m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00410)

Target Name	Sequestosome-1 (SQSTM1)
Synonyms	EBI3-associated protein of 60 kDa; EBIAP; p60; Phosphotyrosine-independent ligand for the Lck SH2 domain of 62 kDa; Ubiquitin-binding protein p62; ORCA; OSIL Click to Show/Hide
Gene Name	SQSTM1
Chromosomal Location	5q35.3
Function	Autophagy receptor required for selective macroautophagy (aggrephagy). Functions as a bridge between polyubiquitinated cargo and autophagosomes. Interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family . Along with WDFY3, involved in the formation and autophagic degradation of cytoplasmic ubiquitin-containing inclusions (p62 bodies, ALIS/aggresome-like induced structures). Along with WDFY3, required to recruit ubiquitinated proteins to PML bodies in the nucleus. May regulate the activation of NFKB1 by TNF-alpha, nerve growth factor (NGF) and interleukin-1. May play a role in titin/TTN downstream signaling in muscle cells. May regulate signaling cascades through ubiquitination. Adapter that mediates the interaction between TRAF6 and CYLD (By similarity). May be involved in cell differentiation, apoptosis, immune response and regulation of K(+) channels. Involved in endosome organization by retaining vesicles in the perinuclear cloud: following ubiquitination by RNF26, attracts specific vesicle-associated adapters, forming a molecular bridge that restrains cognate vesicles in the perinuclear region and organizes the endosomal pathway for efficient cargo transport. Promotes relocalization of 'Lys-63'-linked ubiquitinated STING1 to autophagosomes. Acts as an activator of the NFE2L2/NRF2 pathway via interaction with KEAP1: interaction inactivates the BCR(KEAP1) complex, promoting nuclear accumulation of NFE2L2/NRF2 and subsequent expression of cytoprotective genes. Click to Show/Hide
Gene ID	8878
Uniprot ID	SQSTM_HUMAN
HGNC ID	HGNC:11280
KEGG ID	hsa:8878

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SQSTM1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HUVEC cell line	Homo sapiens
Treatment: shMETTL3 HUVEC cells Control: shScramble HUVEC cells		GSE157544
Regulation		logFC: -6.28E-01 p-value: 1.94E-05
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between SQSTM1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.03E+00	GSE60213

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 6.53E-01 p-value: 1.38E-07
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	The m6A changes caused by FTO influence the stability of ULK1 transcripts, likely through a YTHDF2-dependent manner.Under both basal and rapamycin-induced autophagy conditions, depletion of FTO significantly reduced the formation of GFP-LC3B puncta. The level of Sequestosome-1 (SQSTM1)/SQSTM1 (an autophagy substrate) was higher in FTO-knockdown cells than that in control cells. FTO specifically upregulates the ULK1 protein abundance. ULK1 mRNA undergoes m6A modification in the 3'-UTR and the m6A-marked ULK1 transcripts can further be targeted for degradation by YTHDF2.
Target Regulation	Down regulation
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	FTO deletion inhibited arsenic-induced tumorigenesis. Epidermis-specific FTO deletion prevented skin tumorigenesis induced by arsenic and UVB irradiation. NEDD4L was identified as the m6A-modified gene target of FTO. Arsenic stabilizes FTO protein through inhibiting Sequestosome-1 (SQSTM1)-mediated selective autophagy. FTO-mediated dysregulation of mRNA m6A methylation as an epitranscriptomic mechanism to promote arsenic tumorigenicity. Arsenic suppresses p62 expression by downregulating the NF-kappaB pathway to upregulate FTO.
Target Regulation	Down regulation
Responsed Disease	Solid tumour/cancer		ICD-11: 2A00-2F9Z	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Transport and catabolism
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	MEF (Mouse embryonic fibroblasts)
In-vivo Model	As cells (5 million) in Matrigel or As-T (1 million) cells in PBS with or without gene manipulations were injected subcutaneously into the right flanks of female mice (6-8 weeks of age). For treatment with CS1 or CS2, As-T cells (1 million) in PBS were injected subcutaneously into the right flanks of 6-week-old female nude mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	FTO deletion inhibited arsenic-induced tumorigenesis. Epidermis-specific FTO deletion prevented skin tumorigenesis induced by arsenic and UVB irradiation. NEDD4L was identified as the m6A-modified gene target of FTO. Arsenic stabilizes FTO protein through inhibiting Sequestosome-1 (SQSTM1)-mediated selective autophagy. FTO-mediated dysregulation of mRNA m6A methylation as an epitranscriptomic mechanism to promote arsenic tumorigenicity. Arsenic suppresses p62 expression by downregulating the NF-kappaB pathway to upregulate FTO.
Target Regulation	Down regulation
Responsed Disease	Human skin lesions		ICD-11: ME60	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Transport and catabolism
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	MEF (Mouse embryonic fibroblasts)
In-vivo Model	As cells (5 million) in Matrigel or As-T (1 million) cells in PBS with or without gene manipulations were injected subcutaneously into the right flanks of female mice (6-8 weeks of age). For treatment with CS1 or CS2, As-T cells (1 million) in PBS were injected subcutaneously into the right flanks of 6-week-old female nude mice.

YTH domain-containing protein 1 (YTHDC1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDC1*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shYTHDC1 MOLM13 cells Control: shControl MOLM13 cells		GSE168565
Regulation		logFC: 1.02E+00 p-value: 3.33E-09
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	In diabetes/diabetic skin, YTHDC1 interacted and cooperated with ELAVL1/HuR (ELAV like RNA binding protein 1) in modulating the expression of Sequestosome-1 (SQSTM1).
Target Regulation	Up regulation
Responsed Disease	Diabetes		ICD-11: 5A10-5A14	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell apoptosis
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	NHEK (Normal human epithelial keratinocytes)
In-vivo Model	The WT-si-NC, WT-si-Ythdc1 and WT-si-Sqstm1 groups were intracutaneously injected with corresponding siRNAs (si-NC, si-Ythdc1, or si-Sqstm1, 2.5 nmol) on the circle.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	In diabetes/diabetic skin, YTHDC1 interacted and cooperated with ELAVL1/HuR (ELAV like RNA binding protein 1) in modulating the expression of Sequestosome-1 (SQSTM1).
Target Regulation	Up regulation
Responsed Disease	Diabetic skin lesions		ICD-11: EB90.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell apoptosis
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	NHEK (Normal human epithelial keratinocytes)
In-vivo Model	The WT-si-NC, WT-si-Ythdc1 and WT-si-Sqstm1 groups were intracutaneously injected with corresponding siRNAs (si-NC, si-Ythdc1, or si-Sqstm1, 2.5 nmol) on the circle.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	FTO deletion inhibited arsenic-induced tumorigenesis. Epidermis-specific FTO deletion prevented skin tumorigenesis induced by arsenic and UVB irradiation. NEDD4L was identified as the m6A-modified gene target of FTO. Arsenic stabilizes FTO protein through inhibiting Sequestosome-1 (SQSTM1)-mediated selective autophagy. FTO-mediated dysregulation of mRNA m6A methylation as an epitranscriptomic mechanism to promote arsenic tumorigenicity. Arsenic suppresses p62 expression by downregulating the NF-kappaB pathway to upregulate FTO.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Transport and catabolism
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	MEF (Mouse embryonic fibroblasts)
In-vivo Model	As cells (5 million) in Matrigel or As-T (1 million) cells in PBS with or without gene manipulations were injected subcutaneously into the right flanks of female mice (6-8 weeks of age). For treatment with CS1 or CS2, As-T cells (1 million) in PBS were injected subcutaneously into the right flanks of 6-week-old female nude mice.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Diabetes [ICD-11: 5A10-5A14]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	In diabetes/diabetic skin, YTHDC1 interacted and cooperated with ELAVL1/HuR (ELAV like RNA binding protein 1) in modulating the expression of Sequestosome-1 (SQSTM1).
Responsed Disease	Diabetes [ICD-11: 5A10-5A14]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell apoptosis
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	NHEK (Normal human epithelial keratinocytes)
In-vivo Model	The WT-si-NC, WT-si-Ythdc1 and WT-si-Sqstm1 groups were intracutaneously injected with corresponding siRNAs (si-NC, si-Ythdc1, or si-Sqstm1, 2.5 nmol) on the circle.

Diabetic skin lesions [ICD-11: EB90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	In diabetes/diabetic skin, YTHDC1 interacted and cooperated with ELAVL1/HuR (ELAV like RNA binding protein 1) in modulating the expression of Sequestosome-1 (SQSTM1).
Responsed Disease	Diabetic skin lesions [ICD-11: EB90.0]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell apoptosis
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	NHEK (Normal human epithelial keratinocytes)
In-vivo Model	The WT-si-NC, WT-si-Ythdc1 and WT-si-Sqstm1 groups were intracutaneously injected with corresponding siRNAs (si-NC, si-Ythdc1, or si-Sqstm1, 2.5 nmol) on the circle.

Human skin lesions [ICD-11: ME60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	FTO deletion inhibited arsenic-induced tumorigenesis. Epidermis-specific FTO deletion prevented skin tumorigenesis induced by arsenic and UVB irradiation. NEDD4L was identified as the m6A-modified gene target of FTO. Arsenic stabilizes FTO protein through inhibiting Sequestosome-1 (SQSTM1)-mediated selective autophagy. FTO-mediated dysregulation of mRNA m6A methylation as an epitranscriptomic mechanism to promote arsenic tumorigenicity. Arsenic suppresses p62 expression by downregulating the NF-kappaB pathway to upregulate FTO.
Responsed Disease	Human skin lesions [ICD-11: ME60]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Transport and catabolism
	Cell autophagy
In-vitro Model	HaCaT	Normal	Homo sapiens	CVCL_0038
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	MEF (Mouse embryonic fibroblasts)
In-vivo Model	As cells (5 million) in Matrigel or As-T (1 million) cells in PBS with or without gene manipulations were injected subcutaneously into the right flanks of female mice (6-8 weeks of age). For treatment with CS1 or CS2, As-T cells (1 million) in PBS were injected subcutaneously into the right flanks of 6-week-old female nude mice.

Chloroquine [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Gefitinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Rapamycin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	The m6A changes caused by FTO influence the stability of ULK1 transcripts, likely through a YTHDF2-dependent manner.Under both basal and rapamycin-induced autophagy conditions, depletion of FTO significantly reduced the formation of GFP-LC3B puncta. The level of Sequestosome-1 (SQSTM1)/SQSTM1 (an autophagy substrate) was higher in FTO-knockdown cells than that in control cells. FTO specifically upregulates the ULK1 protein abundance. ULK1 mRNA undergoes m6A modification in the 3'-UTR and the m6A-marked ULK1 transcripts can further be targeted for degradation by YTHDF2.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030

Beta-Elemen [Phase 3]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and Sequestosome-1 (SQSTM1). beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02226		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Paclitaxel	Drug Info
Crosstalk ID: M6ACROT02250		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Paclitaxel	Drug Info
Crosstalk ID: M6ACROT02274		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Paclitaxel	Drug Info
Crosstalk ID: M6ACROT05977		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	STM2457	Drug Info
Crosstalk ID: M6ACROT05979		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	STM2457	Drug Info
Crosstalk ID: M6ACROT05981		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	STM2457	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00410)

Sequestosome-1 (SQSTM1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000098		Click to Show/Hide the Full List
mod site	chr5:179833104-179833105:+		[9]
Sequence	CCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAG
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000466342.1; ENST00000360718.5; ENST00000510187.5; ENST00000389805.9
External Link	RMBase: ac4C_site_1536

Adenosine-to-Inosine editing (A-to-I)

In total 8 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001325		Click to Show/Hide the Full List
mod site	chr5:179808629-179808630:+		[10]
Sequence	GATCGAGACCATCCTGGCTAACACGGTGAAACCCCGTCTCT
Transcript ID List	rmsk_1845595; ENST00000506690.1; ENST00000506042.5; ENST00000514093.5
External Link	RMBase: RNA-editing_site_114142
mod ID: A2ISITE001326		Click to Show/Hide the Full List
mod site	chr5:179811146-179811147:+		[10]
Sequence	GGAGGCTGAGGCAGGAGAATAGCTTCAACCTGTGAGGCGGA
Transcript ID List	ENST00000506042.5; ENST00000514093.5; rmsk_1845604; ENST00000506690.1
External Link	RMBase: RNA-editing_site_114143
mod ID: A2ISITE001327		Click to Show/Hide the Full List
mod site	chr5:179818924-179818925:+		[10]
Sequence	GACTGCATCGGGAAAGGGGAAGGAGTCAGAGGCGAGAAGGG
Transcript ID List	ENST00000422245.5; ENST00000514093.5
External Link	RMBase: RNA-editing_site_114144
mod ID: A2ISITE001328		Click to Show/Hide the Full List
mod site	chr5:179829944-179829945:+		[11]
Sequence	ATCCCCCACTTCCCGTGTCTACAAACACTATGAAAATTAGC
Transcript ID List	ENST00000466342.1; rmsk_1845634; ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: RNA-editing_site_114145
mod ID: A2ISITE001329		Click to Show/Hide the Full List
mod site	chr5:179829986-179829987:+		[11]
Sequence	AGGCATGGAGTTGTGTACTTATGGCCCCAGCTACGTGGGAG
Transcript ID List	ENST00000360718.5; rmsk_1845634; ENST00000389805.9; ENST00000466342.1; ENST00000510187.5
External Link	RMBase: RNA-editing_site_114146
mod ID: A2ISITE001330		Click to Show/Hide the Full List
mod site	chr5:179830644-179830645:+		[11]
Sequence	CTCAGCTCACTGCAGTTTCCACCTCCTGGGTTCAAGCAATT
Transcript ID List	ENST00000389805.9; ENST00000466342.1; ENST00000510187.5; ENST00000360718.5
External Link	RMBase: RNA-editing_site_114147
mod ID: A2ISITE001331		Click to Show/Hide the Full List
mod site	chr5:179830658-179830659:+		[11]
Sequence	GTTTCCACCTCCTGGGTTCAAGCAATTTTCTGCCTCAGCCT
Transcript ID List	ENST00000389805.9; ENST00000510187.5; ENST00000466342.1; ENST00000360718.5
External Link	RMBase: RNA-editing_site_114148
mod ID: A2ISITE001332		Click to Show/Hide the Full List
mod site	chr5:179830817-179830818:+		[10]
Sequence	TACCTGCCTTCGTCTCCCAAAGTGCTGGGATTACAGGCATG
Transcript ID List	ENST00000466342.1; ENST00000360718.5; ENST00000510187.5; ENST00000389805.9
External Link	RMBase: RNA-editing_site_114149

N1-methyladenosine (m1A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000097		Click to Show/Hide the Full List
mod site	chr5:179820904-179820905:+		[12]
Sequence	GCGCGGCGGCTGCGACCGGGACGGCCCGTTTTCCGCCAGCT
Cell/Tissue List	HEK293T
Seq Type List	m1A-MAP-seq
Transcript ID List	ENST00000626660.1; ENST00000453046.5; ENST00000422245.5; ENST00000514093.5; ENST00000508284.5; ENST00000504627.1; ENST00000464493.5; ENST00000481335.5; ENST00000389805.9
External Link	RMBase: m1A_site_753

5-methylcytidine (m5C)

In total 19 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003701		Click to Show/Hide the Full List
mod site	chr5:179808617-179808618:+
Sequence	ACGAGGTCAGGAGATCGAGACCATCCTGGCTAACACGGTGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_1845595; ENST00000506690.1; ENST00000506042.5; ENST00000514093.5
External Link	RMBase: m5C_site_36586
mod ID: M5CSITE003702		Click to Show/Hide the Full List
mod site	chr5:179808618-179808619:+
Sequence	CGAGGTCAGGAGATCGAGACCATCCTGGCTAACACGGTGAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000506042.5; ENST00000514093.5; rmsk_1845595; ENST00000506690.1
External Link	RMBase: m5C_site_36587
mod ID: M5CSITE003703		Click to Show/Hide the Full List
mod site	chr5:179808621-179808622:+
Sequence	GGTCAGGAGATCGAGACCATCCTGGCTAACACGGTGAAACC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_1845595; ENST00000514093.5; ENST00000506042.5; ENST00000506690.1
External Link	RMBase: m5C_site_36588
mod ID: M5CSITE003704		Click to Show/Hide the Full List
mod site	chr5:179808622-179808623:+
Sequence	GTCAGGAGATCGAGACCATCCTGGCTAACACGGTGAAACCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_1845595; ENST00000506042.5; ENST00000506690.1; ENST00000514093.5
External Link	RMBase: m5C_site_36589
mod ID: M5CSITE003705		Click to Show/Hide the Full List
mod site	chr5:179808626-179808627:+
Sequence	GGAGATCGAGACCATCCTGGCTAACACGGTGAAACCCCGTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000514093.5; ENST00000506042.5; ENST00000506690.1; rmsk_1845595
External Link	RMBase: m5C_site_36590
mod ID: M5CSITE003706		Click to Show/Hide the Full List
mod site	chr5:179808640-179808641:+
Sequence	TCCTGGCTAACACGGTGAAACCCCGTCTCTACTAAAAAATA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000506042.5; rmsk_1845595; ENST00000506690.1; ENST00000514093.5
External Link	RMBase: m5C_site_36591
mod ID: M5CSITE003707		Click to Show/Hide the Full List
mod site	chr5:179808641-179808642:+
Sequence	CCTGGCTAACACGGTGAAACCCCGTCTCTACTAAAAAATAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_1845595; ENST00000506042.5; ENST00000506690.1; ENST00000514093.5
External Link	RMBase: m5C_site_36592
mod ID: M5CSITE003708		Click to Show/Hide the Full List
mod site	chr5:179808642-179808643:+
Sequence	CTGGCTAACACGGTGAAACCCCGTCTCTACTAAAAAATACA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000514093.5; ENST00000506690.1; ENST00000506042.5; rmsk_1845595
External Link	RMBase: m5C_site_36593
mod ID: M5CSITE003709		Click to Show/Hide the Full List
mod site	chr5:179808643-179808644:+
Sequence	TGGCTAACACGGTGAAACCCCGTCTCTACTAAAAAATACAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000506690.1; ENST00000506042.5; ENST00000514093.5; rmsk_1845595
External Link	RMBase: m5C_site_36594
mod ID: M5CSITE003710		Click to Show/Hide the Full List
mod site	chr5:179811579-179811580:+
Sequence	CTCACTCTTCAAAGTGTCTGCGAGATTAATCTCTCATGGCC
Cell/Tissue List	HeLa
Seq Type List	m5C-RIP-seq
Transcript ID List	ENST00000514093.5; ENST00000506690.1; ENST00000506042.5; rmsk_1845606
External Link	RMBase: m5C_site_36595
mod ID: M5CSITE003711		Click to Show/Hide the Full List
mod site	chr5:179820905-179820906:+		[13]
Sequence	CGCGGCGGCTGCGACCGGGACGGCCCGTTTTCCGCCAGCTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000626660.1; ENST00000464493.5; ENST00000504627.1; ENST00000514093.5; ENST00000389805.9; ENST00000481335.5; ENST00000453046.5; ENST00000422245.5; ENST00000508284.5
External Link	RMBase: m5C_site_36596
mod ID: M5CSITE003712		Click to Show/Hide the Full List
mod site	chr5:179820909-179820910:+		[13]
Sequence	GCGGCTGCGACCGGGACGGCCCGTTTTCCGCCAGCTCGCCG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000504627.1; ENST00000626660.1; ENST00000481335.5; ENST00000389805.9; ENST00000514093.5; ENST00000453046.5; ENST00000508284.5; ENST00000464493.5; ENST00000422245.5
External Link	RMBase: m5C_site_36597
mod ID: M5CSITE003713		Click to Show/Hide the Full List
mod site	chr5:179820910-179820911:+		[13]
Sequence	CGGCTGCGACCGGGACGGCCCGTTTTCCGCCAGCTCGCCGC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000508284.5; ENST00000626660.1; ENST00000481335.5; ENST00000514093.5; ENST00000464493.5; ENST00000422245.5; ENST00000453046.5; ENST00000504627.1; ENST00000389805.9
External Link	RMBase: m5C_site_36598
mod ID: M5CSITE003714		Click to Show/Hide the Full List
mod site	chr5:179824092-179824093:+		[13]
Sequence	GGGCACCTGTCTGAGGTGAGCAGGCCCTCTGTGCAGGCCTG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000466342.1; ENST00000514093.5; ENST00000485412.1; ENST00000510187.5; ENST00000422245.5; ENST00000389805.9; ENST00000464493.5; ENST00000508284.5; ENST00000360718.5
External Link	RMBase: m5C_site_36599
mod ID: M5CSITE003715		Click to Show/Hide the Full List
mod site	chr5:179831401-179831402:+
Sequence	CTGGGTGCAGTGGCTCATGCCTGTAATCCAAGCACTTTGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000510187.5; ENST00000466342.1; ENST00000389805.9; rmsk_1845641; ENST00000360718.5
External Link	RMBase: m5C_site_36600
mod ID: M5CSITE003716		Click to Show/Hide the Full List
mod site	chr5:179831415-179831416:+
Sequence	TCATGCCTGTAATCCAAGCACTTTGGGAGGCCAAGGCAGGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_1845641; ENST00000510187.5; ENST00000466342.1; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m5C_site_36601
mod ID: M5CSITE003717		Click to Show/Hide the Full List
mod site	chr5:179833492-179833493:+		[13]
Sequence	CTTAACTGCACGTGTGCATGCGTGCTCCCCGACTGTCTGCC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: m5C_site_36602
mod ID: M5CSITE003718		Click to Show/Hide the Full List
mod site	chr5:179836691-179836692:+		[13]
Sequence	GTACGGGCCAGTTTCTCTGCCTTCTTCCAGGATCAGGGGTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000510187.5; ENST00000389805.9; ENST00000360718.5
External Link	RMBase: m5C_site_36604
mod ID: M5CSITE003719		Click to Show/Hide the Full List
mod site	chr5:179836868-179836869:+		[13]
Sequence	AGCGCGCTCCTGACCCCTCCCTGCAGGGGCTACGTTAGCAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000389805.9; ENST00000510187.5; ENST00000360718.5
External Link	RMBase: m5C_site_36605

N6-methyladenosine (m6A)

In total 34 m6A sequence/site(s) in this target gene
mod ID: M6ASITE072983		Click to Show/Hide the Full List
mod site	chr5:179806516-179806517:+		[14]
Sequence	GCTGAGTGCCGCGTACCAGGACAGCGAGAGGAAGGCGCACA
Motif Score	3.643047619
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000514093.5; ENST00000506042.5
External Link	RMBase: m6A_site_701557
mod ID: M6ASITE072984		Click to Show/Hide the Full List
mod site	chr5:179812842-179812843:+		[15]
Sequence	TTCCAAGGTTGAGGGTTGGAACTCCACAGCCTCAGCCTCCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000514093.5; ENST00000512234.1; ENST00000506042.5; ENST00000506690.1
External Link	RMBase: m6A_site_701559
mod ID: M6ASITE072985		Click to Show/Hide the Full List
mod site	chr5:179820904-179820905:+		[16]
Sequence	GCGCGGCGGCTGCGACCGGGACGGCCCGTTTTCCGCCAGCT
Motif Score	3.616982143
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000508284.5; ENST00000514093.5; ENST00000453046.5; ENST00000626660.1; ENST00000389805.9; ENST00000422245.5; ENST00000481335.5; ENST00000504627.1; ENST00000464493.5
External Link	RMBase: m6A_site_701560
mod ID: M6ASITE072986		Click to Show/Hide the Full List
mod site	chr5:179821061-179821062:+		[15]
Sequence	GAGGCTGCGGCGGGTCCGGGACCCTGCGAGCGGCTGCTGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000508284.5; ENST00000453046.5; ENST00000481335.5; ENST00000510187.5; ENST00000504627.1; ENST00000422245.5; ENST00000626660.1; ENST00000514093.5; ENST00000464493.5; ENST00000389805.9
External Link	RMBase: m6A_site_701561
mod ID: M6ASITE072987		Click to Show/Hide the Full List
mod site	chr5:179821641-179821642:+		[15]
Sequence	CAAGCGCGGGGGTGCGGGGGACTCGCGAGCGCCGCGACAGC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000508284.5; ENST00000481335.5; ENST00000514093.5; ENST00000464493.5; ENST00000453046.5; ENST00000422245.5; ENST00000510187.5; ENST00000504627.1; ENST00000389805.9
External Link	RMBase: m6A_site_701562
mod ID: M6ASITE072988		Click to Show/Hide the Full List
mod site	chr5:179823044-179823045:+		[17]
Sequence	GGATGACATCTTCCGAATCTACATTAAAGGTAAGGGGCTGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000481335.5; ENST00000504627.1; ENST00000453046.5; ENST00000389805.9; ENST00000510187.5; ENST00000508284.5; ENST00000514093.5; ENST00000360718.5; ENST00000464493.5; ENST00000422245.5
External Link	RMBase: m6A_site_701563
mod ID: M6ASITE072989		Click to Show/Hide the Full List
mod site	chr5:179823914-179823915:+		[17]
Sequence	TGCTCAGGAGGCGCCCCGCAACATGGTGCACCCCAATGTGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000514093.5; ENST00000481335.5; ENST00000464493.5; ENST00000485412.1; ENST00000508284.5; ENST00000360718.5; ENST00000504627.1; ENST00000453046.5; ENST00000466342.1; ENST00000389805.9; ENST00000422245.5; ENST00000510187.5
External Link	RMBase: m6A_site_701564
mod ID: M6ASITE072990		Click to Show/Hide the Full List
mod site	chr5:179823974-179823975:+		[14]
Sequence	GCCTGTGGTAGGAACCCGCTACAAGTGCAGCGTCTGCCCAG
Motif Score	2.078666667
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000485412.1; ENST00000464493.5; ENST00000466342.1; ENST00000389805.9; ENST00000504627.1; ENST00000510187.5; ENST00000508284.5; ENST00000514093.5; ENST00000422245.5; ENST00000360718.5
External Link	RMBase: m6A_site_701565
mod ID: M6ASITE072991		Click to Show/Hide the Full List
mod site	chr5:179824043-179824044:+		[14]
Sequence	AAAGGGCTTGCACCGGGGGCACACCAAGCTCGCATTCCCCA
Motif Score	2.830589286
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000389805.9; ENST00000466342.1; ENST00000464493.5; ENST00000514093.5; ENST00000485412.1; ENST00000504627.1; ENST00000510187.5; ENST00000360718.5; ENST00000422245.5; ENST00000508284.5
External Link	RMBase: m6A_site_701566
mod ID: M6ASITE072992		Click to Show/Hide the Full List
mod site	chr5:179824222-179824223:+		[17]
Sequence	CTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000360718.5; ENST00000514093.5; ENST00000508284.5; ENST00000422245.5; ENST00000464493.5; ENST00000389805.9; ENST00000510187.5; ENST00000485412.1; ENST00000466342.1
External Link	RMBase: m6A_site_701567
mod ID: M6ASITE072993		Click to Show/Hide the Full List
mod site	chr5:179833108-179833109:+		[14]
Sequence	TCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCA
Motif Score	2.830589286
Cell/Tissue List	HEK293; kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000360718.5; ENST00000510187.5; ENST00000389805.9; ENST00000466342.1
External Link	RMBase: m6A_site_701568
mod ID: M6ASITE072994		Click to Show/Hide the Full List
mod site	chr5:179833275-179833276:+		[18]
Sequence	TGCCCCTCCCGCCACCTGGGACCACGGCCAGCCTAGTGATC
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000466342.1; ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701569
mod ID: M6ASITE072995		Click to Show/Hide the Full List
mod site	chr5:179833348-179833349:+		[19]
Sequence	CTCTGCAGCCCCACTTACAAACCCGAGGGAGCTGCTGCTGC
Motif Score	2.185083333
Cell/Tissue List	H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000510187.5; ENST00000466342.1; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701570
mod ID: M6ASITE072996		Click to Show/Hide the Full List
mod site	chr5:179833415-179833416:+		[16]
Sequence	CACGCTGGGAACCTGCTAGAACTTTGTAGTTACTTGGTCTT
Motif Score	3.373380952
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: m6A_site_701571
mod ID: M6ASITE072997		Click to Show/Hide the Full List
mod site	chr5:179833664-179833665:+		[14]
Sequence	CAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTA
Motif Score	2.078666667
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000389805.9; ENST00000510187.5; ENST00000360718.5
External Link	RMBase: m6A_site_701572
mod ID: M6ASITE072998		Click to Show/Hide the Full List
mod site	chr5:179833672-179833673:+		[18]
Sequence	GTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCC
Motif Score	3.373380952
Cell/Tissue List	HepG2; HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: m6A_site_701573
mod ID: M6ASITE072999		Click to Show/Hide the Full List
mod site	chr5:179833684-179833685:+		[14]
Sequence	ACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGG
Motif Score	2.078666667
Cell/Tissue List	brain; kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701574
mod ID: M6ASITE073000		Click to Show/Hide the Full List
mod site	chr5:179833719-179833720:+		[15]
Sequence	CGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000510187.5; ENST00000389805.9; ENST00000360718.5
External Link	RMBase: m6A_site_701575
mod ID: M6ASITE073001		Click to Show/Hide the Full List
mod site	chr5:179833735-179833736:+		[15]
Sequence	CTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000510187.5
External Link	RMBase: m6A_site_701576
mod ID: M6ASITE073002		Click to Show/Hide the Full List
mod site	chr5:179833768-179833769:+		[17]
Sequence	AAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGGCAAGTG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000510187.5
External Link	RMBase: m6A_site_701577
mod ID: M6ASITE073003		Click to Show/Hide the Full List
mod site	chr5:179836524-179836525:+		[15]
Sequence	GGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: m6A_site_701583
mod ID: M6ASITE073004		Click to Show/Hide the Full List
mod site	chr5:179836531-179836532:+		[15]
Sequence	CAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000360718.5; ENST00000389805.9; ENST00000510187.5
External Link	RMBase: m6A_site_701584
mod ID: M6ASITE073005		Click to Show/Hide the Full List
mod site	chr5:179836537-179836538:+		[14]
Sequence	CCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGACA
Motif Score	2.859755952
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701585
mod ID: M6ASITE073006		Click to Show/Hide the Full List
mod site	chr5:179836555-179836556:+		[15]
Sequence	TGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000510187.5
External Link	RMBase: m6A_site_701586
mod ID: M6ASITE073007		Click to Show/Hide the Full List
mod site	chr5:179836742-179836743:+		[15]
Sequence	AAGCCATTTAGGGCAGCAAAACAAGTGACATGAAGGGAGGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701590
mod ID: M6ASITE073008		Click to Show/Hide the Full List
mod site	chr5:179836749-179836750:+		[17]
Sequence	TTAGGGCAGCAAAACAAGTGACATGAAGGGAGGGTCCCTGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000510187.5
External Link	RMBase: m6A_site_701591
mod ID: M6ASITE073009		Click to Show/Hide the Full List
mod site	chr5:179836832-179836833:+		[15]
Sequence	AGCAGGGCTGGGCCTGCGAGACCCAAGGCTCACTGCAGCGC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000389805.9; ENST00000510187.5; ENST00000360718.5
External Link	RMBase: m6A_site_701594
mod ID: M6ASITE073010		Click to Show/Hide the Full List
mod site	chr5:179836895-179836896:+		[17]
Sequence	GGCTACGTTAGCAGCCCAGCACATAGCTTGCCTAATGGCTT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000510187.5; ENST00000389805.9; ENST00000360718.5
External Link	RMBase: m6A_site_701595
mod ID: M6ASITE073011		Click to Show/Hide the Full List
mod site	chr5:179836940-179836941:+		[20]
Sequence	TTTCTCTTTTGTTTTAAATGACTCATAGGTCCCTGACATTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701596
mod ID: M6ASITE073012		Click to Show/Hide the Full List
mod site	chr5:179836955-179836956:+		[20]
Sequence	AAATGACTCATAGGTCCCTGACATTTAGTTGATTATTTTCT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000360718.5; ENST00000510187.5; ENST00000389805.9
External Link	RMBase: m6A_site_701597
mod ID: M6ASITE073013		Click to Show/Hide the Full List
mod site	chr5:179836990-179836991:+		[17]
Sequence	TTTTCTGCTACAGACCTGGTACACTCTGATTTTAGATAAAG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000510187.5
External Link	RMBase: m6A_site_701598
mod ID: M6ASITE073014		Click to Show/Hide the Full List
mod site	chr5:179837219-179837220:+		[17]
Sequence	CCATCCTGTTAAATTTGTAAACAATCTAATTAAATGGCATC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000360718.5; ENST00000389805.9
External Link	RMBase: m6A_site_701599
mod ID: M6ASITE073015		Click to Show/Hide the Full List
mod site	chr5:179837697-179837698:+		[14]
Sequence	ACCTTGGCTGCTCACTGTCCACATGTGAACTTTTTCTAGGT
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000389805.9
External Link	RMBase: m6A_site_701607
mod ID: M6ASITE073016		Click to Show/Hide the Full List
mod site	chr5:179837922-179837923:+		[17]
Sequence	CATGCCCTCCATGTGTAAGAACAATGCCAGGGCCCAGGAGG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000389805.9
External Link	RMBase: m6A_site_701612

2'-O-Methylation (2'-O-Me)

In total 4 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000388		Click to Show/Hide the Full List
mod site	chr5:179825170-179825171:+		[21]
Sequence	GGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000510187.5; ENST00000466342.1; ENST00000514093.5; ENST00000389805.9; ENST00000360718.5
External Link	RMBase: Nm_site_5630
mod ID: 2OMSITE000389		Click to Show/Hide the Full List
mod site	chr5:179825172-179825173:+		[21]
Sequence	TCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000389805.9; ENST00000360718.5; ENST00000514093.5; ENST00000466342.1; ENST00000510187.5
External Link	RMBase: Nm_site_5631
mod ID: 2OMSITE000390		Click to Show/Hide the Full List
mod site	chr5:179833609-179833610:+		[21]
Sequence	CAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000360718.5; ENST00000510187.5; ENST00000389805.9
External Link	RMBase: Nm_site_5632
mod ID: 2OMSITE000391		Click to Show/Hide the Full List
mod site	chr5:179833724-179833725:+		[21]
Sequence	GGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000510187.5; ENST00000360718.5; ENST00000389805.9
External Link	RMBase: Nm_site_5633

Ref 1	The mechanism of m(6)A methyltransferase METTL3-mediated autophagy in reversing gefitinib resistance in NSCLC cells by Beta-elemene. Cell Death Dis. 2020 Nov 11;11(11):969. doi: 10.1038/s41419-020-03148-8.
Ref 2	m(6)A RNA modification controls autophagy through upregulating ULK1 protein abundance. Cell Res. 2018 Sep;28(9):955-957. doi: 10.1038/s41422-018-0069-8. Epub 2018 Jul 25.
Ref 3	Autophagy of the m(6)A mRNA demethylase FTO is impaired by low-level arsenic exposure to promote tumorigenesis. Nat Commun. 2021 Apr 12;12(1):2183. doi: 10.1038/s41467-021-22469-6.
Ref 4	m(6)A reader YTHDC1 modulates autophagy by targeting SQSTM1 in diabetic skin. Autophagy. 2022 Jun;18(6):1318-1337. doi: 10.1080/15548627.2021.1974175. Epub 2021 Oct 17.
Ref 5	Efflux transporters at the blood-brain barrier limit delivery and efficacy of cyclin-dependent kinase 4/6 inhibitor palbociclib (PD-0332991) in an orthotopic brain tumor model. J Pharmacol Exp Ther. 2015 Nov;355(2):264-71. doi: 10.1124/jpet.115.228213. Epub 2015 Sep 9.
Ref 6	Heparanase affects secretory granule homeostasis of murine mast cells through degrading heparin. J Allergy Clin Immunol. 2011 Dec;128(6):1310-1317.e8. doi: 10.1016/j.jaci.2011.04.011. Epub 2011 May 14.
Ref 7	Interactions between riluzole and ABCG2/BCRP transporter. Neurosci Lett. 2009 Mar 6;452(1):12-6. doi: 10.1016/j.neulet.2008.12.061. Epub 2009 Jan 6.
Ref 8	Population pharmacokinetics of romidepsin in patients with cutaneous T-cell lymphoma and relapsed peripheral T-cell lymphoma. Clin Cancer Res. 2009 Feb 15;15(4):1496-503. doi: 10.1158/1078-0432.CCR-08-1215.
Ref 9	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 10	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 11	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 12	Base-Resolution Mapping Reveals Distinct m(1)A Methylome in Nuclear- and Mitochondrial-Encoded Transcripts. Mol Cell. 2017 Dec 7;68(5):993-1005.e9. doi: 10.1016/j.molcel.2017.10.019. Epub 2017 Nov 5.
Ref 13	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 14	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 15	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 16	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 17	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 18	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 19	The m(6)A Methyltransferase METTL3 Promotes Translation in Human Cancer Cells. Mol Cell. 2016 May 5;62(3):335-345. doi: 10.1016/j.molcel.2016.03.021. Epub 2016 Apr 21.
Ref 20	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 21	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map