General Information of the m6A Target Gene (ID: M6ATAR00129)
Target Name microRNA 222 (MIR222)
Synonyms
MIR222; MIRN222; hsa-mir-222
    Click to Show/Hide
Gene Name MIR222
Chromosomal Location Xp11.3
Family MicroRNAs
Gene ID 407007
HGNC ID
HGNC:31602
miRBase ID
MI0000299
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MIR222 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Target Regulation Down regulation
Responsed Disease Breast cancer ICD-11: 2C60
Responsed Drug Fulvestrant Approved
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Target Regulation Down regulation
Responsed Disease Breast cancer ICD-11: 2C60
Responsed Drug Tamoxifen Approved
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Methyltransferase-like 3 (METTL3) [WRITER]
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 has an oncogenic role in bladder cancer through interacting with the microprocessor protein DGCR8 and positively modulating the microRNA 222 (MIR222) process in an m6A-dependent manner.
Target Regulation Up regulation
Responsed Disease Bladder cancer ICD-11: 2C94
Cell Process Cell proliferation
In-vitro Model EJ (Human bladder cancer cells)
T24 Bladder carcinoma Homo sapiens CVCL_0554
In-vivo Model About 1× 107 cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4-6 weeks old, 18-22 g, five mice per group).
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary METTL3 positively modulates the pri-miR221/pri-miR-222 maturation process in an m6A-dependent manner and subsequently activates Wnt/Beta-catenin signaling by inhibiting DKK2, thus promoting Ang-II-induced cardiac hypertrophy.
Target Regulation Up regulation
Responsed Disease Cardiomegaly ICD-11: BC45
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model NRCMs (Primary neonatal rat cardiomyocytes (NRCMs)NRCMs were prepared from the hearts of 2- to 3-day-old SD rats according to the following protocol)
In-vivo Model The pump was prefilled with Ang-II or saline and then incubated in sterile saline at 37 ℃ for 48 h. After the mice were anesthetized with 3.0% isoflurane mixed with oxygen, an incision was made on the back skin of the mice, and the pump was implanted into the subcutaneous area, followed by suturing the incision. After the operation, the mice were given buprenorphine (0.1 mg/kg) to reach analgesia. Finally, the regaining consciousness mice were returned to cages and fed until the end of the experiment.
Breast cancer [ICD-11: 2C60]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Down regulation
Responsed Drug Fulvestrant Approved
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Down regulation
Responsed Drug Tamoxifen Approved
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Bladder cancer [ICD-11: 2C94]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 has an oncogenic role in bladder cancer through interacting with the microprocessor protein DGCR8 and positively modulating the microRNA 222 (MIR222) process in an m6A-dependent manner.
Responsed Disease Bladder cancer [ICD-11: 2C94]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Cell Process Cell proliferation
In-vitro Model EJ (Human bladder cancer cells)
T24 Bladder carcinoma Homo sapiens CVCL_0554
In-vivo Model About 1× 107 cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4-6 weeks old, 18-22 g, five mice per group).
Cardiomegaly [ICD-11: BC45]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary METTL3 positively modulates the pri-miR221/pri-miR-222 maturation process in an m6A-dependent manner and subsequently activates Wnt/Beta-catenin signaling by inhibiting DKK2, thus promoting Ang-II-induced cardiac hypertrophy.
Responsed Disease Cardiomegaly [ICD-11: BC45]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model NRCMs (Primary neonatal rat cardiomyocytes (NRCMs)NRCMs were prepared from the hearts of 2- to 3-day-old SD rats according to the following protocol)
In-vivo Model The pump was prefilled with Ang-II or saline and then incubated in sterile saline at 37 ℃ for 48 h. After the mice were anesthetized with 3.0% isoflurane mixed with oxygen, an incision was made on the back skin of the mice, and the pump was implanted into the subcutaneous area, followed by suturing the incision. After the operation, the mice were given buprenorphine (0.1 mg/kg) to reach analgesia. Finally, the regaining consciousness mice were returned to cages and fed until the end of the experiment.
Fulvestrant [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Down regulation
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Tamoxifen [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance.
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Down regulation
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response TGF-beta signaling pathway hsa04350
Cell Process Endocrine-resistance
In-vitro Model MCF7/LCC9 Invasive breast carcinoma Homo sapiens CVCL_DP52
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00636
Epigenetic Regulator Alpha-ketoglutarate-dependent dioxygenase alkB homolog 3 (ALKBH3)
Regulated Target Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27)
Crosstalk relationship m6A → m1A
Crosstalk ID: M6ACROT00637
Epigenetic Regulator RNA cytosine C(5)-methyltransferase NSUN2 (NSUN2)
Regulated Target Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27)
Crosstalk relationship m6A → m5C
Crosstalk ID: M6ACROT00638
Epigenetic Regulator Methyltransferase-like protein 1 (METTL1)
Regulated Target Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27)
Crosstalk relationship m6A → m7G
Non-coding RNA
m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)
In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05131
Epigenetic Regulator Prostate cancer associated transcript 6 (PCAT6)
Regulated Target Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship ncRNA → m6A
Disease Breast cancer
Drug Fulvestrant
Crosstalk ID: M6ACROT05138
Epigenetic Regulator Prostate cancer associated transcript 6 (PCAT6)
Regulated Target Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship ncRNA → m6A
Disease Breast cancer
Drug Adriamycin
Crosstalk ID: M6ACROT05385
Epigenetic Regulator MicroRNA 222 (MIR222)
Crosstalk relationship m6A → ncRNA
Disease Breast cancer
Drug Tamoxifen
Crosstalk ID: M6ACROT05391
Epigenetic Regulator MicroRNA 222 (MIR222)
Crosstalk relationship m6A → ncRNA
Disease Breast cancer
Drug Fulvestrant
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05382
Epigenetic Regulator MicroRNA 222 (MIR222)
Regulated Target Mutated in multiple advanced cancers 1 (PTEN)
Crosstalk relationship m6A → ncRNA
Disease Bladder cancer
Crosstalk ID: M6ACROT05562
Epigenetic Regulator MicroRNA 222 (MIR222)
Regulated Target Dickkopf-related protein 2 (DKK2)
Crosstalk relationship m6A → ncRNA
Disease Cardiomegaly
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00129)
microRNA 222 (MIR222)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003384 Click to Show/Hide the Full List
mod site chrX:45747114-45747115:- [4]
Sequence AGGATCACCCAGCTGCTGGAAGGTGTAGGTACCCTCAATGG
Transcript ID List ENST00000384992.3; ENST00000602461.1
External Link RMBase: RNA-editing_site_140353