m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00433)
Target Name Tumor necrosis factor receptor superfamily member 6 (FAS)
Gene Name FAS
Chromosomal Location 10q23.31
Function
Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. The secreted isoforms 2 to 6 block apoptosis (in vitro).
    Click to Show/Hide
Gene ID 355
Uniprot ID
TNR6_HUMAN
HGNC ID
HGNC:11920
KEGG ID
hsa:355
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
FAS can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing protein 2 (YTHDC2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary In nonalcoholic fatty liver disease, Ythdc2 could bind to mRNA of lipogenic genes, including sterol regulatory element-binding protein 1c, Tumor necrosis factor receptor superfamily member 6 (FAS), stearoyl-CoA desaturase 1, and acetyl-CoA carboxylase 1, to decrease their mRNA stability and inhibit gene expression.
Target Regulation Down regulation
Responsed Disease Non-alcoholic fatty liver disease ICD-11: DB92
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vivo Model All mice were housed at 21℃ ± 1℃ with a humidity of 55% ± 10% and a 12-hour light/dark cycle. The high-fat diets (HFDs), containing 60% kcal from fat, 20% kcal from carbohydrate, and 20% kcal from protein.
Non-alcoholic fatty liver disease [ICD-11: DB92]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary In nonalcoholic fatty liver disease, Ythdc2 could bind to mRNA of lipogenic genes, including sterol regulatory element-binding protein 1c, Tumor necrosis factor receptor superfamily member 6 (FAS), stearoyl-CoA desaturase 1, and acetyl-CoA carboxylase 1, to decrease their mRNA stability and inhibit gene expression.
Responsed Disease Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator YTH domain-containing protein 2 (YTHDC2) READER
 Regulator Info 
Target Regulation Down regulation
Pathway Response RNA degradation hsa03018
Cell Process RNA stability
In-vivo Model All mice were housed at 21℃ ± 1℃ with a humidity of 55% ± 10% and a 12-hour light/dark cycle. The high-fat diets (HFDs), containing 60% kcal from fat, 20% kcal from carbohydrate, and 20% kcal from protein.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05162
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 1410 (LINC01410)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Preeclampsia
 Disease Info 
m6A Regulator: RNA-binding motif protein 15 (RBM15)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05203
 Crosstalk Info 
Epigenetic Regulator FTO intronic transcript 1 (FTO-IT1)
Regulated Target RNA binding motif protein 15 (RBM15)
Crosstalk relationship ncRNA → m6A
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00433)
Tumor necrosis factor receptor superfamily member 6 (FAS)
N6-methyladenosine (m6A)
In total 23 m6A sequence/site(s) in this target gene
mod ID: M6ASITE001326 Click to Show/Hide the Full List
mod site chr10:88990756-88990757:+ [4]
Sequence GGGGCGGGCACTGGCACGGAACACACCCTGAGGCCAGCCCT
Motif Score 2.951386905
Cell/Tissue List HepG2; HeLa; MSC; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000355740.7; ENST00000484444.5; ENST00000352159.8; ENST00000612663.5
External Link RMBase: m6A_site_109512
mod ID: M6ASITE001327 Click to Show/Hide the Full List
mod site chr10:88990819-88990820:+ [5]
Sequence CTTCTCCCGCGGGTTGGTGGACCCGCTCAGTACGGAGTTGG
Motif Score 3.622404762
Cell/Tissue List HepG2; MSC; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000484444.5; ENST00000612663.5; ENST00000652046.1; ENST00000357339.6; ENST00000355740.7; ENST00000352159.8
External Link RMBase: m6A_site_109513
mod ID: M6ASITE001328 Click to Show/Hide the Full List
mod site chr10:88990891-88990892:+ [6]
Sequence CAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTGAGC
Motif Score 3.622404762
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000479522.5; ENST00000357339.6; ENST00000492756.5; ENST00000355740.7; ENST00000612663.5; ENST00000494410.5; ENST00000652046.1; ENST00000352159.8; ENST00000355279.2; ENST00000488877.5; ENST00000484444.5
External Link RMBase: m6A_site_109514
mod ID: M6ASITE001330 Click to Show/Hide the Full List
mod site chr10:88991056-88991057:+ [7]
Sequence TGCTGCGGGAGGCGTTGGAGACTGGCTCCCGGGGGCTGTTA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; MT4; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000492756.5; ENST00000612663.5; ENST00000460510.5; ENST00000355740.7; ENST00000477270.5; ENST00000494410.5; ENST00000488877.5; ENST00000479522.5; ENST00000357339.6; ENST00000484444.5; ENST00000352159.8; ENST00000355279.2; ENST00000652046.1
External Link RMBase: m6A_site_109516
mod ID: M6ASITE001331 Click to Show/Hide the Full List
mod site chr10:88991079-88991080:+ [7]
Sequence GGCTCCCGGGGGCTGTTAGGACCTTCCCTCAGGCCCGGGTG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; MT4; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612663.5; ENST00000488877.5; ENST00000652046.1; ENST00000477270.5; ENST00000355279.2; ENST00000492756.5; ENST00000355740.7; ENST00000494410.5; ENST00000352159.8; ENST00000479522.5; ENST00000460510.5; ENST00000357339.6; ENST00000484444.5
External Link RMBase: m6A_site_109517
mod ID: M6ASITE001332 Click to Show/Hide the Full List
mod site chr10:88991116-88991117:+ [7]
Sequence GGTGCTCAGAACGCTGGAGGACTTGCTTTTCTTGGGCCTTG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; MT4; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652046.1; ENST00000494410.5; ENST00000355279.2; ENST00000355740.7; ENST00000352159.8; ENST00000477270.5; ENST00000460510.5; ENST00000479522.5; ENST00000492756.5; ENST00000357339.6; ENST00000612663.5; ENST00000484444.5; ENST00000488877.5
External Link RMBase: m6A_site_109518
mod ID: M6ASITE001333 Click to Show/Hide the Full List
mod site chr10:88991191-88991192:+ [7]
Sequence AGCTCCGGCGCTCCTCGGAGACCACTGCGCTCCACGTTGAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; U2OS; hESCs; MT4; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477270.5; ENST00000460510.5; ENST00000357339.6; ENST00000488877.5; ENST00000494410.5; ENST00000612663.5; ENST00000355279.2; ENST00000355740.7; ENST00000484444.5; ENST00000492756.5; ENST00000352159.8; ENST00000479522.5; ENST00000652046.1
External Link RMBase: m6A_site_109519
mod ID: M6ASITE001334 Click to Show/Hide the Full List
mod site chr10:88991229-88991230:+ [7]
Sequence GAGGTGGGCGTGGGGTGCGGACAGGAATTGAAGCGGAAGTC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; MT4; GSC-11; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477270.5; ENST00000479522.5; ENST00000484444.5; ENST00000492756.5; ENST00000357339.6; ENST00000352159.8; ENST00000460510.5; ENST00000355740.7; ENST00000652046.1; ENST00000488877.5; ENST00000494410.5; ENST00000612663.5; ENST00000355279.2
External Link RMBase: m6A_site_109520
mod ID: M6ASITE001336 Click to Show/Hide the Full List
mod site chr10:88991278-88991279:+ [7]
Sequence TTTAGGGTCGCTGGAGGGGGACCCCGGTTGGAGAGAGGAGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; MT4; MSC; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477270.5; ENST00000612663.5; ENST00000484444.5; ENST00000652046.1; ENST00000494410.5; ENST00000355740.7; ENST00000355279.2; ENST00000352159.8; ENST00000357339.6; ENST00000492756.5; ENST00000460510.5; ENST00000488877.5; ENST00000479522.5
External Link RMBase: m6A_site_109522
mod ID: M6ASITE001337 Click to Show/Hide the Full List
mod site chr10:88991302-88991303:+ [7]
Sequence CGGTTGGAGAGAGGAGCGGAACTCCTGGACAAGCCCTGACA
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; MT4; MSC; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000492756.5; ENST00000460510.5; ENST00000355279.2; ENST00000494410.5; ENST00000352159.8; ENST00000357339.6; ENST00000488877.5; ENST00000477270.5; ENST00000313771.9; ENST00000479522.5; ENST00000652046.1; ENST00000484444.5; ENST00000355740.7; ENST00000612663.5
External Link RMBase: m6A_site_109523
mod ID: M6ASITE001338 Click to Show/Hide the Full List
mod site chr10:88991310-88991311:+ [7]
Sequence GAGAGGAGCGGAACTCCTGGACAAGCCCTGACAAGCCAAGC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; MT4; MSC; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000479522.5; ENST00000313771.9; ENST00000494410.5; ENST00000357339.6; ENST00000460510.5; ENST00000492756.5; ENST00000355740.7; ENST00000477270.5; ENST00000352159.8; ENST00000488877.5; ENST00000484444.5; ENST00000355279.2; ENST00000612663.5; ENST00000652046.1
External Link RMBase: m6A_site_109524
mod ID: M6ASITE001340 Click to Show/Hide the Full List
mod site chr10:88991407-88991408:+ [7]
Sequence GAGAGCCTGCAGCCTTCAGAACAGATATTGCTCATTTTCTG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000488877.5; ENST00000355740.7; ENST00000313771.9; ENST00000355279.2; ENST00000494410.5; ENST00000484444.5; ENST00000352159.8; ENST00000612663.5; ENST00000479522.5; ENST00000652046.1; ENST00000477270.5; ENST00000492756.5; ENST00000460510.5; ENST00000357339.6
External Link RMBase: m6A_site_109526
mod ID: M6ASITE001341 Click to Show/Hide the Full List
mod site chr10:89007780-89007781:+ [8]
Sequence AGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCA
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000640140.1; ENST00000494799.5; ENST00000355740.7; ENST00000640681.1; ENST00000487314.1; ENST00000477270.5; ENST00000494410.5; ENST00000652046.1; ENST00000460510.5; ENST00000371857.7; ENST00000355279.2; ENST00000488877.5; ENST00000612663.5; ENST00000492756.5; ENST00000466081.5; ENST00000484444.5; ENST00000352159.8; ENST00000479522.5; ENST00000313771.9; ENST00000357339.6
External Link RMBase: m6A_site_109527
mod ID: M6ASITE001342 Click to Show/Hide the Full List
mod site chr10:89007832-89007833:+ [8]
Sequence TGTAGATTGTGTGATGAAGGACATGGTAAGAGTCTTAAAAT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000484444.5; ENST00000313771.9; ENST00000640681.1; ENST00000494410.5; ENST00000479522.5; ENST00000355740.7; ENST00000488877.5; ENST00000640140.1; ENST00000612663.5; ENST00000371857.7; ENST00000487314.1; ENST00000355279.2; ENST00000460510.5; ENST00000652046.1; ENST00000492756.5; ENST00000466081.5; ENST00000352159.8; ENST00000477270.5; ENST00000357339.6; ENST00000494799.5
External Link RMBase: m6A_site_109528
mod ID: M6ASITE001343 Click to Show/Hide the Full List
mod site chr10:89014162-89014163:+ [8]
Sequence CCACTATTGCTGGAGTCATGACACTAAGTCAAGTTAAAGGC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000494799.5; ENST00000488877.5; ENST00000313771.9; ENST00000640140.1; ENST00000492756.5; ENST00000640250.1; ENST00000352159.8; ENST00000479522.5; ENST00000484444.5; ENST00000640681.1; ENST00000612663.5; ENST00000652046.1; ENST00000355279.2; ENST00000357339.6; ENST00000355740.7; ENST00000494410.5
External Link RMBase: m6A_site_109529
mod ID: M6ASITE001344 Click to Show/Hide the Full List
mod site chr10:89014247-89014248:+ [9]
Sequence CAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTC
Motif Score 2.897386905
Cell/Tissue List HEK293T; HeLa; fibroblasts; A549; GM12878; HEK293A-TOA
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000479522.5; ENST00000652046.1; ENST00000640681.1; ENST00000488877.5; ENST00000355740.7; ENST00000640250.1; ENST00000352159.8; ENST00000494410.5; ENST00000612663.5; ENST00000357339.6; ENST00000355279.2; ENST00000484444.5; ENST00000492756.5; ENST00000640140.1
External Link RMBase: m6A_site_109530
mod ID: M6ASITE001345 Click to Show/Hide the Full List
mod site chr10:89014257-89014258:+ [9]
Sequence AATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCG
Motif Score 2.951386905
Cell/Tissue List HEK293T; HeLa; fibroblasts; A549; GM12878; HEK293A-TOA
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000357339.6; ENST00000352159.8; ENST00000492756.5; ENST00000479522.5; ENST00000355740.7; ENST00000355279.2; ENST00000640250.1; ENST00000640681.1; ENST00000494410.5; ENST00000652046.1; ENST00000612663.5; ENST00000484444.5; ENST00000488877.5; ENST00000640140.1
External Link RMBase: m6A_site_109531
mod ID: M6ASITE001346 Click to Show/Hide the Full List
mod site chr10:89014375-89014376:+ [7]
Sequence CTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000492756.5; ENST00000652046.1; ENST00000479522.5; ENST00000640250.1; ENST00000640681.1; ENST00000357339.6; ENST00000352159.8; ENST00000494410.5; ENST00000355279.2; ENST00000355740.7; ENST00000640140.1; ENST00000484444.5; ENST00000612663.5; ENST00000488877.5
External Link RMBase: m6A_site_109532
mod ID: M6ASITE001347 Click to Show/Hide the Full List
mod site chr10:89014391-89014392:+ [7]
Sequence TCAGACTATCATCCTCAAGGACATTACTAGTGACTCAGAAA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; hESC-HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000484444.5; ENST00000357339.6; ENST00000612663.5; ENST00000640681.1; ENST00000488877.5; ENST00000640250.1; ENST00000640140.1; ENST00000355740.7; ENST00000352159.8; ENST00000355279.2; ENST00000652046.1; ENST00000494410.5; ENST00000492756.5; ENST00000479522.5
External Link RMBase: m6A_site_109533
mod ID: M6ASITE001348 Click to Show/Hide the Full List
mod site chr10:89014403-89014404:+ [10]
Sequence CCTCAAGGACATTACTAGTGACTCAGAAAATTCAAACTTCA
Motif Score 3.28175
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000640681.1; ENST00000352159.8; ENST00000355740.7; ENST00000484444.5; ENST00000612663.5; ENST00000494410.5; ENST00000640140.1; ENST00000479522.5; ENST00000357339.6; ENST00000355279.2; ENST00000652046.1; ENST00000492756.5; ENST00000640250.1; ENST00000488877.5
External Link RMBase: m6A_site_109534
mod ID: M6ASITE001349 Click to Show/Hide the Full List
mod site chr10:89014418-89014419:+ [7]
Sequence TAGTGACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hESCs; fibroblasts; A549; GM12878; LCLs; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000640140.1; ENST00000488877.5; ENST00000640250.1; ENST00000357339.6; ENST00000492756.5; ENST00000479522.5; ENST00000612663.5; ENST00000494410.5; ENST00000352159.8; ENST00000484444.5; ENST00000355740.7; ENST00000640681.1; ENST00000355279.2; ENST00000652046.1
External Link RMBase: m6A_site_109535
mod ID: M6ASITE001350 Click to Show/Hide the Full List
mod site chr10:89014458-89014459:+ [7]
Sequence AGCTTGGTCTAGAGTGAAAAACAACAAATTCAGTTCTGAGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; hESC-HEK293T; U2OS; hESCs; fibroblasts; A549; GM12878; LCLs; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000640140.1; ENST00000640250.1; ENST00000352159.8; ENST00000652046.1; ENST00000355740.7; ENST00000494410.5; ENST00000640681.1; ENST00000484444.5; ENST00000612663.5; ENST00000479522.5
External Link RMBase: m6A_site_109536
mod ID: M6ASITE001351 Click to Show/Hide the Full List
mod site chr10:89014865-89014866:+ [7]
Sequence GCTGAAATATCAGTTACTGAACAGGCAGGCCACTTTGCCTC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000640250.1; ENST00000352159.8; ENST00000355740.7; ENST00000652046.1; ENST00000640681.1; ENST00000640140.1
External Link RMBase: m6A_site_109537