM6; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403711
mod ID: M6ASITE037583 Click to Show/Hide the Full List
mod site chr18:63125607-63125608:- [23]
Sequence TTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403712
mod ID: M6ASITE037584 Click to Show/Hide the Full List
mod site chr18:63126810-63126811:- [24]
Sequence GAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403713
mod ID: M6ASITE037585 Click to Show/Hide the Full List
mod site chr18:63126934-63126935:- [24]
Sequence AGTTTAGAATCAGCCTTGAAACATTGATGGAATAACTCTGT
Motif Score 2.20572619
Cell/Tissue List HEK293T; hESC-HEK293T; GM12878
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403714
mod ID: M6ASITE037586 Click to Show/Hide the Full List
mod site chr18:63126977-63126978:- [21]
Sequence GTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403715
mod ID: M6ASITE037587 Click to Show/Hide the Full List
mod site chr18:63126994-63126995:- [24]
Sequence AAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTA
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T; AML
Seq Type List MAZTER-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403716
mod ID: M6ASITE037588 Click to Show/Hide the Full List
mod site chr18:63127020-63127021:- [21]
Sequence AAAAAAATCAATGGTGGGGAACTATAAAGAAGTAACAAAAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; CD8T; MM6; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403717
mod ID: M6ASITE037589 Click to Show/Hide the Full List
mod site chr18:63127105-63127106:- [21]
Sequence TAGTTTGGTTTTATTTGAAAACCTGACAAAAAAAAAGTTCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; MM6; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403718
mod ID: M6ASITE037590 Click to Show/Hide the Full List
mod site chr18:63127142-63127143:- [21]
Sequence TCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; HepG2; hNPCs; GM12878; LCLs; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403719
mod ID: M6ASITE037591 Click to Show/Hide the Full List
mod site chr18:63127169-63127170:- [25]
Sequence GAGGTGTCATGGATTAATTGACCCCTGTCTATGGAATTACA
Motif Score 2.839113095
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403720
mod ID: M6ASITE037592 Click to Show/Hide the Full List
mod site chr18:63127351-63127352:- [21]
Sequence GGGCCCTTCCTATCAGAAGGACATGGTGAAGGCTGGGAACG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403721
mod ID: M6ASITE037593 Click to Show/Hide the Full List
mod site chr18:63127382-63127383:- [21]
Sequence TATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403722
mod ID: M6ASITE037594 Click to Show/Hide the Full List
mod site chr18:63127407-63127408:- [21]
Sequence GAGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGA
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; HepG2; H1A; H1B; hNPCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403723
mod ID: M6ASITE037595 Click to Show/Hide the Full List
mod site chr18:63127606-63127607:- [21]
Sequence CTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; hNPCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403724
mod ID: M6ASITE037596 Click to Show/Hide the Full List
mod site chr18:63127643-63127644:- [21]
Sequence AGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTG
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403725
mod ID: M6ASITE037597 Click to Show/Hide the Full List
mod site chr18:63127658-63127659:- [21]
Sequence CAAGTGCCTGCTTTTAGGAGACCGAAGTCCGCAGAACCTGC
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403726
mod ID: M6ASITE037598 Click to Show/Hide the Full List
mod site chr18:63127736-63127737:- [21]
Sequence TCTGGAACTTGAGGAAGTGAACATTTCGGTGACTTCCGCAT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; HepG2; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403727
mod ID: M6ASITE037599 Click to Show/Hide the Full List
mod site chr18:63127750-63127751:- [21]
Sequence AAGAAACAGAATCCTCTGGAACTTGAGGAAGTGAACATTTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403728
mod ID: M6ASITE037600 Click to Show/Hide the Full List
mod site chr18:63127765-63127766:- [21]
Sequence TGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTTGA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403729
mod ID: M6ASITE037601 Click to Show/Hide the Full List
mod site chr18:63127949-63127950:- [21]
Sequence TGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCC
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403730
mod ID: M6ASITE037602 Click to Show/Hide the Full List
mod site chr18:63127982-63127983:- [21]
Sequence GAGTTGGGAACTTCAGATGGACCTAGTACCCACTGAGATTT
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403731
mod ID: M6ASITE037603 Click to Show/Hide the Full List
mod site chr18:63127993-63127994:- [21]
Sequence TGGGAGGAAAAGAGTTGGGAACTTCAGATGGACCTAGTACC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403732
mod ID: M6ASITE037604 Click to Show/Hide the Full List
mod site chr18:63128048-63128049:- [21]
Sequence CTCCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACA
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403733
mod ID: M6ASITE037605 Click to Show/Hide the Full List
mod site chr18:63128103-63128104:- [24]
Sequence CCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T; AML
Seq Type List MAZTER-seq; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403734
mod ID: M6ASITE037606 Click to Show/Hide the Full List
mod site chr18:63128199-63128200:- [21]
Sequence AGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTG
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; GM12878; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403735
mod ID: M6ASITE037607 Click to Show/Hide the Full List
mod site chr18:63128214-63128215:- [25]
Sequence GATCACCATCTGAAGAGCAGACGGATGGAAAAAGGACCTGA
Motif Score 2.871321429
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000333681.5; ENST00000590515.1; ENST00000398117.1
External Link RMBase: m6A_site_403736
mod ID: M6ASITE037608 Click to Show/Hide the Full List
mod site chr18:63128264-63128265:- [21]
Sequence TGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; GM12878; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000590515.1; ENST00000333681.5
External Link RMBase: m6A_site_403737
mod ID: M6ASITE037609 Click to Show/Hide the Full List
mod site chr18:63128343-63128344:- [26]
Sequence TTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCG
Motif Score 2.627720238
Cell/Tissue List HEK293T; GM12878; LCLs; HEK293A-TOA
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000590515.1; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403738
mod ID: M6ASITE037610 Click to Show/Hide the Full List
mod site chr18:63128357-63128358:- [21]
Sequence AAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; GM12878; LCLs; HEK293A-TOA; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1; ENST00000590515.1
External Link RMBase: m6A_site_403739
mod ID: M6ASITE037611 Click to Show/Hide the Full List
mod site chr18:63128481-63128482:- [21]
Sequence TATAAACATCACACACACAGACAGACACACACACACACAAC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000590515.1; ENST00000333681.5
External Link RMBase: m6A_site_403740
mod ID: M6ASITE037612 Click to Show/Hide the Full List
mod site chr18:63128496-63128497:- [21]
Sequence AAAAAATAACACACATATAAACATCACACACACAGACAGAC
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; hNPCs; GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000590515.1; ENST00000398117.1
External Link RMBase: m6A_site_403741
mod ID: M6ASITE037613 Click to Show/Hide the Full List
mod site chr18:63128538-63128539:- [27]
Sequence TGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAA
Motif Score 2.20572619
Cell/Tissue List CD34; HEK293T; hNPCs; GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000590515.1; ENST00000398117.1
External Link RMBase: m6A_site_403742
mod ID: M6ASITE037614 Click to Show/Hide the Full List
mod site chr18:63128603-63128604:- [21]
Sequence AGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCAC
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; GM12878; LCLs; MM6; peripheral-blood; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1; ENST00000590515.1
External Link RMBase: m6A_site_403743
mod ID: M6ASITE037615 Click to Show/Hide the Full List
mod site chr18:63128689-63128690:- [21]
Sequence TCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTG
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HEK293T; HepG2; H1A; H1B; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000590515.1; ENST00000333681.5
External Link RMBase: m6A_site_403744
mod ID: M6ASITE037616 Click to Show/Hide the Full List
mod site chr18:63128744-63128745:- [21]
Sequence CTGCAGGATGCCTTTGTGGAACTGTACGGCCCCAGCATGCG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1; ENST00000590515.1
External Link RMBase: m6A_site_403745
mod ID: M6ASITE037617 Click to Show/Hide the Full List
mod site chr18:63216101-63216102:- [2]
Sequence CACCAAAAACAAACAAACAAACAAAACCACAGCCCTATTGT
Motif Score 2.20572619
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403746
mod ID: M6ASITE037618 Click to Show/Hide the Full List
mod site chr18:63281093-63281094:- [2]
Sequence TAGGTACCTCGCATAAGTGGACTCACACTTGTGACTGGCTT
Motif Score 4.065041667
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403747
mod ID: M6ASITE037619 Click to Show/Hide the Full List
mod site chr18:63313896-63313897:- [21]
Sequence TTTTAGCAATCTTTGATTGAACTGGTACATTTCAGATTACT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403748
mod ID: M6ASITE037620 Click to Show/Hide the Full List
mod site chr18:63314614-63314615:- [27]
Sequence AGTGACCCTCTAAACTGGGAACTGTGACGACATTCAGCTTC
Motif Score 3.373380952
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403749
mod ID: M6ASITE037621 Click to Show/Hide the Full List
mod site chr18:63314621-63314622:- [27]
Sequence GATGGAGAGTGACCCTCTAAACTGGGAACTGTGACGACATT
Motif Score 2.627720238
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000398117.1; ENST00000589955.2; ENST00000333681.5
External Link RMBase: m6A_site_403750
mod ID: M6ASITE037622 Click to Show/Hide the Full List
mod site chr18:63314676-63314677:- [27]
Sequence AGCTTCTTTAAGACAAAGGGACTCTTGCAGGCAAGGGATTG
Motif Score 4.065041667
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403751
mod ID: M6ASITE037623 Click to Show/Hide the Full List
mod site chr18:63317459-63317460:- [21]
Sequence TGACATTCCAAAGTCCTTGGACTGGAATCTCCAGTGTGTGC
Motif Score 4.065041667
Cell/Tissue List HeLa; GM12878; LCLs; peripheral-blood; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403752
mod ID: M6ASITE037624 Click to Show/Hide the Full List
mod site chr18:63317507-63317508:- [21]
Sequence TAAGTCTTTTTCCCTGAAAAACTTAGTTGTGTTTGTAAAGA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; GM12878; LCLs; peripheral-blood; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403753
mod ID: M6ASITE037625 Click to Show/Hide the Full List
mod site chr18:63317534-63317535:- [21]
Sequence AAATTTTCCAAAAGAGGAAAACCAATGTAAGTCTTTTTCCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; A549; HepG2; GM12878; LCLs; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000589955.2; ENST00000333681.5
External Link RMBase: m6A_site_403754
mod ID: M6ASITE037626 Click to Show/Hide the Full List
mod site chr18:63317577-63317578:- [21]
Sequence AAGAATAGACTCCACAGAAGACCAAGGGCATCATCAATCGG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; hNPCs; GM12878; LCLs; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403755
mod ID: M6ASITE037627 Click to Show/Hide the Full List
mod site chr18:63317589-63317590:- [21]
Sequence CAACCCGATTAGAAGAATAGACTCCACAGAAGACCAAGGGC
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; GM12878; LCLs; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403756
mod ID: M6ASITE037628 Click to Show/Hide the Full List
mod site chr18:63317610-63317611:- [21]
Sequence TTGTACACTAAAATTGGAGAACAACCCGATTAGAAGAATAG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; GM12878; LCLs; CD8T; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403757
mod ID: M6ASITE037629 Click to Show/Hide the Full List
mod site chr18:63317639-63317640:- [21]
Sequence CCCAAACAAGCTCCCCTGAAACAAGCCCGTTGTACACTAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403758
mod ID: M6ASITE037630 Click to Show/Hide the Full List
mod site chr18:63317654-63317655:- [21]
Sequence CTTGACAGTCTGCATCCCAAACAAGCTCCCCTGAAACAAGC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000589955.2; ENST00000333681.5
External Link RMBase: m6A_site_403759
mod ID: M6ASITE037631 Click to Show/Hide the Full List
mod site chr18:63317693-63317694:- [21]
Sequence GTTTCAGGGACTGCTTATGAACCAGATACCAGGTTGGGTCT
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403760
mod ID: M6ASITE037632 Click to Show/Hide the Full List
mod site chr18:63317704-63317705:- [21]
Sequence ACCGGAGGGAGGTTTCAGGGACTGCTTATGAACCAGATACC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; peripheral-blood; HEK293A-TOA; iSLK; TIME; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000589955.2; ENST00000333681.5
External Link RMBase: m6A_site_403761
mod ID: M6ASITE037633 Click to Show/Hide the Full List
mod site chr18:63317724-63317725:- [21]
Sequence GGCTTGAGCAGCTTGTTGGAACCGGAGGGAGGTTTCAGGGA
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; peripheral-blood; HEK293A-TOA; iSLK; TIME; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403762
mod ID: M6ASITE037634 Click to Show/Hide the Full List
mod site chr18:63317757-63317758:- [21]
Sequence AAGGTCCAGGAGTCCCCAGGACCACCGTTTCCTGGCTTGAG
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; peripheral-blood; HEK293A-TOA; iSLK; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403763
mod ID: M6ASITE037635 Click to Show/Hide the Full List
mod site chr18:63317925-63317926:- [21]
Sequence GTCCCTACCTCCTCCTCTGGACAAAGCGTTCACTCCCAACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; U2OS; H1B; H1A; hESCs; GM12878; LCLs; CD8T; MT4; peripheral-blood; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000589955.2; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403764
mod ID: M6ASITE037636 Click to Show/Hide the Full List
mod site chr18:63318121-63318122:- [21]
Sequence GTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGA
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; GM12878; LCLs; MT4; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403765
mod ID: M6ASITE037637 Click to Show/Hide the Full List
mod site chr18:63318154-63318155:- [21]
Sequence GGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000398117.1; ENST00000333681.5; ENST00000589955.2
External Link RMBase: m6A_site_403766
mod ID: M6ASITE037638 Click to Show/Hide the Full List
mod site chr18:63318238-63318239:- [21]
Sequence GCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; LCLs; CD8T; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000589955.2; ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403767
mod ID: M6ASITE037639 Click to Show/Hide the Full List
mod site chr18:63318282-63318283:- [25]
Sequence ACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGA
Motif Score 3.616982143
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403768
mod ID: M6ASITE037640 Click to Show/Hide the Full List
mod site chr18:63318446-63318447:- [21]
Sequence CCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCC
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; GM12878; LCLs; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403769
mod ID: M6ASITE037641 Click to Show/Hide the Full List
mod site chr18:63318461-63318462:- [21]
Sequence CCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCG
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; GM12878; LCLs; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403770
mod ID: M6ASITE037642 Click to Show/Hide the Full List
mod site chr18:63318475-63318476:- [21]
Sequence CCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; GM12878; LCLs; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403771
mod ID: M6ASITE037643 Click to Show/Hide the Full List
mod site chr18:63318647-63318648:- [21]
Sequence GGATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HEK293T; hESC-HEK293T; HepG2; GM12878; LCLs; MT4; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000333681.5; ENST00000589955.2; ENST00000398117.1
External Link RMBase: m6A_site_403772
mod ID: M6ASITE037644 Click to Show/Hide the Full List
mod site chr18:63318749-63318750:- [2]
Sequence AATAAAATAGCTGGATTATAACTCCTCTTCTTTCTCTGGGG
Motif Score 2.590089286
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000333681.5; ENST00000398117.1; ENST00000589955.2
External Link RMBase: m6A_site_403773
mod ID: M6ASITE037645 Click to Show/Hide the Full List
mod site chr18:63318802-63318803:- [21]
Sequence AGTGTTCCGCGTGATTGAAGACACCCCCTCGTCCAAGAATG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; GM12878; LCLs; MT4; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000589955.2; ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403774
mod ID: M6ASITE037646 Click to Show/Hide the Full List
mod site chr18:63318834-63318835:- [21]
Sequence CATCTCATGCCAAGGGGGAAACACCAGAATCAAGTGTTCCG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; GM12878; LCLs; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403775
mod ID: M6ASITE037647 Click to Show/Hide the Full List
mod site chr18:63318934-63318935:- [21]
Sequence CAGCATCACAGAGGAAGTAGACTGATATTAACAATACTTAC
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; hNPCs; GM12878; LCLs; HEK293A-TOA; iSLK; MSC; TIME; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403776
mod ID: M6ASITE037648 Click to Show/Hide the Full List
mod site chr18:63318960-63318961:- [25]
Sequence ATTAGTTTGTTTTTTCTTTAACCTTTCAGCATCACAGAGGA
Motif Score 2.147452381
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403777
mod ID: M6ASITE037649 Click to Show/Hide the Full List
mod site chr18:63319125-63319126:- [26]
Sequence TAATGTAACTTTCAATGGAAACCTTTGAGATTTTTTACTTA
Motif Score 2.185083333
Cell/Tissue List HEK293T; GM12878; LCLs; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403778
mod ID: M6ASITE037650 Click to Show/Hide the Full List
mod site chr18:63319209-63319210:- [21]
Sequence TTTGGTTTTACAAAAAGGAAACTTGACAGAGGATCATGCTG
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; GM12878; LCLs; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000333681.5; ENST00000398117.1
External Link RMBase: m6A_site_403779
mod ID: M6ASITE037651 Click to Show/Hide the Full List
mod site chr18:63319382-63319383:- [2]
Sequence GTTGGGATTCCTGCGGATTGACATTTCTGTGAAGCAGAAGT
Motif Score 2.859755952
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403780
mod ID: M6ASITE037652 Click to Show/Hide the Full List
mod site chr18:63319469-63319470:- [21]
Sequence AGGACTTCTGCGAATACCGGACTGAAAATTGTAATTCATCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; A549; GM12878; LCLs; CD8T; MT4; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403781
mod ID: M6ASITE037653 Click to Show/Hide the Full List
mod site chr18:63319486-63319487:- [21]
Sequence GAAGGGGAAAACATCACAGGACTTCTGCGAATACCGGACTG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; A549; GM12878; LCLs; CD8T; MT4; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; endometrial; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403782
mod ID: M6ASITE037654 Click to Show/Hide the Full List
mod site chr18:63319496-63319497:- [21]
Sequence AAATTGCCGAGAAGGGGAAAACATCACAGGACTTCTGCGAA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; A549; GM12878; LCLs; MT4; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1; ENST00000333681.5
External Link RMBase: m6A_site_403783
mod ID: M6ASITE037655 Click to Show/Hide the Full List
mod site chr18:63319795-63319796:- [21]
Sequence GAAAAGAGGGAAAAAATAAAACCCTCCCCCACCACCTCCTT
Motif Score 2.185083333
Cell/Tissue List HeLa; hNPCs; LCLs; MT4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1
External Link RMBase: m6A_site_403784
mod ID: M6ASITE037656 Click to Show/Hide the Full List
mod site chr18:63319840-63319841:- [21]
Sequence GAGGGGGTCCAGGGGGGAGAACTTCGTAGCAGTCATCCTTT
Motif Score 3.373380952
Cell/Tissue List HeLa; H1B; hNPCs; LCLs; MT4; MM6; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000398117.1
External Link RMBase: m6A_site_403785
mod ID: M6ASITE037657 Click to Show/Hide the Full List
mod site chr18:63319923-63319924:- [21]
Sequence AGCCAGCGCCGCCGCGCAGGACCAGGAGGAGGAGAAAGGGT
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; hNPCs; LCLs; MT4; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000398117.1
External Link RMBase: m6A_site_403786