m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00129)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MIR222
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Fulvestrant | Approved | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Tamoxifen | Approved | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
Methyltransferase-like 3 (METTL3) [WRITER]
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | METTL3 has an oncogenic role in bladder cancer through interacting with the microprocessor protein DGCR8 and positively modulating the microRNA 222 (MIR222) process in an m6A-dependent manner. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Cell Process | Cell proliferation | |||
| In-vitro Model | EJ (Human bladder cancer cells) | |||
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | About 1× 107 cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4-6 weeks old, 18-22 g, five mice per group). | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [3] | |||
| Response Summary | METTL3 positively modulates the pri-miR221/pri-miR-222 maturation process in an m6A-dependent manner and subsequently activates Wnt/Beta-catenin signaling by inhibiting DKK2, thus promoting Ang-II-induced cardiac hypertrophy. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Cardiomegaly | ICD-11: BC45 | ||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| In-vitro Model | NRCMs (Primary neonatal rat cardiomyocytes (NRCMs)NRCMs were prepared from the hearts of 2- to 3-day-old SD rats according to the following protocol) | |||
| In-vivo Model | The pump was prefilled with Ang-II or saline and then incubated in sterile saline at 37 ℃ for 48 h. After the mice were anesthetized with 3.0% isoflurane mixed with oxygen, an incision was made on the back skin of the mice, and the pump was implanted into the subcutaneous area, followed by suturing the incision. After the operation, the mice were given buprenorphine (0.1 mg/kg) to reach analgesia. Finally, the regaining consciousness mice were returned to cages and fed until the end of the experiment. | |||
Breast cancer [ICD-11: 2C60]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Fulvestrant | Approved | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Tamoxifen | Approved | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
Bladder cancer [ICD-11: 2C94]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | METTL3 has an oncogenic role in bladder cancer through interacting with the microprocessor protein DGCR8 and positively modulating the microRNA 222 (MIR222) process in an m6A-dependent manner. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell proliferation | |||
| In-vitro Model | EJ (Human bladder cancer cells) | |||
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | About 1× 107 cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4-6 weeks old, 18-22 g, five mice per group). | |||
Cardiomegaly [ICD-11: BC45]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [3] | |||
| Response Summary | METTL3 positively modulates the pri-miR221/pri-miR-222 maturation process in an m6A-dependent manner and subsequently activates Wnt/Beta-catenin signaling by inhibiting DKK2, thus promoting Ang-II-induced cardiac hypertrophy. | |||
| Responsed Disease | Cardiomegaly [ICD-11: BC45] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| In-vitro Model | NRCMs (Primary neonatal rat cardiomyocytes (NRCMs)NRCMs were prepared from the hearts of 2- to 3-day-old SD rats according to the following protocol) | |||
| In-vivo Model | The pump was prefilled with Ang-II or saline and then incubated in sterile saline at 37 ℃ for 48 h. After the mice were anesthetized with 3.0% isoflurane mixed with oxygen, an incision was made on the back skin of the mice, and the pump was implanted into the subcutaneous area, followed by suturing the incision. After the operation, the mice were given buprenorphine (0.1 mg/kg) to reach analgesia. Finally, the regaining consciousness mice were returned to cages and fed until the end of the experiment. | |||
Fulvestrant
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
Tamoxifen
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | HNRNPA2B1 is a reader of the N(6)-methyladenosine mark in primary-miRNAs and promotes DROSHA processing to precursor-miRNAs. HNRNPA2B1 downregulated miR-29a-3p, miR-29b-3p, and microRNA 222 (MIR222) and upregulated miR-1266-5p, miR-1268a, miR-671-3p. Transient overexpression of HNRNPA2/B1 reduced breast cancer cellMCF-7 sensitivity to 4-hydroxytamoxifen and fulvestrant, suggesting a role for HNRNPA2/B1 in endocrine-resistance. | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | TGF-beta signaling pathway | hsa04350 | ||
| Cell Process | Endocrine-resistance | |||
| In-vitro Model | MCF7/LCC9 | Invasive breast carcinoma | Homo sapiens | CVCL_DP52 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 3 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT00636 | ||
| Epigenetic Regulator | Alpha-ketoglutarate-dependent dioxygenase alkB homolog 3 (ALKBH3) | |
| Regulated Target | Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) | |
| Crosstalk relationship | m6A → m1A | |
| Crosstalk ID: M6ACROT00637 | ||
| Epigenetic Regulator | RNA cytosine C(5)-methyltransferase NSUN2 (NSUN2) | |
| Regulated Target | Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) | |
| Crosstalk relationship | m6A → m5C | |
| Crosstalk ID: M6ACROT00638 | ||
| Epigenetic Regulator | Methyltransferase-like protein 1 (METTL1) | |
| Regulated Target | Cyclin-dependent kinase inhibitor 1B (CDKN1B/p27) | |
| Crosstalk relationship | m6A → m7G | |
Non-coding RNA
m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)
| In total 4 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05131 | ||
| Epigenetic Regulator | Prostate cancer associated transcript 6 (PCAT6) | |
| Regulated Target | Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Drug | Fulvestrant | |
| Crosstalk ID: M6ACROT05138 | ||
| Epigenetic Regulator | Prostate cancer associated transcript 6 (PCAT6) | |
| Regulated Target | Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Drug | Adriamycin | |
| Crosstalk ID: M6ACROT05385 | ||
| Epigenetic Regulator | MicroRNA 222 (MIR222) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Breast cancer | |
| Drug | Tamoxifen | |
| Crosstalk ID: M6ACROT05391 | ||
| Epigenetic Regulator | MicroRNA 222 (MIR222) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Breast cancer | |
| Drug | Fulvestrant | |
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05382 | ||
| Epigenetic Regulator | MicroRNA 222 (MIR222) | |
| Regulated Target | Mutated in multiple advanced cancers 1 (PTEN) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Bladder cancer | |
| Crosstalk ID: M6ACROT05562 | ||
| Epigenetic Regulator | MicroRNA 222 (MIR222) | |
| Regulated Target | Dickkopf-related protein 2 (DKK2) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Cardiomegaly | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00129)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE003384 | Click to Show/Hide the Full List | ||
| mod site | chrX:45747114-45747115:- | [4] | |
| Sequence | AGGATCACCCAGCTGCTGGAAGGTGTAGGTACCCTCAATGG | ||
| Transcript ID List | ENST00000384992.3; ENST00000602461.1 | ||
| External Link | RMBase: RNA-editing_site_140353 | ||
References