m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00356)
Target Name Cellular tumor antigen p53 (TP53/p53)
Synonyms
Antigen NY-CO-13; Phosphoprotein p53; Tumor suppressor p53; P53
    Click to Show/Hide
Gene Name TP53
Chromosomal Location 17p13.1
Family p53 family
Function
Acts as a tumor suppressor in many tumor types; induces growth arrest or apoptosis depending on the physiological circumstances and cell type. Involved in cell cycle regulation as a trans-activator that acts to negatively regulate cell division by controlling a set of genes required for this process. One of the activated genes is an inhibitor of cyclin-dependent kinases. Apoptosis induction seems to be mediated either by stimulation of BAX and FAS antigen expression, or by repression of Bcl-2 expression. Its pro-apoptotic activity is activated via its interaction with PPP1R13B/ASPP1 or TP53BP2/ASPP2. However, this activity is inhibited when the interaction with PPP1R13B/ASPP1 or TP53BP2/ASPP2 is displaced by PPP1R13L/iASPP. In cooperation with mitochondrial PPIF is involved in activating oxidative stress-induced necrosis; the function is largely independent of transcription. Induces the transcription of long intergenic non-coding RNA p21 (lincRNA-p21) and lincRNA-Mkln1. LincRNA-p21 participates in TP53-dependent transcriptional repression leading to apoptosis and seems to have an effect on cell-cycle regulation. Implicated in Notch signaling cross-over. Prevents CDK7 kinase activity when associated to CAK complex in response to DNA damage, thus stopping cell cycle progression. Isoform 2 enhances the transactivation activity of isoform 1 from some but not all TP53-inducible promoters. Isoform 4 suppresses transactivation activity and impairs growth suppression mediated by isoform 1. Isoform 7 inhibits isoform 1-mediated apoptosis. Regulates the circadian clock by repressing CLOCK-ARNTL/BMAL1-mediated transcriptional activation of PER2.
    Click to Show/Hide
Gene ID 7157
Uniprot ID
P53_HUMAN
HGNC ID
HGNC:11998
KEGG ID
hsa:7157
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TP53 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line HeLa cell line Homo sapiens
Treatment: METTL3 knockdown HeLa cells
Control: HeLa cells
 GSE70061
Regulation
logFC: 1.12E+00
p-value: 1.48E-02
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TP53 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 2.05E+00 GSE60213
In total 6 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silencing the m(6)A methyltransferase significantly affects gene expression and alternative splicing patterns, resulting in modulation of the Cellular tumor antigen p53 (TP53/p53) (also known as TP53) signalling pathway and apoptosis. Modulation of p53 signalling through splicing is relevant to induction of apoptosis by silencing of METTL3.
Target Regulation Down regulation
Pathway Response Apoptosis hsa04210
p53 signaling pathway hsa04115
Cell Process Gene expression
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Target Regulation Up regulation
Responsed Disease Solid tumour/cancer ICD-11: 2A00-2F9Z
 Disease Info 
Responsed Drug Arsenite Phase 2
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/Cellular tumor antigen p53 (TP53/p53) signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/p21), and downregulation of mdm2.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Cell cycle hsa04110
Apoptosis hsa04210
Cell Process Cell apoptosis
Cells in G3/M phase decreased
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
MOLT-4 Adult T acute lymphoblastic leukemia Homo sapiens CVCL_0013
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
HL-60 Adult acute myeloid leukemia Homo sapiens CVCL_0002
HEL Erythroleukemia Homo sapiens CVCL_0001
CCRF-CEM C7 T acute lymphoblastic leukemia Homo sapiens CVCL_6825
HEK293T Normal Homo sapiens CVCL_0063
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [4]
Response Summary The produced p53 R273H mutant protein resulted in acquired multidrug resistance in colon cancer cells. Either silencing METTL3 expression by using small interfering RNA (siRNA) or inhibiting RNA methylation with neplanocin A suppressed m6A formation in Cellular tumor antigen p53 (TP53/p53) pre-mRNA, and substantially increased the level of phosphorylated p53 protein (Ser15) and its function in cells heterozygously carrying the R273H mutation, thereby re-sensitizing these cells to anticancer drugs.
Target Regulation Up regulation
Responsed Disease Colon cancer ICD-11: 2B90
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Cell Process Protein signaling
In-vitro Model SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
WiDr Colon adenocarcinoma Homo sapiens CVCL_2760
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug Apatinib Approved
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug RG7112 Phase 1
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced acute kidney injury Acute kidney injury.
Target Regulation Down regulation
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced Acute kidney injury.
Target Regulation Down regulation
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/Cellular tumor antigen p53 (TP53/p53) signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/p21), and downregulation of mdm2.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Cell cycle hsa04110
Apoptosis hsa04210
Cell Process Cell apoptosis
Cells in G6/M phase decreased
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
MOLT-4 Adult T acute lymphoblastic leukemia Homo sapiens CVCL_0013
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
HL-60 Adult acute myeloid leukemia Homo sapiens CVCL_0002
HEL Erythroleukemia Homo sapiens CVCL_0001
CCRF-CEM C7 T acute lymphoblastic leukemia Homo sapiens CVCL_6825
HEK293T Normal Homo sapiens CVCL_0063
Methyltransferase-like 16 (METTL16) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [10]
Response Summary Deletion of METTL16 or ALKBH5 predicted poor OS and DFS of hepatocellular carcinoma (HCC) patients. And this study found significant associations between the genetic alterations and clinicopathological features as well as Cellular tumor antigen p53 (TP53/p53) alteration.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [10]
Response Summary Deletion of METTL16 or ALKBH5 predicted poor OS and DFS of hepatocellular carcinoma (HCC) patients. And this study found significant associations between the genetic alterations and clinicopathological features as well as Cellular tumor antigen p53 (TP53/p53) alteration.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [14]
Response Summary Knockdown of Cellular tumor antigen p53 (TP53/p53) or inhibition of p53's transcriptional activity by addition of its specific inhibitor PFT-Alpha decreased expression of ALKBH5 and Cancer stem cells' malignancies, the pivotal role of ALKBH5 in Cancer stem cells derived from nonsmall-cell lung cancer and highlight the regulatory function of the p53/ALKBH5 axis in modulating CSC progression. p53 transcriptionally regulates PRRX1, which is consistent with our previous report.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
In-vivo Model Cells at 1 × 106 were subcutaneously injected into the mice similarly to nude mice. Twenty-eight days later, grafted tumors were collected and morphologically analyzed.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [15]
Response Summary ALKBH5 as another mammalian demethylase that oxidatively reverses m(6)A in mRNA in vitro and in vivo. Alkbh5-deficient male mice have increased m(6)A in mRNA and are characterized by impaired fertility resulting from apoptosis that affects meiotic metaphase-stage spermatocytes. Identified in mouse testes 1,551 differentially expressed genes that cover broad functional categories and include spermatogenesis-related mRNAs involved in the Cellular tumor antigen p53 (TP53/p53) functional interaction network.
Responsed Disease Female reproductive system disorders ICD-11: SC4Y
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
In-vivo Model Neo-resistant recombinant ESCs were analyzed for correct 3' and 5' targeting through hybridization by standard protocols, and we identified seven correctly targeted clones. Following ESC cell injection, several high-percentage chimera males were born. These were bred with Cre-expressing mice, and Cre-mediated excision of Alkbh5 exon 1 was tested in 26 agouti F1 pups. Two animals tested positive for the excised allele. These two mice, heterozygous for the constitutive allele (Alkbh5+/-), were analyzed by Southern blot analysis and used for further breeding to generate Alkbh5-/- mice.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Target Regulation Down regulation
Responsed Disease Solid tumour/cancer ICD-11: 2A00-2F9Z
 Disease Info 
Responsed Drug Arsenite Phase 2
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
Solid tumour/cancer [ICD-11: 2A00-2F9Z]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Responsed Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Arsenite Phase 2
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
Experiment 2 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Responsed Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Arsenite Phase 2
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
Acute myeloid leukaemia [ICD-11: 2A60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/Cellular tumor antigen p53 (TP53/p53) signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/p21), and downregulation of mdm2.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response p53 signaling pathway hsa04115
Cell cycle hsa04110
Apoptosis hsa04210
Cell Process Cell apoptosis
Cells in G6/M phase decreased
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
MOLT-4 Adult T acute lymphoblastic leukemia Homo sapiens CVCL_0013
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
HL-60 Adult acute myeloid leukemia Homo sapiens CVCL_0002
HEL Erythroleukemia Homo sapiens CVCL_0001
CCRF-CEM C7 T acute lymphoblastic leukemia Homo sapiens CVCL_6825
HEK293T Normal Homo sapiens CVCL_0063
Experiment 2 Reporting the m6A-centered Disease Response [3]
Response Summary METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/Cellular tumor antigen p53 (TP53/p53) signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/p21), and downregulation of mdm2.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response p53 signaling pathway hsa04115
Cell cycle hsa04110
Apoptosis hsa04210
Cell Process Cell apoptosis
Cells in G3/M phase decreased
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
NB4 Acute promyelocytic leukemia Homo sapiens CVCL_0005
MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
MOLT-4 Adult T acute lymphoblastic leukemia Homo sapiens CVCL_0013
Kasumi-1 Myeloid leukemia with maturation Homo sapiens CVCL_0589
K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
HL-60 Adult acute myeloid leukemia Homo sapiens CVCL_0002
HEL Erythroleukemia Homo sapiens CVCL_0001
CCRF-CEM C7 T acute lymphoblastic leukemia Homo sapiens CVCL_6825
HEK293T Normal Homo sapiens CVCL_0063
Colon cancer [ICD-11: 2B90]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary Colon cancer cell lines, either WiDr homozygous for missense-mutated Cellular tumor antigen p53 (TP53/p53) (R273H) or SW48/TP53-Dox bearing heterozygous TP53 mutant (R273H), display drug resistance with increased ceramide glycosylation. Increased Gb3-cSrc complex in GEMs of membranes in response to anticancer drug induced cell stress promotes expression of p53 mutant proteins and accordant cancer drug resistance. Genz-161 effectively inhibited GCS activity, and substantially suppressed the elevated Gb3 levels seen in GEMs of p53-mutant cells exposed to doxorubicin.
Responsed Disease Colon cancer [ICD-11: 2B90]
Pathway Response Apoptosis hsa04210
Wnt signaling pathway hsa04310
Cell Process Cellular stress
Cell apoptosis
In-vitro Model SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
In-vivo Model Cell suspension of SW48 or SW48/TP53 (5-7 passages, 1 × 106 cells in 20 uL/mouse) was subcutaneously injected into the left flank of the mice.
Experiment 2 Reporting the m6A-centered Disease Response [4]
Response Summary The produced p53 R273H mutant protein resulted in acquired multidrug resistance in colon cancer cells. Either silencing METTL3 expression by using small interfering RNA (siRNA) or inhibiting RNA methylation with neplanocin A suppressed m6A formation in Cellular tumor antigen p53 (TP53/p53) pre-mRNA, and substantially increased the level of phosphorylated p53 protein (Ser15) and its function in cells heterozygously carrying the R273H mutation, thereby re-sensitizing these cells to anticancer drugs.
Responsed Disease Colon cancer [ICD-11: 2B90]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response p53 signaling pathway hsa04115
Cell Process Protein signaling
In-vitro Model SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
WiDr Colon adenocarcinoma Homo sapiens CVCL_2760
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [10]
Response Summary Deletion of METTL16 or ALKBH5 predicted poor OS and DFS of hepatocellular carcinoma (HCC) patients. And this study found significant associations between the genetic alterations and clinicopathological features as well as Cellular tumor antigen p53 (TP53/p53) alteration.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 16 (METTL16) WRITER
 Regulator Info 
Experiment 2 Reporting the m6A-centered Disease Response [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Apatinib Approved
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Experiment 3 Reporting the m6A-centered Disease Response [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug RG7112 Phase 1
 Drug Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Experiment 4 Reporting the m6A-centered Disease Response [10]
Response Summary Deletion of METTL16 or ALKBH5 predicted poor OS and DFS of hepatocellular carcinoma (HCC) patients. And this study found significant associations between the genetic alterations and clinicopathological features as well as Cellular tumor antigen p53 (TP53/p53) alteration.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [14]
Response Summary Knockdown of Cellular tumor antigen p53 (TP53/p53) or inhibition of p53's transcriptional activity by addition of its specific inhibitor PFT-Alpha decreased expression of ALKBH5 and Cancer stem cells' malignancies, the pivotal role of ALKBH5 in Cancer stem cells derived from nonsmall-cell lung cancer and highlight the regulatory function of the p53/ALKBH5 axis in modulating CSC progression. p53 transcriptionally regulates PRRX1, which is consistent with our previous report.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Up regulation
Pathway Response p53 signaling pathway hsa04115
In-vitro Model PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
In-vivo Model Cells at 1 × 106 were subcutaneously injected into the mice similarly to nude mice. Twenty-eight days later, grafted tumors were collected and morphologically analyzed.
Acute kidney failure [ICD-11: GB60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced acute kidney injury Acute kidney injury.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Experiment 2 Reporting the m6A-centered Disease Response [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced Acute kidney injury.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Cerebral development anomalies [ICD-11: LA05]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary Post-transcriptional regulation by the exosome complex is required for cell survival and forebrain development via repression of Cellular tumor antigen p53 (TP53/p53) signaling. N6-methyladenosine (m6A) methylation-mediated degradation of RNA is essential for brain development,m6A methylation impacts not only RNA stability, but also other RNA metabolism processes. Exosc10 in suppressing the P53 pathway, in which the rapid turnover of the apoptosis effectors Aen and Bbc3 mRNAs is essential for cell survival and normal cortical histogenesis.
Responsed Disease Cerebral development anomalies [ICD-11: LA05]
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vivo Model Exosc10cKO_Emx1-Cre mouse embryos were subjected to the p53-inhibitor Pifithrin-Alpha (PFT-Alpha) by intraperitoneal injection of 2.2 mg/kg PFT-Alpha (Selleckchem) into the pregnant mother at between E9.5 and E12.5 or between E9.5 and E15.5. Embryonic brains were isolated at E13.5 or E18.5 and immunohistochemistry was performed.
Female reproductive system disorders [ICD-11: SC4Y]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [15]
Response Summary ALKBH5 as another mammalian demethylase that oxidatively reverses m(6)A in mRNA in vitro and in vivo. Alkbh5-deficient male mice have increased m(6)A in mRNA and are characterized by impaired fertility resulting from apoptosis that affects meiotic metaphase-stage spermatocytes. Identified in mouse testes 1,551 differentially expressed genes that cover broad functional categories and include spermatogenesis-related mRNAs involved in the Cellular tumor antigen p53 (TP53/p53) functional interaction network.
Responsed Disease Female reproductive system disorders [ICD-11: SC4Y]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
In-vivo Model Neo-resistant recombinant ESCs were analyzed for correct 3' and 5' targeting through hybridization by standard protocols, and we identified seven correctly targeted clones. Following ESC cell injection, several high-percentage chimera males were born. These were bred with Cre-expressing mice, and Cre-mediated excision of Alkbh5 exon 1 was tested in 26 agouti F1 pups. Two animals tested positive for the excised allele. These two mice, heterozygous for the constitutive allele (Alkbh5+/-), were analyzed by Southern blot analysis and used for further breeding to generate Alkbh5-/- mice.
Apatinib [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced acute kidney injury Acute kidney injury.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Meclofenamic acid [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [7]
Response Summary Meclofenamic acid increased Cellular tumor antigen p53 (TP53/p53) mRNA and protein levels in AKI both in vitro and in vivo, and FTO overexpression reduced p53 expression and reversed the MA-induced p53 increase in cisplatin-induced Acute kidney injury.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model HK2 Normal Acipenser baerii CVCL_YE28
In-vivo Model Induced AKI in c57BL/6 mice by intraperitoneal cisplatin injection and treated the animal with vehicle or an FTO inhibitor meclofenamic acid (MA) for 3 days.
Arsenite [Phase 2]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Solid tumour/cancer ICD-11: 2A00-2F9Z
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
Experiment 2 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 significantly decreased m6A level, restoring Cellular tumor antigen p53 (TP53/p53) activation and inhibiting cellular transformation phenotypes in the arsenite-transformed cells. m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A upregulated the expression of the negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. This study further sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Solid tumour/cancer ICD-11: 2A00-2F9Z
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
In-vitro Model HaCaT Normal Homo sapiens CVCL_0038
RG7112 [ Phase 1]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [5]
Response Summary Cellular tumor antigen p53 (TP53/p53) n6-methyladenosine (m6A) played a decisive role in regulating Hepatocellular carcinoma(HCC) sensitivity to chemotherapy via the p53 activator RG7112 and the vascular endothelial growth factor receptor inhibitor apatinib. p53 mRNA m6A modification blockage induced by S-adenosyl homocysteine or siRNA-mediated METTL3 inhibition enhanced HCC sensitivity to chemotherapy.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response p53 signaling pathway hsa04115
Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model QGY-7701 Human papillomavirus-related endocervical adenocarcinoma Homo sapiens CVCL_6859
HHL-5 Normal Homo sapiens CVCL_S956
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Nude mice (4-6 week-old) were administered sterile water and feed in a specific pathogen-free barrier. Using a 1-mL syringe, 1 × 107 HEPG2 cells were subcutaneously inoculated into the right axilla of nude mice to build the HCC xenograft model. When the tumor volume reached 50 mm3, the nude mice were randomly divided into 1 control (n = 4) and 3 treatment groups (n = 4 each). RG7112, apatinib, and RG7112 + apatinib were administered to the treatment groups and an equal volume of dimethyl sulfoxide to the control group by daily gavage for 14 d. The tumor length (L) and width (W) were measured on alternate days using vernier calipers. The following formula was used to calculate the tumor volume: volume (mm3) = 0.5 × L × W × W. At the end of the experiment, the nude mice were killed by CO2 overdose anesthesia. The tumors were dissected and weighed using a precision balance, and the tumor tissue was stored in liquid nitrogen for further analysis.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00069
 Crosstalk Info 
Epigenetic Regulator tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 (NSUN6)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship m5C → m6A
Disease Colon cancer
 Disease Info 
Drug Contusugene ladenovec
 Drug Info 
Crosstalk ID: M6ACROT00432
 Crosstalk Info 
Epigenetic Regulator Methyltransferase-like protein 1 (METTL1)
Regulated Target MicroRNA 125a (MIR125A)
Crosstalk relationship m7G → m6A
Crosstalk ID: M6ACROT00437
 Crosstalk Info 
Epigenetic Regulator Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target MicroRNA 214 (MIR214)
Crosstalk relationship A-to-I → m6A
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00431
 Crosstalk Info 
Epigenetic Regulator Methyltransferase-like protein 1 (METTL1)
Regulated Target MicroRNA 125a (MIR125A)
Crosstalk relationship m7G → m6A
Crosstalk ID: M6ACROT00436
 Crosstalk Info 
Epigenetic Regulator Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target MicroRNA 214 (MIR214)
Crosstalk relationship A-to-I → m6A
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00433
 Crosstalk Info 
Epigenetic Regulator Methyltransferase-like protein 1 (METTL1)
Regulated Target MicroRNA 125a (MIR125A)
Crosstalk relationship m7G → m6A
Crosstalk ID: M6ACROT00438
 Crosstalk Info 
Epigenetic Regulator Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target MicroRNA 214 (MIR214)
Crosstalk relationship A-to-I → m6A
Histone modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03049
 Crosstalk Info 
Epigenetic Regulator Lactate dehydrogenase A (LDHA)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Melanoma of uvea
 Disease Info 
Crosstalk ID: M6ACROT03050
 Crosstalk Info 
Epigenetic Regulator L-lactate dehydrogenase B chain (LDHB)
Regulated Target Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship Histone modification → m6A
Disease Melanoma of uvea
 Disease Info 
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03366
 Crosstalk Info 
Epigenetic Regulator Histone deacetylase 2 (HDAC2)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03463
 Crosstalk Info 
Epigenetic Regulator Histone deacetylase 1 (HDAC1)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03533
 Crosstalk Info 
Epigenetic Regulator WD repeat-containing protein 5 (WDR5)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Liver cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05064
 Crosstalk Info 
Epigenetic Regulator Antisense of IGF2R non-protein coding RNA (AIRN)
Regulated Target Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship ncRNA → m6A
Disease Vascular disorders of the liver
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00356)
Cellular tumor antigen p53 (TP53/p53)
Adenosine-to-Inosine editing (A-to-I)
In total 8 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007741 Click to Show/Hide the Full List
mod site chr17:7662895-7662896:- [17]
Sequence CATGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCT
Transcript ID List ENST00000413465.6; rmsk_4628373
External Link RMBase: RNA-editing_site_54881
mod ID: A2ISITE007742 Click to Show/Hide the Full List
mod site chr17:7665877-7665878:- [17]
Sequence ACAGCACATTGGGAGGCTAAAGCAGGAGGATAACTTGAGGC
Transcript ID List ENST00000413465.6; ENST00000635293.1; rmsk_4628387
External Link RMBase: RNA-editing_site_54882
mod ID: A2ISITE007743 Click to Show/Hide the Full List
mod site chr17:7666206-7666207:- [17]
Sequence GCACGGTGGATCACACCTGTAATCCCAGCTACTCGGGAGGC
Transcript ID List ENST00000359597.8; rmsk_4628388; ENST00000635293.1; ENST00000413465.6
External Link RMBase: RNA-editing_site_54883
mod ID: A2ISITE007744 Click to Show/Hide the Full List
mod site chr17:7671228-7671229:- [17]
Sequence AGGAGGATCTCTTGAGCCCAAGAGTTTGAGTCCAGCCTGAA
Transcript ID List ENST00000620739.4; ENST00000619485.4; ENST00000359597.8; ENST00000504937.5; ENST00000504290.5; ENST00000269305.8; ENST00000617185.4; ENST00000576024.1; ENST00000510385.5; ENST00000610623.4; ENST00000413465.6; ENST00000610292.4; ENST00000445888.6; ENST00000635293.1; ENST00000455263.6; ENST00000420246.6; ENST00000619186.4; ENST00000622645.4; ENST00000610538.4; ENST00000618944.4; rmsk_4628398; ENST00000615910.4
External Link RMBase: RNA-editing_site_54884
mod ID: A2ISITE007745 Click to Show/Hide the Full List
mod site chr17:7671925-7671926:- [17]
Sequence TTTTTATTTTCTGTGAAGTCAAGGTCTTGCTACGTTGCCCA
Transcript ID List ENST00000504937.5; ENST00000510385.5; ENST00000617185.4; ENST00000455263.6; ENST00000610623.4; ENST00000420246.6; ENST00000576024.1; ENST00000610538.4; ENST00000359597.8; ENST00000619186.4; ENST00000619485.4; ENST00000504290.5; ENST00000635293.1; ENST00000615910.4; ENST00000413465.6; ENST00000269305.8; ENST00000610292.4; ENST00000620739.4; ENST00000618944.4; ENST00000622645.4; ENST00000445888.6
External Link RMBase: RNA-editing_site_54885
mod ID: A2ISITE007746 Click to Show/Hide the Full List
mod site chr17:7672745-7672746:- [17]
Sequence GATTACAGTGATGTGATCATAGCTCATTATACCCTCCTGGG
Transcript ID List ENST00000620739.4; ENST00000617185.4; ENST00000269305.8; ENST00000610292.4; ENST00000610538.4; ENST00000615910.4; ENST00000635293.1; ENST00000445888.6; ENST00000622645.4; ENST00000359597.8; ENST00000420246.6; ENST00000413465.6; ENST00000610623.4; ENST00000504290.5; ENST00000455263.6; ENST00000619485.4; ENST00000504937.5; ENST00000619186.4; ENST00000510385.5; ENST00000576024.1; ENST00000618944.4
External Link RMBase: RNA-editing_site_54886
mod ID: A2ISITE007747 Click to Show/Hide the Full List
mod site chr17:7684206-7684207:- [17]
Sequence AGGATCTCACTATGTTGCCCAGGCTGGTCTCAAACTGCTGG
Transcript ID List ENST00000635293.1; ENST00000610538.4; ENST00000445888.6; ENST00000455263.6; ENST00000514944.5; ENST00000622645.4; ENST00000505014.5; ENST00000604348.5; ENST00000503591.1; ENST00000509690.5; ENST00000620739.4; ENST00000617185.4; ENST00000420246.6; ENST00000610292.4; ENST00000269305.8; ENST00000619485.4
External Link RMBase: RNA-editing_site_54887
mod ID: A2ISITE007748 Click to Show/Hide the Full List
mod site chr17:7684352-7684353:- [18]
Sequence ACTGTTGCCCAGGCTAGAGTACAATGGCACAATCAAGGCTT
Transcript ID List ENST00000514944.5; ENST00000509690.5; ENST00000445888.6; ENST00000619485.4; ENST00000505014.5; ENST00000617185.4; ENST00000503591.1; ENST00000269305.8; ENST00000620739.4; ENST00000635293.1; ENST00000622645.4; ENST00000455263.6; ENST00000420246.6; ENST00000610538.4; ENST00000610292.4; ENST00000604348.5
External Link RMBase: RNA-editing_site_54888
N1-methyladenosine (m1A)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000049 Click to Show/Hide the Full List
mod site chr17:7673779-7673780:- [19]
Sequence GTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGA
Cell/Tissue List HEK293T
Seq Type List m1A-MAP-seq
Transcript ID List ENST00000504937.5; ENST00000610623.4; ENST00000510385.5; ENST00000618944.4; ENST00000619485.4; ENST00000635293.1; ENST00000455263.6; ENST00000610292.4; ENST00000610538.4; ENST00000445888.6; ENST00000504290.5; ENST00000420246.6; ENST00000622645.4; ENST00000413465.6; ENST00000619186.4; ENST00000359597.8; ENST00000617185.4; ENST00000509690.5; ENST00000620739.4; ENST00000269305.8; ENST00000615910.4
External Link RMBase: m1A_site_414
mod ID: M1ASITE000050 Click to Show/Hide the Full List
mod site chr17:7674891-7674892:- [20]
Sequence GATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTA
Cell/Tissue List HEK293T
Seq Type List m1A-seq
Transcript ID List ENST00000504290.5; ENST00000610292.4; ENST00000359597.8; ENST00000617185.4; ENST00000413465.6; ENST00000610538.4; ENST00000455263.6; ENST00000509690.5; ENST00000574684.1; ENST00000615910.4; ENST00000269305.8; ENST00000635293.1; ENST00000622645.4; ENST00000420246.6; ENST00000504937.5; ENST00000618944.4; ENST00000619186.4; ENST00000514944.5; ENST00000445888.6; ENST00000619485.4; ENST00000620739.4; ENST00000610623.4; ENST00000505014.5; ENST00000510385.5
External Link RMBase: m1A_site_415
5-methylcytidine (m5C)
In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000941 Click to Show/Hide the Full List
mod site chr17:7670712-7670713:- [21]
Sequence CCTCCTCTGTTGCTGCAGATCCGTGGGCGTGAGCGCTTCGA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000504290.5; ENST00000620739.4; ENST00000504937.5; ENST00000619186.4; ENST00000617185.4; ENST00000576024.1; ENST00000359597.8; ENST00000455263.6; ENST00000618944.4; ENST00000445888.6; ENST00000622645.4; ENST00000510385.5; ENST00000610538.4; ENST00000269305.8; ENST00000635293.1; ENST00000610292.4; ENST00000615910.4; ENST00000420246.6; ENST00000610623.4; ENST00000619485.4; ENST00000413465.6
External Link RMBase: m5C_site_17915
mod ID: M5CSITE000942 Click to Show/Hide the Full List
mod site chr17:7676583-7676584:- [21]
Sequence GGTCACTGCCATGGAGGAGCCGCAGTCAGATCCTAGCGTCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000420246.6; ENST00000619485.4; ENST00000455263.6; ENST00000514944.5; ENST00000617185.4; ENST00000509690.5; ENST00000505014.5; ENST00000269305.8; ENST00000359597.8; ENST00000604348.5; ENST00000610292.4; ENST00000615910.4; ENST00000620739.4; ENST00000622645.4; ENST00000635293.1; ENST00000413465.6; ENST00000508793.5; ENST00000503591.1; ENST00000445888.6; ENST00000610538.4
External Link RMBase: m5C_site_17916
mod ID: M5CSITE000943 Click to Show/Hide the Full List
mod site chr17:7686881-7686882:-
Sequence CCCAAGCTGCTAAGGTCCCACAACTTCCGGACCTTTGTCCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000505014.5; ENST00000610292.4; ENST00000509690.5; ENST00000445888.6; ENST00000622645.4; ENST00000269305.8; ENST00000420246.6; ENST00000620739.4; ENST00000619485.4; ENST00000617185.4; ENST00000455263.6; ENST00000604348.5; ENST00000610538.4; ENST00000635293.1; ENST00000514944.5; ENST00000503591.1
External Link RMBase: m5C_site_17917
N6-methyladenosine (m6A)
In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE030086 Click to Show/Hide the Full List
mod site chr17:7667034-7667035:- [22]
Sequence ACTCTGCAGATCTCAAGTAAACAGAAAATCTCCCTTTTTGA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000359597.8; ENST00000413465.6; ENST00000635293.1
External Link RMBase: m6A_site_346500
mod ID: M6ASITE030087 Click to Show/Hide the Full List
mod site chr17:7667058-7667059:- [22]
Sequence CCTACGACGAGGACACTTGGACCTACTCTGCAGATCTCAAG
Motif Score 3.622404762
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000413465.6; ENST00000359597.8; ENST00000635293.1
External Link RMBase: m6A_site_346501
mod ID: M6ASITE030088 Click to Show/Hide the Full List
mod site chr17:7667066-7667067:- [22]
Sequence TGTGTTCACCTACGACGAGGACACTTGGACCTACTCTGCAG
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000413465.6; ENST00000359597.8; ENST00000635293.1
External Link RMBase: m6A_site_346502
mod ID: M6ASITE030089 Click to Show/Hide the Full List
mod site chr17:7667392-7667393:- [23]
Sequence ACTCTCCCCAGGAGATCCAGACCCGCCTCTTTCAGAGACTT
Motif Score 2.876744048
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000359597.8; ENST00000635293.1; ENST00000413465.6
External Link RMBase: m6A_site_346503
mod ID: M6ASITE030090 Click to Show/Hide the Full List
mod site chr17:7667414-7667415:- [22]
Sequence TTCTTACTAGGGAATGCCAAACACTCTCCCCAGGAGATCCA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000413465.6; ENST00000359597.8; ENST00000635293.1
External Link RMBase: m6A_site_346504
mod ID: M6ASITE030091 Click to Show/Hide the Full List
mod site chr17:7668431-7668432:- [22]
Sequence ATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000619485.4; ENST00000445888.6; ENST00000269305.8; ENST00000620739.4; ENST00000420246.6; ENST00000504937.5; ENST00000622645.4; ENST00000618944.4; ENST00000359597.8; ENST00000617185.4; ENST00000610538.4; ENST00000610623.4; ENST00000455263.6; ENST00000610292.4; ENST00000504290.5; ENST00000635293.1; ENST00000619186.4; ENST00000413465.6; ENST00000510385.5
External Link RMBase: m6A_site_346505
mod ID: M6ASITE030092 Click to Show/Hide the Full List
mod site chr17:7668624-7668625:- [24]
Sequence GTTGCCCAGGCTGGTCTCAAACTCCTGGGCTCAGGCGATCC
Motif Score 2.627720238
Cell/Tissue List MT4; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000455263.6; ENST00000622645.4; ENST00000619186.4; ENST00000504290.5; ENST00000610623.4; ENST00000619485.4; ENST00000635293.1; ENST00000413465.6; ENST00000504937.5; ENST00000359597.8; ENST00000618944.4; ENST00000510385.5; ENST00000617185.4; ENST00000445888.6; ENST00000620739.4; ENST00000610538.4; ENST00000610292.4; ENST00000269305.8; ENST00000420246.6
External Link RMBase: m6A_site_346506
mod ID: M6ASITE030093 Click to Show/Hide the Full List
mod site chr17:7668710-7668711:- [25]
Sequence CAGCCTCCGGAGTAGCTGGGACCACAGGTTCATGCCACCAT
Motif Score 3.622404762
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000620739.4; ENST00000610292.4; ENST00000635293.1; ENST00000622645.4; ENST00000619485.4; ENST00000504937.5; ENST00000445888.6; ENST00000618944.4; ENST00000619186.4; ENST00000617185.4; ENST00000269305.8; ENST00000455263.6; ENST00000610623.4; ENST00000413465.6; ENST00000610538.4; ENST00000420246.6; ENST00000359597.8; ENST00000510385.5; ENST00000504290.5
External Link RMBase: m6A_site_346507
mod ID: M6ASITE030094 Click to Show/Hide the Full List
mod site chr17:7669054-7669055:- [26]
Sequence TCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGG
Motif Score 2.078666667
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000420246.6; ENST00000620739.4; ENST00000413465.6; ENST00000618944.4; ENST00000622645.4; ENST00000510385.5; ENST00000455263.6; ENST00000635293.1; ENST00000610538.4; ENST00000504937.5; ENST00000610292.4; ENST00000619186.4; ENST00000445888.6; ENST00000359597.8; ENST00000617185.4; ENST00000610623.4; ENST00000619485.4; ENST00000504290.5; ENST00000269305.8
External Link RMBase: m6A_site_346508
mod ID: M6ASITE030095 Click to Show/Hide the Full List
mod site chr17:7669274-7669275:- [27]
Sequence GGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCTCAC
Motif Score 2.147452381
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000504937.5; ENST00000619485.4; ENST00000635293.1; ENST00000359597.8; ENST00000269305.8; ENST00000618944.4; ENST00000619186.4; ENST00000617185.4; ENST00000610538.4; ENST00000610292.4; ENST00000510385.5; ENST00000622645.4; ENST00000504290.5; ENST00000610623.4; ENST00000620739.4; ENST00000445888.6; ENST00000455263.6; ENST00000413465.6; ENST00000420246.6
External Link RMBase: m6A_site_346509
mod ID: M6ASITE030096 Click to Show/Hide the Full List
mod site chr17:7669288-7669289:- [28]
Sequence CACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGG
Motif Score 2.475107143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000455263.6; ENST00000420246.6; ENST00000504937.5; ENST00000622645.4; ENST00000617185.4; ENST00000635293.1; ENST00000510385.5; ENST00000610623.4; ENST00000269305.8; ENST00000359597.8; ENST00000619485.4; ENST00000620739.4; ENST00000504290.5; ENST00000413465.6; ENST00000610292.4; ENST00000618944.4; ENST00000610538.4; ENST00000619186.4; ENST00000445888.6
External Link RMBase: m6A_site_346510
mod ID: M6ASITE030097 Click to Show/Hide the Full List
mod site chr17:7669401-7669402:- [24]
Sequence GGAGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAA
Motif Score 3.643047619
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000455263.6; ENST00000504937.5; ENST00000269305.8; ENST00000445888.6; ENST00000610538.4; ENST00000635293.1; ENST00000420246.6; ENST00000622645.4; ENST00000510385.5; ENST00000619485.4; ENST00000619186.4; ENST00000413465.6; ENST00000610292.4; ENST00000610623.4; ENST00000359597.8; ENST00000617185.4; ENST00000504290.5; ENST00000620739.4; ENST00000618944.4
External Link RMBase: m6A_site_346511
mod ID: M6ASITE030098 Click to Show/Hide the Full List
mod site chr17:7669453-7669454:- [24]
Sequence TTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTG
Motif Score 2.951386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000455263.6; ENST00000620739.4; ENST00000610538.4; ENST00000618944.4; ENST00000269305.8; ENST00000622645.4; ENST00000610292.4; ENST00000359597.8; ENST00000635293.1; ENST00000445888.6; ENST00000619186.4; ENST00000413465.6; ENST00000504937.5; ENST00000504290.5; ENST00000420246.6; ENST00000619485.4; ENST00000510385.5; ENST00000610623.4; ENST00000617185.4
External Link RMBase: m6A_site_346512
mod ID: M6ASITE030099 Click to Show/Hide the Full List
mod site chr17:7669486-7669487:- [24]
Sequence GTGCGTCAGAAGCACCCAGGACTTCCATTTGCTTTGTCCCG
Motif Score 4.065041667
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000610292.4; ENST00000619186.4; ENST00000510385.5; ENST00000622645.4; ENST00000610538.4; ENST00000445888.6; ENST00000610623.4; ENST00000504937.5; ENST00000455263.6; ENST00000420246.6; ENST00000619485.4; ENST00000618944.4; ENST00000635293.1; ENST00000617185.4; ENST00000269305.8; ENST00000620739.4; ENST00000359597.8; ENST00000504290.5; ENST00000413465.6
External Link RMBase: m6A_site_346513
mod ID: M6ASITE030100 Click to Show/Hide the Full List
mod site chr17:7669525-7669526:- [24]
Sequence TTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGT
Motif Score 2.930744048
Cell/Tissue List MT4; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000617185.4; ENST00000610292.4; ENST00000610538.4; ENST00000618944.4; ENST00000504290.5; ENST00000622645.4; ENST00000504937.5; ENST00000635293.1; ENST00000445888.6; ENST00000620739.4; ENST00000359597.8; ENST00000619186.4; ENST00000413465.6; ENST00000455263.6; ENST00000619485.4; ENST00000269305.8; ENST00000610623.4; ENST00000510385.5; ENST00000420246.6
External Link RMBase: m6A_site_346514
mod ID: M6ASITE030101 Click to Show/Hide the Full List
mod site chr17:7669581-7669582:- [28]
Sequence CCACTTCTTGTTCCCCACTGACAGCCTCCCACCCCCATCTC
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000413465.6; ENST00000619485.4; ENST00000618944.4; ENST00000455263.6; ENST00000619186.4; ENST00000420246.6; ENST00000445888.6; ENST00000635293.1; ENST00000510385.5; ENST00000610623.4; ENST00000610538.4; ENST00000620739.4; ENST00000359597.8; ENST00000610292.4; ENST00000269305.8; ENST00000504937.5; ENST00000504290.5; ENST00000622645.4; ENST00000576024.1; ENST00000617185.4
External Link RMBase: m6A_site_346515
mod ID: M6ASITE030102 Click to Show/Hide the Full List
mod site chr17:7669612-7669613:- [24]
Sequence GACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTG
Motif Score 3.319380952
Cell/Tissue List MT4; Huh7; CD4T; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000445888.6; ENST00000610538.4; ENST00000610623.4; ENST00000510385.5; ENST00000413465.6; ENST00000504290.5; ENST00000420246.6; ENST00000359597.8; ENST00000269305.8; ENST00000618944.4; ENST00000455263.6; ENST00000617185.4; ENST00000576024.1; ENST00000620739.4; ENST00000619485.4; ENST00000622645.4; ENST00000504937.5; ENST00000615910.4; ENST00000635293.1; ENST00000610292.4; ENST00000619186.4
External Link RMBase: m6A_site_346516
mod ID: M6ASITE030103 Click to Show/Hide the Full List
mod site chr17:7669631-7669632:- [24]
Sequence ATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGAC
Motif Score 2.897386905
Cell/Tissue List MT4; Huh7; CD4T; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000619485.4; ENST00000413465.6; ENST00000615910.4; ENST00000576024.1; ENST00000610623.4; ENST00000619186.4; ENST00000617185.4; ENST00000610292.4; ENST00000622645.4; ENST00000504290.5; ENST00000359597.8; ENST00000635293.1; ENST00000610538.4; ENST00000420246.6; ENST00000455263.6; ENST00000510385.5; ENST00000445888.6; ENST00000269305.8; ENST00000618944.4; ENST00000620739.4; ENST00000504937.5
External Link RMBase: m6A_site_346517
mod ID: M6ASITE030104 Click to Show/Hide the Full List
mod site chr17:7669644-7669645:- [24]
Sequence TCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGG
Motif Score 2.627720238
Cell/Tissue List MT4; Huh7; CD4T; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000610623.4; ENST00000615910.4; ENST00000359597.8; ENST00000610292.4; ENST00000455263.6; ENST00000504290.5; ENST00000619485.4; ENST00000610538.4; ENST00000413465.6; ENST00000420246.6; ENST00000617185.4; ENST00000620739.4; ENST00000269305.8; ENST00000510385.5; ENST00000445888.6; ENST00000618944.4; ENST00000504937.5; ENST00000576024.1; ENST00000635293.1; ENST00000619186.4; ENST00000622645.4
External Link RMBase: m6A_site_346518
mod ID: M6ASITE030105 Click to Show/Hide the Full List
mod site chr17:7670661-7670662:- [23]
Sequence GAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGG
Motif Score 3.373380952
Cell/Tissue List HeLa; MT4; CD4T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000619186.4; ENST00000413465.6; ENST00000359597.8; ENST00000620739.4; ENST00000576024.1; ENST00000635293.1; ENST00000615910.4; ENST00000504937.5; ENST00000269305.8; ENST00000622645.4; ENST00000510385.5; ENST00000617185.4; ENST00000504290.5; ENST00000619485.4; ENST00000610292.4; ENST00000618944.4; ENST00000455263.6; ENST00000610623.4; ENST00000445888.6; ENST00000420246.6; ENST00000610538.4
External Link RMBase: m6A_site_346519
mod ID: M6ASITE030106 Click to Show/Hide the Full List
mod site chr17:7673228-7673229:- [23]
Sequence ATGGTGTTACTTCCTGATAAACTCGTCGTAAGTTGAAAATA
Motif Score 2.627720238
Cell/Tissue List HeLa; CD4T
Seq Type List m6A-seq
Transcript ID List ENST00000618944.4; ENST00000620739.4; ENST00000359597.8; ENST00000510385.5; ENST00000610292.4; ENST00000504290.5; ENST00000445888.6; ENST00000413465.6; ENST00000455263.6; ENST00000619485.4; ENST00000619186.4; ENST00000576024.1; ENST00000610623.4; ENST00000610538.4; ENST00000635293.1; ENST00000617185.4; ENST00000420246.6; ENST00000269305.8; ENST00000615910.4; ENST00000622645.4; ENST00000504937.5
External Link RMBase: m6A_site_346520
mod ID: M6ASITE030107 Click to Show/Hide the Full List
mod site chr17:7673332-7673333:- [29]
Sequence TATATATTTTAAAGGACCAGACCAGCTTTCAAAAAGAAAAT
Motif Score 2.876744048
Cell/Tissue List A549; CD4T; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000576024.1; ENST00000413465.6; ENST00000619186.4; ENST00000269305.8; ENST00000617185.4; ENST00000619485.4; ENST00000510385.5; ENST00000420246.6; ENST00000610292.4; ENST00000618944.4; ENST00000504290.5; ENST00000504937.5; ENST00000620739.4; ENST00000610538.4; ENST00000610623.4; ENST00000455263.6; ENST00000615910.4; ENST00000359597.8; ENST00000622645.4; ENST00000635293.1; ENST00000445888.6
External Link RMBase: m6A_site_346521
mod ID: M6ASITE030108 Click to Show/Hide the Full List
mod site chr17:7673564-7673565:- [30]
Sequence TCTCCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTT
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; CD4T; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000576024.1; ENST00000622645.4; ENST00000620739.4; ENST00000359597.8; ENST00000610292.4; ENST00000510385.5; ENST00000504290.5; ENST00000635293.1; ENST00000610623.4; ENST00000445888.6; ENST00000617185.4; ENST00000420246.6; ENST00000610538.4; ENST00000413465.6; ENST00000618944.4; ENST00000615910.4; ENST00000619186.4; ENST00000504937.5; ENST00000269305.8; ENST00000455263.6; ENST00000509690.5; ENST00000619485.4
External Link RMBase: m6A_site_346522
mod ID: M6ASITE030109 Click to Show/Hide the Full List
mod site chr17:7673777-7673778:- [29]
Sequence TTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGA
Motif Score 2.876744048
Cell/Tissue List A549; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000504290.5; ENST00000635293.1; ENST00000504937.5; ENST00000510385.5; ENST00000619485.4; ENST00000610538.4; ENST00000617185.4; ENST00000622645.4; ENST00000445888.6; ENST00000610623.4; ENST00000413465.6; ENST00000615910.4; ENST00000509690.5; ENST00000620739.4; ENST00000359597.8; ENST00000618944.4; ENST00000619186.4; ENST00000455263.6; ENST00000269305.8; ENST00000610292.4; ENST00000420246.6
External Link RMBase: m6A_site_346523
mod ID: M6ASITE030110 Click to Show/Hide the Full List
mod site chr17:7674901-7674902:- [23]
Sequence GGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000504937.5; ENST00000622645.4; ENST00000610538.4; ENST00000445888.6; ENST00000574684.1; ENST00000618944.4; ENST00000509690.5; ENST00000455263.6; ENST00000617185.4; ENST00000269305.8; ENST00000510385.5; ENST00000420246.6; ENST00000514944.5; ENST00000505014.5; ENST00000413465.6; ENST00000619485.4; ENST00000610292.4; ENST00000615910.4; ENST00000610623.4; ENST00000620739.4; ENST00000359597.8; ENST00000619186.4; ENST00000504290.5; ENST00000635293.1
External Link RMBase: m6A_site_346524
mod ID: M6ASITE030111 Click to Show/Hide the Full List
mod site chr17:7675193-7675194:- [23]
Sequence TGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGG
Motif Score 2.876744048
Cell/Tissue List HeLa; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000610538.4; ENST00000622645.4; ENST00000610623.4; ENST00000618944.4; ENST00000508793.5; ENST00000509690.5; ENST00000514944.5; ENST00000455263.6; ENST00000610292.4; ENST00000505014.5; ENST00000615910.4; ENST00000269305.8; ENST00000510385.5; ENST00000617185.4; ENST00000620739.4; ENST00000413465.6; ENST00000504937.5; ENST00000504290.5; ENST00000359597.8; ENST00000420246.6; ENST00000445888.6; ENST00000619186.4; ENST00000604348.5; ENST00000619485.4; ENST00000635293.1
External Link RMBase: m6A_site_346525
mod ID: M6ASITE030112 Click to Show/Hide the Full List
mod site chr17:7676016-7676017:- [23]
Sequence TGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000514944.5; ENST00000620739.4; ENST00000269305.8; ENST00000622645.4; ENST00000503591.1; ENST00000508793.5; ENST00000635293.1; ENST00000615910.4; ENST00000359597.8; ENST00000610292.4; ENST00000509690.5; ENST00000445888.6; ENST00000505014.5; ENST00000619485.4; ENST00000420246.6; ENST00000610538.4; ENST00000413465.6; ENST00000604348.5; ENST00000617185.4; ENST00000455263.6
External Link RMBase: m6A_site_346526
mod ID: M6ASITE030113 Click to Show/Hide the Full List
mod site chr17:7676064-7676065:- [23]
Sequence CTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000635293.1; ENST00000514944.5; ENST00000622645.4; ENST00000269305.8; ENST00000617185.4; ENST00000509690.5; ENST00000455263.6; ENST00000604348.5; ENST00000610292.4; ENST00000420246.6; ENST00000620739.4; ENST00000413465.6; ENST00000508793.5; ENST00000503591.1; ENST00000619485.4; ENST00000359597.8; ENST00000610538.4; ENST00000445888.6; ENST00000615910.4; ENST00000505014.5
External Link RMBase: m6A_site_346527
mod ID: M6ASITE030114 Click to Show/Hide the Full List
mod site chr17:7676198-7676199:- [23]
Sequence TGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000455263.6; ENST00000620739.4; ENST00000269305.8; ENST00000420246.6; ENST00000505014.5; ENST00000617185.4; ENST00000622645.4; ENST00000445888.6; ENST00000359597.8; ENST00000610538.4; ENST00000610292.4; ENST00000503591.1; ENST00000514944.5; ENST00000615910.4; ENST00000413465.6; ENST00000635293.1; ENST00000508793.5; ENST00000604348.5; ENST00000509690.5; ENST00000619485.4
External Link RMBase: m6A_site_346528
mod ID: M6ASITE030115 Click to Show/Hide the Full List
mod site chr17:7676215-7676216:- [23]
Sequence CTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000420246.6; ENST00000604348.5; ENST00000508793.5; ENST00000509690.5; ENST00000635293.1; ENST00000455263.6; ENST00000610292.4; ENST00000619485.4; ENST00000514944.5; ENST00000505014.5; ENST00000503591.1; ENST00000413465.6; ENST00000617185.4; ENST00000269305.8; ENST00000359597.8; ENST00000445888.6; ENST00000610538.4; ENST00000622645.4; ENST00000620739.4; ENST00000615910.4
External Link RMBase: m6A_site_346529
mod ID: M6ASITE030116 Click to Show/Hide the Full List
mod site chr17:7676391-7676392:- [23]
Sequence GTCTTTCAGACTTCCTGAAAACAACGTTCTGGTAAGGACAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000620739.4; ENST00000269305.8; ENST00000604348.5; ENST00000445888.6; ENST00000509690.5; ENST00000413465.6; ENST00000615910.4; ENST00000622645.4; ENST00000420246.6; ENST00000610292.4; ENST00000619485.4; ENST00000455263.6; ENST00000508793.5; ENST00000617185.4; ENST00000505014.5; ENST00000610538.4; ENST00000503591.1; ENST00000635293.1; ENST00000514944.5; ENST00000359597.8
External Link RMBase: m6A_site_346530
mod ID: M6ASITE030117 Click to Show/Hide the Full List
mod site chr17:7676402-7676403:- [23]
Sequence TTTCTGCTCTTGTCTTTCAGACTTCCTGAAAACAACGTTCT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000269305.8; ENST00000445888.6; ENST00000413465.6; ENST00000505014.5; ENST00000610538.4; ENST00000610292.4; ENST00000635293.1; ENST00000503591.1; ENST00000615910.4; ENST00000620739.4; ENST00000619485.4; ENST00000622645.4; ENST00000359597.8; ENST00000508793.5; ENST00000604348.5; ENST00000455263.6; ENST00000420246.6; ENST00000514944.5; ENST00000617185.4; ENST00000509690.5
External Link RMBase: m6A_site_346531
mod ID: M6ASITE030118 Click to Show/Hide the Full List
mod site chr17:7676428-7676429:- [23]
Sequence GGAAGCGAAAATTCCATGGGACTGACTTTCTGCTCTTGTCT
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000514944.5; ENST00000505014.5; ENST00000622645.4; ENST00000619485.4; ENST00000610538.4; ENST00000455263.6; ENST00000445888.6; ENST00000617185.4; ENST00000359597.8; ENST00000503591.1; ENST00000610292.4; ENST00000269305.8; ENST00000413465.6; ENST00000615910.4; ENST00000620739.4; ENST00000420246.6; ENST00000509690.5; ENST00000508793.5; ENST00000604348.5; ENST00000635293.1
External Link RMBase: m6A_site_346532
mod ID: M6ASITE030119 Click to Show/Hide the Full List
mod site chr17:7676455-7676456:- [23]
Sequence ACCCCAGCCCCCTAGCAGAGACCTGTGGGAAGCGAAAATTC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000622645.4; ENST00000620739.4; ENST00000420246.6; ENST00000359597.8; ENST00000505014.5; ENST00000610538.4; ENST00000615910.4; ENST00000455263.6; ENST00000617185.4; ENST00000503591.1; ENST00000269305.8; ENST00000610292.4; ENST00000509690.5; ENST00000635293.1; ENST00000514944.5; ENST00000445888.6; ENST00000413465.6; ENST00000619485.4; ENST00000508793.5; ENST00000604348.5
External Link RMBase: m6A_site_346533
mod ID: M6ASITE030120 Click to Show/Hide the Full List
mod site chr17:7676522-7676523:- [23]
Sequence ACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000455263.6; ENST00000604348.5; ENST00000503591.1; ENST00000509690.5; ENST00000610292.4; ENST00000269305.8; ENST00000413465.6; ENST00000610538.4; ENST00000420246.6; ENST00000619485.4; ENST00000620739.4; ENST00000508793.5; ENST00000635293.1; ENST00000622645.4; ENST00000505014.5; ENST00000617185.4; ENST00000514944.5; ENST00000445888.6; ENST00000615910.4; ENST00000359597.8
External Link RMBase: m6A_site_346534
mod ID: M6ASITE030121 Click to Show/Hide the Full List
mod site chr17:7676532-7676533:- [23]
Sequence GAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000359597.8; ENST00000615910.4; ENST00000619485.4; ENST00000610538.4; ENST00000455263.6; ENST00000604348.5; ENST00000509690.5; ENST00000514944.5; ENST00000445888.6; ENST00000413465.6; ENST00000610292.4; ENST00000622645.4; ENST00000269305.8; ENST00000635293.1; ENST00000508793.5; ENST00000503591.1; ENST00000617185.4; ENST00000620739.4; ENST00000420246.6; ENST00000505014.5
External Link RMBase: m6A_site_346535
mod ID: M6ASITE030122 Click to Show/Hide the Full List
mod site chr17:7676542-7676543:- [23]
Sequence AGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000617185.4; ENST00000445888.6; ENST00000622645.4; ENST00000615910.4; ENST00000610292.4; ENST00000505014.5; ENST00000269305.8; ENST00000604348.5; ENST00000413465.6; ENST00000420246.6; ENST00000508793.5; ENST00000610538.4; ENST00000514944.5; ENST00000620739.4; ENST00000359597.8; ENST00000619485.4; ENST00000503591.1; ENST00000455263.6; ENST00000635293.1; ENST00000509690.5
External Link RMBase: m6A_site_346536
mod ID: M6ASITE030123 Click to Show/Hide the Full List
mod site chr17:7676614-7676615:- [23]
Sequence TTTCCTCTTGCAGCAGCCAGACTGCCTTCCGGGTCACTGCC
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000508793.5; ENST00000604348.5; ENST00000503591.1; ENST00000514944.5; ENST00000635293.1; ENST00000610292.4; ENST00000620739.4; ENST00000509690.5; ENST00000619485.4; ENST00000622645.4; ENST00000269305.8; ENST00000420246.6; ENST00000445888.6; ENST00000505014.5; ENST00000610538.4; ENST00000455263.6; ENST00000617185.4
External Link RMBase: m6A_site_346537
mod ID: M6ASITE030124 Click to Show/Hide the Full List
mod site chr17:7677384-7677385:- [23]
Sequence ATGGGCAGGTGAGCGGTGAGACAGTTGTTCTTCCAGAAGCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620739.4; ENST00000269305.8; ENST00000455263.6; ENST00000508793.5; ENST00000509690.5; ENST00000505014.5; ENST00000514944.5; ENST00000617185.4; ENST00000445888.6; ENST00000622645.4; ENST00000610292.4; ENST00000420246.6; ENST00000635293.1; ENST00000503591.1; ENST00000604348.5; ENST00000610538.4; ENST00000619485.4
External Link RMBase: m6A_site_346538
mod ID: M6ASITE030125 Click to Show/Hide the Full List
mod site chr17:7685261-7685262:- [23]
Sequence ATGAAATAAAGCTGCTATAAACATTCTTGTACAATTCTTTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000420246.6; ENST00000269305.8; ENST00000610538.4; ENST00000604348.5; ENST00000505014.5; ENST00000622645.4; ENST00000445888.6; ENST00000617185.4; ENST00000619485.4; ENST00000455263.6; ENST00000571370.1; ENST00000610292.4; ENST00000503591.1; ENST00000514944.5; ENST00000620739.4; ENST00000635293.1; ENST00000509690.5
External Link RMBase: m6A_site_346539
mod ID: M6ASITE030126 Click to Show/Hide the Full List
mod site chr17:7685473-7685474:- [23]
Sequence GCCTGGGCGACAAGAACGAAACTCCGTCTCAAAAAAAAGGG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; Jurkat; CD4T; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000420246.6; ENST00000610538.4; ENST00000635293.1; ENST00000620739.4; ENST00000610292.4; ENST00000617185.4; ENST00000514944.5; ENST00000619485.4; ENST00000445888.6; ENST00000509690.5; rmsk_4628448; ENST00000571370.1; ENST00000455263.6; ENST00000505014.5; ENST00000269305.8; ENST00000604348.5; ENST00000622645.4; ENST00000503591.1
External Link RMBase: m6A_site_346540
mod ID: M6ASITE030127 Click to Show/Hide the Full List
mod site chr17:7685543-7685544:- [23]
Sequence GAGGCAGGAGAATCGCTTGAACCCGGGAGGCAGAGGTTGCA
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; Jurkat; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000509690.5; ENST00000610292.4; ENST00000514944.5; ENST00000269305.8; ENST00000505014.5; ENST00000617185.4; ENST00000619485.4; ENST00000455263.6; ENST00000503591.1; rmsk_4628448; ENST00000620739.4; ENST00000622645.4; ENST00000571370.1; ENST00000420246.6; ENST00000610538.4; ENST00000445888.6; ENST00000604348.5; ENST00000635293.1
External Link RMBase: m6A_site_346541
mod ID: M6ASITE030128 Click to Show/Hide the Full List
mod site chr17:7685661-7685662:- [31]
Sequence CTTGAGGATAGGAGTTCCAGACCAGCGTGGCCAACGTGGTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; A549; Jurkat; HEK293A-TOA; MSC; TREX
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000622645.4; ENST00000610538.4; ENST00000514944.5; ENST00000617185.4; ENST00000503591.1; ENST00000635293.1; ENST00000619485.4; ENST00000571370.1; ENST00000604348.5; ENST00000509690.5; ENST00000620739.4; rmsk_4628448; ENST00000505014.5; ENST00000420246.6; ENST00000445888.6; ENST00000269305.8; ENST00000455263.6; ENST00000610292.4
External Link RMBase: m6A_site_346542
mod ID: M6ASITE030129 Click to Show/Hide the Full List
mod site chr17:7685756-7685757:- [23]
Sequence ACCATTTTGCCTGTTGGAGAACTTCATATAGAATGGAATCA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; H1A; H1B; A549; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000604348.5; ENST00000505014.5; ENST00000509690.5; ENST00000420246.6; ENST00000619485.4; ENST00000503591.1; ENST00000622645.4; ENST00000571370.1; ENST00000610292.4; ENST00000617185.4; ENST00000610538.4; ENST00000514944.5; ENST00000445888.6; ENST00000269305.8; ENST00000635293.1; ENST00000455263.6; ENST00000620739.4
External Link RMBase: m6A_site_346543
mod ID: M6ASITE030130 Click to Show/Hide the Full List
mod site chr17:7685857-7685858:- [23]
Sequence TGATGCCTACCAAGTCACAGACCCTTTTCATCGTCCCAGAA
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000617185.4; ENST00000610538.4; ENST00000619485.4; ENST00000505014.5; ENST00000269305.8; ENST00000604348.5; ENST00000620739.4; ENST00000610292.4; ENST00000445888.6; ENST00000635293.1; ENST00000514944.5; ENST00000571370.1; ENST00000503591.1; ENST00000622645.4; ENST00000509690.5; ENST00000455263.6; ENST00000420246.6
External Link RMBase: m6A_site_346544
mod ID: M6ASITE030131 Click to Show/Hide the Full List
mod site chr17:7686080-7686081:- [23]
Sequence TCTTCCTGGTAGGAGGCGGAACTCGAATTCATTTCTCCCGC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000610538.4; ENST00000514944.5; ENST00000445888.6; ENST00000571370.1; ENST00000503591.1; ENST00000619485.4; ENST00000610292.4; ENST00000617185.4; ENST00000505014.5; ENST00000620739.4; ENST00000604348.5; ENST00000420246.6; ENST00000635293.1; ENST00000455263.6; ENST00000622645.4; ENST00000269305.8; ENST00000509690.5
External Link RMBase: m6A_site_346545
mod ID: M6ASITE030132 Click to Show/Hide the Full List
mod site chr17:7686232-7686233:- [23]
Sequence TTTGATAATTTGTCGGAAAAACAATCTACCTGTTATCTAGC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000505014.5; ENST00000619485.4; ENST00000635293.1; ENST00000620739.4; ENST00000503591.1; ENST00000420246.6; ENST00000269305.8; ENST00000610292.4; ENST00000514944.5; ENST00000571370.1; ENST00000610538.4; ENST00000445888.6; ENST00000622645.4; ENST00000455263.6; ENST00000617185.4; ENST00000509690.5; ENST00000604348.5
External Link RMBase: m6A_site_346546
mod ID: M6ASITE030133 Click to Show/Hide the Full List
mod site chr17:7687436-7687437:- [23]
Sequence GTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; H1B; fibroblasts; A549; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622645.4; ENST00000455263.6; ENST00000619485.4; ENST00000617185.4; ENST00000620739.4; ENST00000420246.6; ENST00000269305.8; ENST00000604348.5; ENST00000610538.4; ENST00000505014.5; ENST00000635293.1; ENST00000610292.4; ENST00000509690.5; ENST00000445888.6
External Link RMBase: m6A_site_346553
mod ID: M6ASITE030134 Click to Show/Hide the Full List
mod site chr17:7687513-7687514:- [23]
Sequence TCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAG
Motif Score 3.319380952
Cell/Tissue List HeLa; fibroblasts; A549; HEK293A-TOA; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000269305.8; ENST00000620739.4; ENST00000617185.4
External Link RMBase: m6A_site_346556