m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00213)

Target Name	Cyclin-dependent kinase inhibitor 1 (CDKN1A)
Synonyms	CDK-interacting protein 1; Melanoma differentiation-associated protein 6; MDA-6; p21; CAP20; CDKN1; CIP1; MDA6; PIC1; SDI1; WAF1 Click to Show/Hide
Gene Name	CDKN1A
Chromosomal Location	6p21.2
Family	CDI family
Function	May be involved in p53/TP53 mediated inhibition of cellular proliferation in response to DNA damage. Binds to and inhibits cyclin-dependent kinase activity, preventing phosphorylation of critical cyclin-dependent kinase substrates and blocking cell cycle progression. Functions in the nuclear localization and assembly of cyclin D-CDK4 complex and promotes its kinase activity towards RB1. At higher stoichiometric ratios, inhibits the kinase activity of the cyclin D-CDK4 complex. Inhibits DNA synthesis by DNA polymerase delta by competing with POLD3 for PCNA binding. Plays an important role in controlling cell cycle progression and DNA damage-induced G2 arrest. Click to Show/Hide
Gene ID	1026
Uniprot ID	CDN1A_HUMAN
HGNC ID	HGNC:1784
KEGG ID	hsa:1026

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CDKN1A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 7.88E-01 p-value: 3.07E-21
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between CDKN1A and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 9.39E+00	GSE60213

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/p53 signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/Cyclin-dependent kinase inhibitor 1 (CDKN1A)), and downregulation of mdm2.
Target Regulation	Up regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell apoptosis
Cell Process	Cells in G4/M phase decreased
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	MOLT-4	Adult T acute lymphoblastic leukemia	Homo sapiens	CVCL_0013
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEL	Erythroleukemia	Homo sapiens	CVCL_0001
	CCRF-CEM C7	T acute lymphoblastic leukemia	Homo sapiens	CVCL_6825
	HEK293T	Normal	Homo sapiens	CVCL_0063
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 modulates the cell cycle of Esophageal squamous cell carcinoma(ESCC) cells through a Cyclin-dependent kinase inhibitor 1 (CDKN1A)-dependent pattern. METTL3-guided m6A modification contributes to the progression of ESCC via the p21-axis.
Target Regulation	Down regulation
Responsed Disease	Esophageal squamous cell carcinoma		ICD-11: 2B70.1	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Arrest cell cycle at G2/M phase
In-vitro Model	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
In-vitro Model	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
In-vivo Model	Totally 5 × 10⁶ ESCC cells after treatment were administered to randomized animals by the subcutaneous route (right flank) in 200 uL DMEM. Tumor measurement was performed every other day. At study end (at least 3 weeks), the animals underwent euthanasia, and the tumors were extracted for histology.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 is able to promote breast cancer cell proliferation by regulating the Cyclin-dependent kinase inhibitor 1 (CDKN1A) expression by an m6A-dependent manner. Metformin can take p21 as the main target to inhibit such effect.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	SUM1315MO2	Invasive breast carcinoma of no special type	Homo sapiens	CVCL_5589
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HBL-100	Normal	Homo sapiens	CVCL_4362
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
In-vivo Model	About 1 × 10⁷ stable METTL3 overexpression and negative control SUM-1315 cells were injected subcutaneously into the axilla of the female BALB/C nude mice (4-6 weeks old, 18-20 g, 10 mice/group). One week after injection, the two groups, METTL3 OE and NC, were then randomly allocated into the control group and experimental group (5 mice/group), which were treated with PBS or metformin (250 mg/kg/dose, respectively). PBS or metformin was administered every 2 days via intraperitoneal injection.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 9.72E-01 p-value: 1.24E-24
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	The elevated FTO in esophageal squamous cell carcinoma decreased m6A methylation of LINC00022 transcript, leading to the inhibition of LINC00022 decay via the m6A reader YTHDF2. LINC00022 directly binds to Cyclin-dependent kinase inhibitor 1 (CDKN1A) protein and promotes its ubiquitination-mediated degradation, thereby facilitating cell-cycle progression and proliferation.
Responsed Disease	Esophageal squamous cell carcinoma		ICD-11: 2B70.1	Disease Info
Pathway Response	Cell cycle			hsa04110
Pathway Response	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Ubiquitination degradation
	Cell apoptosis
	Decreased G0/G1 phase
In-vitro Model	HET-1A	Normal	Homo sapiens	CVCL_3702
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	KYSE-450	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1353
	KYSE-70	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1356
	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
In-vivo Model	The number of cells inoculated in each mouse was 4 × 10⁶, 1 × 10⁶, 2 × 10⁶ and 1 × 10⁶, respectively.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Neural progenitor cell line	Mus musculus
Treatment: METTL14 knockout NPCs Control: Wild type NPCs		GSE158985
Regulation		logFC: -9.21E-01 p-value: 1.04E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/p53 signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/Cyclin-dependent kinase inhibitor 1 (CDKN1A)), and downregulation of mdm2.
Target Regulation	Up regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell apoptosis
Cell Process	Cells in G7/M phase decreased
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	MOLT-4	Adult T acute lymphoblastic leukemia	Homo sapiens	CVCL_0013
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEL	Erythroleukemia	Homo sapiens	CVCL_0001
	CCRF-CEM C7	T acute lymphoblastic leukemia	Homo sapiens	CVCL_6825
	HEK293T	Normal	Homo sapiens	CVCL_0063

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	CAG cell line	Homo sapiens
Treatment: shALKBH5 CAG cells Control: shNC CAG cells		GSE180214
Regulation		logFC: -1.90E+00 p-value: 1.35E-05
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Expression of CDKN1A (p21) was significantly up-regulated in ALKBH5-depleted cells, and m6 A modification and stability of Cyclin-dependent kinase inhibitor 1 (CDKN1A) mRNA were increased by ALKBH5 knockdown. Identify ALKBH5 as the first m6 A demethylase that accelerates cell cycle progression and promotes cell proliferation of ESCC cells, which is associated with poor prognosis of esophageal squamous cell carcinoma patients.
Target Regulation	Down regulation
Responsed Disease	Esophageal squamous cell carcinoma		ICD-11: 2B70.1	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle
Cell Process	Cell apoptosis
In-vitro Model	OE21	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_2661
	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
	TE-5	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1764
	TE-9	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1767
In-vivo Model	The OE21 cells were stably transfected with sh-ALKBH5 (#1), sh-ALKBH5 (#2) or sh-scramble as negative control and injected (2 × 10⁶ cells/mouse in 100 uL volume) subcutaneously into the back of male athymic BALB/c nude mice (6 weeks old, Japan SLC).
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	The expression of Cyclin-dependent kinase inhibitor 1 (CDKN1A) or TIMP3 was increased by ALKBH5 knockdown. In conclusions, the ALKBH5-IGF2BPs axis promotes cell proliferation and tumorigenicity, which in turn causes the unfavorable prognosis of NSCLC.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Arrest cell cycle at G1 phase
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H2087	Lung adenocarcinoma	Homo sapiens	CVCL_1524
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	ABC-1	Lung adenocarcinoma	Homo sapiens	CVCL_1066
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	HEK293	Normal	Homo sapiens	CVCL_0045
	PC-3 [Human lung carcinoma]	Lung adenocarcinoma	Homo sapiens	CVCL_S982
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
	RERF-LC-MS	Lung adenocarcinoma	Homo sapiens	CVCL_1655
	HLC-1	Lung adenocarcinoma	Homo sapiens	CVCL_5529
	LC-2/ad	Lung adenocarcinoma	Homo sapiens	CVCL_1373

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[12]
Response Summary	Knockdown of YTHDC2 substantially promoted the proliferation rate of esophageal squamous cell carcinoma cells by affecting several cancer-related signaling pathways.
Target Regulation	Up regulation
Responsed Disease	Esophageal squamous cell carcinoma		ICD-11: 2B70.1	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
	NF-kappa B signaling pathway			hsa04064
	JAK-STAT signaling pathway			hsa04630
Cell Process	Genetic variants
In-vitro Model	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	KYSE-30	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1351

Acute myeloid leukaemia [ICD-11: 2A60]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/p53 signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/Cyclin-dependent kinase inhibitor 1 (CDKN1A)), and downregulation of mdm2.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	p53 signaling pathway			hsa04115
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell apoptosis
Cell Process	Cells in G7/M phase decreased
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	MOLT-4	Adult T acute lymphoblastic leukemia	Homo sapiens	CVCL_0013
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEL	Erythroleukemia	Homo sapiens	CVCL_0001
	CCRF-CEM C7	T acute lymphoblastic leukemia	Homo sapiens	CVCL_6825
	HEK293T	Normal	Homo sapiens	CVCL_0063
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 play an oncogenic role in acute myeloid leukemia(AML) by targeting mdm2/p53 signal pathway. The knockdown of METTL3 and METTL14 in K562 cell line leads to several changes in the expression of p53 signal pathway, including the upregulation of p53, cyclin dependent kinase inhibitor 1A (CDKN1A/Cyclin-dependent kinase inhibitor 1 (CDKN1A)), and downregulation of mdm2.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	p53 signaling pathway			hsa04115
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell apoptosis
Cell Process	Cells in G4/M phase decreased
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	NB4	Acute promyelocytic leukemia	Homo sapiens	CVCL_0005
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	MOLT-4	Adult T acute lymphoblastic leukemia	Homo sapiens	CVCL_0013
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEL	Erythroleukemia	Homo sapiens	CVCL_0001
	CCRF-CEM C7	T acute lymphoblastic leukemia	Homo sapiens	CVCL_6825
	HEK293T	Normal	Homo sapiens	CVCL_0063

Esophageal cancer [ICD-11: 2B70]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	The elevated FTO in esophageal squamous cell carcinoma decreased m6A methylation of LINC00022 transcript, leading to the inhibition of LINC00022 decay via the m6A reader YTHDF2. LINC00022 directly binds to Cyclin-dependent kinase inhibitor 1 (CDKN1A) protein and promotes its ubiquitination-mediated degradation, thereby facilitating cell-cycle progression and proliferation.
Responsed Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.1]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	Cell cycle			hsa04110
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Ubiquitination degradation
	Cell apoptosis
	Decreased G0/G1 phase
In-vitro Model	HET-1A	Normal	Homo sapiens	CVCL_3702
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	KYSE-450	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1353
	KYSE-70	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1356
	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
In-vivo Model	The number of cells inoculated in each mouse was 4 × 10⁶, 1 × 10⁶, 2 × 10⁶ and 1 × 10⁶, respectively.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 modulates the cell cycle of Esophageal squamous cell carcinoma(ESCC) cells through a Cyclin-dependent kinase inhibitor 1 (CDKN1A)-dependent pattern. METTL3-guided m6A modification contributes to the progression of ESCC via the p21-axis.
Responsed Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.1]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Arrest cell cycle at G2/M phase
In-vitro Model	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
In-vivo Model	Totally 5 × 10⁶ ESCC cells after treatment were administered to randomized animals by the subcutaneous route (right flank) in 200 uL DMEM. Tumor measurement was performed every other day. At study end (at least 3 weeks), the animals underwent euthanasia, and the tumors were extracted for histology.
Experiment 3 Reporting the m6A-centered Disease Response				[5]
Response Summary	Expression of CDKN1A (p21) was significantly up-regulated in ALKBH5-depleted cells, and m6 A modification and stability of Cyclin-dependent kinase inhibitor 1 (CDKN1A) mRNA were increased by ALKBH5 knockdown. Identify ALKBH5 as the first m6 A demethylase that accelerates cell cycle progression and promotes cell proliferation of ESCC cells, which is associated with poor prognosis of esophageal squamous cell carcinoma patients.
Responsed Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.1]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle
	Cell apoptosis
In-vitro Model	OE21	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_2661
	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
	TE-5	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1764
	TE-9	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1767
In-vivo Model	The OE21 cells were stably transfected with sh-ALKBH5 (#1), sh-ALKBH5 (#2) or sh-scramble as negative control and injected (2 × 10⁶ cells/mouse in 100 uL volume) subcutaneously into the back of male athymic BALB/c nude mice (6 weeks old, Japan SLC).
Experiment 4 Reporting the m6A-centered Disease Response				[12]
Response Summary	Knockdown of YTHDC2 substantially promoted the proliferation rate of esophageal squamous cell carcinoma cells by affecting several cancer-related signaling pathways.
Responsed Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.1]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	p53 signaling pathway			hsa04115
	NF-kappa B signaling pathway			hsa04064
	JAK-STAT signaling pathway			hsa04630
Cell Process	Genetic variants
In-vitro Model	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	KYSE-30	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1351

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	In lung squamous cell carcinoma, seven m6A-related autophagy genes were screened to construct a prognostic model: CASP4, Cyclin-dependent kinase inhibitor 1 (CDKN1A), DLC1, ITGB1, PINK1, TP63, and EIF4EBP1.
Responsed Disease	Lung squamous cell carcinoma [ICD-11: 2C25.2]
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation and metastasis
Cell Process	Cell autophagy
Experiment 2 Reporting the m6A-centered Disease Response				[6]
Response Summary	The expression of Cyclin-dependent kinase inhibitor 1 (CDKN1A) or TIMP3 was increased by ALKBH5 knockdown. In conclusions, the ALKBH5-IGF2BPs axis promotes cell proliferation and tumorigenicity, which in turn causes the unfavorable prognosis of NSCLC.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Arrest cell cycle at G1 phase
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H2087	Lung adenocarcinoma	Homo sapiens	CVCL_1524
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	ABC-1	Lung adenocarcinoma	Homo sapiens	CVCL_1066
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	HEK293	Normal	Homo sapiens	CVCL_0045
	PC-3 [Human lung carcinoma]	Lung adenocarcinoma	Homo sapiens	CVCL_S982
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
	RERF-LC-MS	Lung adenocarcinoma	Homo sapiens	CVCL_1655
	HLC-1	Lung adenocarcinoma	Homo sapiens	CVCL_5529
	LC-2/ad	Lung adenocarcinoma	Homo sapiens	CVCL_1373

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 is able to promote breast cancer cell proliferation by regulating the Cyclin-dependent kinase inhibitor 1 (CDKN1A) expression by an m6A-dependent manner. Metformin can take p21 as the main target to inhibit such effect.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	SUM1315MO2	Invasive breast carcinoma of no special type	Homo sapiens	CVCL_5589
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HBL-100	Normal	Homo sapiens	CVCL_4362
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
In-vivo Model	About 1 × 10⁷ stable METTL3 overexpression and negative control SUM-1315 cells were injected subcutaneously into the axilla of the female BALB/C nude mice (4-6 weeks old, 18-20 g, 10 mice/group). One week after injection, the two groups, METTL3 OE and NC, were then randomly allocated into the control group and experimental group (5 mice/group), which were treated with PBS or metformin (250 mg/kg/dose, respectively). PBS or metformin was administered every 2 days via intraperitoneal injection.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00001		Crosstalk Info
Epigenetic Regulator	RNA cytosine C(5)-methyltransferase NSUN2 (NSUN2)
Regulated Target	Cyclin-dependent kinase inhibitor 1 (CDKN1A)
Crosstalk relationship	m5C → m6A

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00002		Crosstalk Info
Epigenetic Regulator	RNA cytosine C(5)-methyltransferase NSUN2 (NSUN2)
Regulated Target	Cyclin-dependent kinase inhibitor 1 (CDKN1A)
Crosstalk relationship	m5C → m6A

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03372		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Esophageal Squamous Cell Carcinoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00213)

Cyclin-dependent kinase inhibitor 1 (CDKN1A)

Adenosine-to-Inosine editing (A-to-I)

In total 6 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001436		Click to Show/Hide the Full List
mod site	chr6:36682188-36682189:+		[13]
Sequence	CTTATGAACTGTGTGATGTTAGGCAAGTTACTTAACTTATC
Transcript ID List	ENST00000405375.5; ENST00000459970.1; ENST00000615513.4; ENST00000244741.9; ENST00000373711.3; ENST00000448526.6; ENST00000478800.1; rmsk_1919667
External Link	RMBase: RNA-editing_site_115776
mod ID: A2ISITE001437		Click to Show/Hide the Full List
mod site	chr6:36682197-36682198:+		[13]
Sequence	TGTGTGATGTTAGGCAAGTTACTTAACTTATCTGAGCCTTG
Transcript ID List	ENST00000615513.4; ENST00000244741.9; ENST00000448526.6; ENST00000459970.1; rmsk_1919667; ENST00000373711.3; ENST00000478800.1; ENST00000405375.5
External Link	RMBase: RNA-editing_site_115777
mod ID: A2ISITE001438		Click to Show/Hide the Full List
mod site	chr6:36682206-36682207:+		[13]
Sequence	TTAGGCAAGTTACTTAACTTATCTGAGCCTTGGTTGCCTCT
Transcript ID List	ENST00000448526.6; ENST00000478800.1; ENST00000459970.1; ENST00000244741.9; ENST00000405375.5; ENST00000615513.4; ENST00000373711.3; rmsk_1919667
External Link	RMBase: RNA-editing_site_115778
mod ID: A2ISITE001439		Click to Show/Hide the Full List
mod site	chr6:36683265-36683266:+		[13]
Sequence	GAGGAAACTAGAGCTCAGACAAGTTAAGTTGCTTGCCCAGG
Transcript ID List	ENST00000373711.3; ENST00000405375.5; ENST00000615513.4; ENST00000478800.1; ENST00000459970.1; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: RNA-editing_site_115779
mod ID: A2ISITE001440		Click to Show/Hide the Full List
mod site	chr6:36683266-36683267:+		[13]
Sequence	AGGAAACTAGAGCTCAGACAAGTTAAGTTGCTTGCCCAGGG
Transcript ID List	ENST00000478800.1; ENST00000459970.1; ENST00000615513.4; ENST00000448526.6; ENST00000244741.9; ENST00000373711.3; ENST00000405375.5
External Link	RMBase: RNA-editing_site_115780
mod ID: A2ISITE001441		Click to Show/Hide the Full List
mod site	chr6:36684876-36684877:+		[13]
Sequence	GTCTTAACTCTGTTGGCCAGACTGGAGTGCAGTGATACGAT
Transcript ID List	ENST00000448526.6; ENST00000373711.3; ENST00000615513.4; ENST00000405375.5; ENST00000244741.9
External Link	RMBase: RNA-editing_site_115781

N6-methyladenosine (m6A)

In total 46 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074863		Click to Show/Hide the Full List
mod site	chr6:36676546-36676547:+		[14]
Sequence	GAGGAAGGGGATGGTAGGAGACAGGAGACCTCTAAAGACCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000448526.6; ENST00000615513.4; ENST00000459970.1
External Link	RMBase: m6A_site_715130
mod ID: M6ASITE074864		Click to Show/Hide the Full List
mod site	chr6:36676553-36676554:+		[14]
Sequence	GGGATGGTAGGAGACAGGAGACCTCTAAAGACCCCAGGTAA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000459970.1; ENST00000615513.4; ENST00000448526.6
External Link	RMBase: m6A_site_715131
mod ID: M6ASITE074865		Click to Show/Hide the Full List
mod site	chr6:36676563-36676564:+		[14]
Sequence	GAGACAGGAGACCTCTAAAGACCCCAGGTAAACCTTAGCCT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000615513.4; ENST00000448526.6; ENST00000459970.1
External Link	RMBase: m6A_site_715132
mod ID: M6ASITE074866		Click to Show/Hide the Full List
mod site	chr6:36677795-36677796:+		[14]
Sequence	GATCTGAGTTAGGTCACCAGACTTCTCTGAGCCCCAGTTTC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000459970.1; rmsk_1919658; ENST00000448526.6; ENST00000615513.4
External Link	RMBase: m6A_site_715133
mod ID: M6ASITE074867		Click to Show/Hide the Full List
mod site	chr6:36677856-36677857:+		[14]
Sequence	ATGTGGGGAGTATTCAGGAGACAGACAACTCACTCGTCAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000448526.6; ENST00000459970.1; ENST00000615513.4
External Link	RMBase: m6A_site_715134
mod ID: M6ASITE074868		Click to Show/Hide the Full List
mod site	chr6:36678816-36678817:+		[14]
Sequence	AGGTGAGAGAGCGGCGGCAGACAACAGGGGACCCCGGGCCG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; MT4; CD4T; peripheral-blood; GSC-11; HEK293T; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000478800.1; ENST00000459970.1; ENST00000615513.4; ENST00000373711.3; ENST00000405375.5; ENST00000462537.3; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: m6A_site_715135
mod ID: M6ASITE074869		Click to Show/Hide the Full List
mod site	chr6:36678826-36678827:+		[14]
Sequence	GCGGCGGCAGACAACAGGGGACCCCGGGCCGGCGGCCCAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; MT4; CD4T; peripheral-blood; GSC-11; HEK293T; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615513.4; ENST00000478800.1; ENST00000373711.3; ENST00000459970.1; ENST00000462537.3; ENST00000405375.5; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: m6A_site_715136
mod ID: M6ASITE074870		Click to Show/Hide the Full List
mod site	chr6:36680530-36680531:+		[14]
Sequence	CGAGCAGCGCCTTGCAGGAAACTGACTCATCACTACTCCCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000615513.4; ENST00000405375.5; ENST00000244741.9; ENST00000459970.1; ENST00000462537.3; ENST00000373711.3; ENST00000448526.6; ENST00000478800.1
External Link	RMBase: m6A_site_715137
mod ID: M6ASITE074871		Click to Show/Hide the Full List
mod site	chr6:36684109-36684110:+		[14]
Sequence	GCTGCAGGCGCCATGTCAGAACCGGCTGGGGATGTCCGTCA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; MT4; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615513.4; ENST00000459970.1; ENST00000448526.6; ENST00000405375.5; ENST00000373711.3; ENST00000244741.9; ENST00000478800.1
External Link	RMBase: m6A_site_715138
mod ID: M6ASITE074872		Click to Show/Hide the Full List
mod site	chr6:36684132-36684133:+		[14]
Sequence	GGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; MT4; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000373711.3; ENST00000478800.1; ENST00000459970.1; ENST00000615513.4; ENST00000448526.6; ENST00000405375.5; ENST00000244741.9
External Link	RMBase: m6A_site_715139
mod ID: M6ASITE074873		Click to Show/Hide the Full List
mod site	chr6:36684177-36684178:+		[14]
Sequence	CCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; MT4; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244741.9; ENST00000373711.3; ENST00000459970.1; ENST00000478800.1; ENST00000615513.4; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715140
mod ID: M6ASITE074874		Click to Show/Hide the Full List
mod site	chr6:36684249-36684250:+		[14]
Sequence	GGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; MT4; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000405375.5; ENST00000459970.1; ENST00000478800.1; ENST00000448526.6; ENST00000373711.3
External Link	RMBase: m6A_site_715141
mod ID: M6ASITE074875		Click to Show/Hide the Full List
mod site	chr6:36684269-36684270:+		[14]
Sequence	ACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; MT4; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000478800.1; ENST00000448526.6; ENST00000615513.4; ENST00000459970.1; ENST00000405375.5; ENST00000373711.3; ENST00000244741.9
External Link	RMBase: m6A_site_715142
mod ID: M6ASITE074876		Click to Show/Hide the Full List
mod site	chr6:36684285-36684286:+		[15]
Sequence	CGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGC
Motif Score	3.28175
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000615513.4; ENST00000478800.1; ENST00000373711.3; ENST00000459970.1; ENST00000448526.6; ENST00000405375.5; ENST00000244741.9
External Link	RMBase: m6A_site_715143
mod ID: M6ASITE074877		Click to Show/Hide the Full List
mod site	chr6:36684413-36684414:+		[14]
Sequence	CACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405375.5; ENST00000373711.3; ENST00000615513.4; ENST00000459970.1; ENST00000448526.6; ENST00000244741.9; ENST00000478800.1
External Link	RMBase: m6A_site_715144
mod ID: M6ASITE074878		Click to Show/Hide the Full List
mod site	chr6:36684426-36684427:+		[14]
Sequence	GCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000448526.6; ENST00000405375.5; ENST00000478800.1; ENST00000244741.9; ENST00000615513.4; ENST00000373711.3; ENST00000459970.1
External Link	RMBase: m6A_site_715145
mod ID: M6ASITE074879		Click to Show/Hide the Full List
mod site	chr6:36684435-36684436:+		[14]
Sequence	AGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; TIME; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000373711.3; ENST00000244741.9; ENST00000615513.4; ENST00000478800.1; ENST00000459970.1; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715146
mod ID: M6ASITE074880		Click to Show/Hide the Full List
mod site	chr6:36684499-36684500:+		[14]
Sequence	GCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000244741.9; ENST00000459970.1; ENST00000405375.5; ENST00000373711.3; ENST00000615513.4; ENST00000448526.6
External Link	RMBase: m6A_site_715147
mod ID: M6ASITE074881		Click to Show/Hide the Full List
mod site	chr6:36684507-36684508:+		[14]
Sequence	GTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615513.4; ENST00000448526.6; ENST00000405375.5; ENST00000459970.1; ENST00000373711.3; ENST00000244741.9
External Link	RMBase: m6A_site_715148
mod ID: M6ASITE074882		Click to Show/Hide the Full List
mod site	chr6:36684533-36684534:+		[14]
Sequence	AGGGTCGAAAACGGCGGCAGACCAGCATGACAGGTGCGGAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; A549; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405375.5; ENST00000448526.6; ENST00000244741.9; ENST00000373711.3; ENST00000615513.4
External Link	RMBase: m6A_site_715149
mod ID: M6ASITE074883		Click to Show/Hide the Full List
mod site	chr6:36685856-36685857:+		[16]
Sequence	GGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000615513.4; ENST00000244741.9; ENST00000405375.5; ENST00000373711.3; ENST00000448526.6
External Link	RMBase: m6A_site_715150
mod ID: M6ASITE074884		Click to Show/Hide the Full List
mod site	chr6:36685915-36685916:+		[17]
Sequence	TTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000405375.5; ENST00000448526.6; ENST00000615513.4; ENST00000373711.3; ENST00000244741.9
External Link	RMBase: m6A_site_715151
mod ID: M6ASITE074885		Click to Show/Hide the Full List
mod site	chr6:36685929-36685930:+		[17]
Sequence	ATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTG
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000615513.4; ENST00000448526.6; ENST00000244741.9; ENST00000405375.5
External Link	RMBase: m6A_site_715152
mod ID: M6ASITE074886		Click to Show/Hide the Full List
mod site	chr6:36685981-36685982:+		[14]
Sequence	CTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000244741.9; ENST00000405375.5; ENST00000615513.4; ENST00000448526.6
External Link	RMBase: m6A_site_715153
mod ID: M6ASITE074887		Click to Show/Hide the Full List
mod site	chr6:36685987-36685988:+		[14]
Sequence	TTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000405375.5; ENST00000448526.6; ENST00000615513.4; ENST00000244741.9
External Link	RMBase: m6A_site_715154
mod ID: M6ASITE074888		Click to Show/Hide the Full List
mod site	chr6:36686044-36686045:+		[17]
Sequence	GCATTTTTATTTTATGAAATACTATTTAAAGCCTCCTCATC
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000448526.6; ENST00000244741.9; ENST00000405375.5; ENST00000615513.4
External Link	RMBase: m6A_site_715155
mod ID: M6ASITE074889		Click to Show/Hide the Full List
mod site	chr6:36686153-36686154:+		[17]
Sequence	CCACTTGTCCGCTGGGTGGTACCCTCTGGAGGGGTGTGGCT
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000615513.4; ENST00000244741.9; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715156
mod ID: M6ASITE074890		Click to Show/Hide the Full List
mod site	chr6:36686190-36686191:+		[17]
Sequence	GGCTCCTTCCCATCGCTGTCACAGGCGGTTATGAAATTCAC
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000448526.6; ENST00000405375.5
External Link	RMBase: m6A_site_715157
mod ID: M6ASITE074891		Click to Show/Hide the Full List
mod site	chr6:36686260-36686261:+		[17]
Sequence	CTTTTTCATTTGAGAAGTAAACAGATGGCACTTTGAAGGGG
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715158
mod ID: M6ASITE074892		Click to Show/Hide the Full List
mod site	chr6:36686269-36686270:+		[17]
Sequence	TTGAGAAGTAAACAGATGGCACTTTGAAGGGGCCTCACCGA
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715159
mod ID: M6ASITE074893		Click to Show/Hide the Full List
mod site	chr6:36686308-36686309:+		[14]
Sequence	GAGTGGGGGCATCATCAAAAACTTTGGAGTCCCCTCACCTC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000615513.4; ENST00000448526.6; ENST00000405375.5; ENST00000244741.9
External Link	RMBase: m6A_site_715160
mod ID: M6ASITE074894		Click to Show/Hide the Full List
mod site	chr6:36686385-36686386:+		[14]
Sequence	AGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGCTCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000448526.6; ENST00000405375.5; ENST00000244741.9; ENST00000615513.4
External Link	RMBase: m6A_site_715161
mod ID: M6ASITE074895		Click to Show/Hide the Full List
mod site	chr6:36686459-36686460:+		[14]
Sequence	AAGGTGGGGTCCTGGAGCAGACCACCCCGCCTGCCCTCATG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405375.5; ENST00000244741.9; ENST00000615513.4; ENST00000448526.6
External Link	RMBase: m6A_site_715162
mod ID: M6ASITE074896		Click to Show/Hide the Full List
mod site	chr6:36686699-36686700:+		[18]
Sequence	CCCCACCCCCAGCTCAATGGACTGGAAGGGGAAGGGACACA
Motif Score	4.065041667
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000405375.5; ENST00000615513.4; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: m6A_site_715163
mod ID: M6ASITE074897		Click to Show/Hide the Full List
mod site	chr6:36686715-36686716:+		[18]
Sequence	ATGGACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACC
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000405375.5; ENST00000448526.6
External Link	RMBase: m6A_site_715164
mod ID: M6ASITE074898		Click to Show/Hide the Full List
mod site	chr6:36686719-36686720:+		[16]
Sequence	ACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACCCTAG
Motif Score	2.084928571
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000448526.6; ENST00000244741.9; ENST00000615513.4; ENST00000405375.5
External Link	RMBase: m6A_site_715165
mod ID: M6ASITE074899		Click to Show/Hide the Full List
mod site	chr6:36686885-36686886:+		[17]
Sequence	TAGATCTTTCTAGGAGGGAGACACTGGCCCCTCAAATCGTC
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000405375.5; ENST00000244741.9; ENST00000448526.6; ENST00000615513.4
External Link	RMBase: m6A_site_715166
mod ID: M6ASITE074900		Click to Show/Hide the Full List
mod site	chr6:36686949-36686950:+		[17]
Sequence	ATCCCTCCCCAGTTCATTGCACTTTGATTAGCAGCGGAACA
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000244741.9; ENST00000615513.4; ENST00000448526.6; ENST00000405375.5
External Link	RMBase: m6A_site_715167
mod ID: M6ASITE074901		Click to Show/Hide the Full List
mod site	chr6:36686967-36686968:+		[16]
Sequence	GCACTTTGATTAGCAGCGGAACAAGGAGTCAGACATTTTAA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000615513.4; ENST00000405375.5; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: m6A_site_715168
mod ID: M6ASITE074902		Click to Show/Hide the Full List
mod site	chr6:36687132-36687133:+		[16]
Sequence	GTATTGGGGTCTGACCCCAAACACCTTCCAGCTCCTGTAAC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; HeLa; peripheral-blood
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000405375.5; ENST00000244741.9; ENST00000448526.6; ENST00000615513.4
External Link	RMBase: m6A_site_715169
mod ID: M6ASITE074903		Click to Show/Hide the Full List
mod site	chr6:36687151-36687152:+		[16]
Sequence	AACACCTTCCAGCTCCTGTAACATACTGGCCTGGACTGTTT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000244741.9; ENST00000405375.5; ENST00000448526.6; ENST00000615513.4
External Link	RMBase: m6A_site_715170
mod ID: M6ASITE074904		Click to Show/Hide the Full List
mod site	chr6:36687165-36687166:+		[19]
Sequence	CCTGTAACATACTGGCCTGGACTGTTTTCTCTCGGCTCCCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000615513.4; ENST00000405375.5; ENST00000448526.6; ENST00000244741.9
External Link	RMBase: m6A_site_715171
mod ID: M6ASITE074905		Click to Show/Hide the Full List
mod site	chr6:36687216-36687217:+		[19]
Sequence	GTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000244741.9; rmsk_1919675; ENST00000448526.6; ENST00000615513.4; ENST00000405375.5
External Link	RMBase: m6A_site_715172
mod ID: M6ASITE074906		Click to Show/Hide the Full List
mod site	chr6:36687223-36687224:+		[14]
Sequence	TTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGGACCA
Motif Score	2.185083333
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000448526.6; rmsk_1919675; ENST00000615513.4; ENST00000405375.5; ENST00000244741.9
External Link	RMBase: m6A_site_715173
mod ID: M6ASITE074907		Click to Show/Hide the Full List
mod site	chr6:36687240-36687241:+		[14]
Sequence	TAAACCTCTCGAGGGCAGGGACCACACCCTGTACTGTTCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000615513.4; ENST00000405375.5; ENST00000448526.6; ENST00000244741.9; rmsk_1919675
External Link	RMBase: m6A_site_715174
mod ID: M6ASITE074908		Click to Show/Hide the Full List
mod site	chr6:36687243-36687244:+		[16]
Sequence	ACCTCTCGAGGGCAGGGACCACACCCTGTACTGTTCTGTGT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	rmsk_1919675; ENST00000405375.5; ENST00000615513.4; ENST00000244741.9; ENST00000448526.6
External Link	RMBase: m6A_site_715175

Ref 1	The m(6)A RNA methyltransferase METTL3/METTL14 promotes leukemogenesis through the mdm2/p53 pathway in acute myeloid leukemia. J Cancer. 2022 Jan 4;13(3):1019-1030. doi: 10.7150/jca.60381. eCollection 2022.
Ref 2	The M6A methyltransferase METTL3 regulates proliferation in esophageal squamous cell carcinoma. Biochem Biophys Res Commun. 2021 Nov 26;580:48-55. doi: 10.1016/j.bbrc.2021.05.048. Epub 2021 Oct 5.
Ref 3	Metformin exhibits antiproliferation activity in breast cancer via miR-483-3p/METTL3/m(6)A/p21 pathway. Oncogenesis. 2021 Jan 5;10(1):7. doi: 10.1038/s41389-020-00290-y.
Ref 4	RNA m6A demethylase FTO-mediated epigenetic up-regulation of LINC00022 promotes tumorigenesis in esophageal squamous cell carcinoma. J Exp Clin Cancer Res. 2021 Sep 20;40(1):294. doi: 10.1186/s13046-021-02096-1.
Ref 5	m(6) A demethylase ALKBH5 promotes proliferation of esophageal squamous cell carcinoma associated with poor prognosis. Genes Cells. 2020 Aug;25(8):547-561. doi: 10.1111/gtc.12792. Epub 2020 Jul 1.
Ref 6	m(6)A demethylase ALKBH5 promotes tumor cell proliferation by destabilizing IGF2BPs target genes and worsens the prognosis of patients with non-small-cell lung cancer. Cancer Gene Ther. 2022 Mar 22. doi: 10.1038/s41417-022-00451-8. Online ahead of print.
Ref 7	Effects of the ABCG2 and ABCB1 drug transporter polymorphisms on the pharmacokinetics of bicalutamide in humans. Clin Chim Acta. 2015 Jan 1;438:7-11. doi: 10.1016/j.cca.2014.08.006. Epub 2014 Aug 11.
Ref 8	Structural determinants of P-glycoprotein-mediated transport of glucocorticoids. Pharm Res. 2003 Nov;20(11):1794-803. doi: 10.1023/b:pham.0000003377.39548.f6.
Ref 9	Selective inhibition of matrix metalloproteinase isozymes and in vivo protection against emphysema by substituted gamma-keto carboxylic acids. J Med Chem. 2006 Jan 26;49(2):456-8. doi: 10.1021/jm051101g.
Ref 10	O-arylmandelic acids as highly selective human PPAR alpha/gamma agonists. Bioorg Med Chem Lett. 2003 Oct 6;13(19):3185-90. doi: 10.1016/s0960-894x(03)00702-9.
Ref 11	Cytochrome P450 isozymes responsible for the metabolism of toluene and styrene in human liver microsomes. Xenobiotica. 1997 Jul;27(7):657-65. doi: 10.1080/004982597240253.
Ref 12	Genetic variants in m6A modification genes are associated with esophageal squamous-cell carcinoma in the Chinese population. Carcinogenesis. 2020 Jul 10;41(6):761-768. doi: 10.1093/carcin/bgaa012.
Ref 13	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 14	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 15	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 16	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 17	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 18	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 19	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map