m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00211)

Target Name	Cyclin-dependent kinase 4 (CDK4)
Synonyms	Cell division protein kinase 4; PSK-J3 Click to Show/Hide
Gene Name	CDK4
Chromosomal Location	12q14.1
Family	protein kinase superfamily; CMGC Ser/Thr protein kinase family; CDC2/CDKX subfamily
Function	Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also phosphorylates SMAD3 in a cell-cycle-dependent manner and represses its transcriptional activity. Component of the ternary complex, cyclin D/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex. Click to Show/Hide
Gene ID	1019
Uniprot ID	CDK4_HUMAN
HGNC ID	HGNC:1773
KEGG ID	hsa:1019

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CDK4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	PANC-1 cell line	Homo sapiens
Treatment: siIGF2BP1 PANC-1 cells Control: siControl PANC-1 cells		GSE161087
Regulation		logFC: -1.19E+00 p-value: 3.49E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, Cyclin-dependent kinase 4 (CDK4), EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	DMDRMR is a protumorigenic lncRNA that mediates the stabilization of IGF2BP3 targets in an m6A-dependent manner in clear cell renal cell carcinoma. IGF2BP3 and DMDRMR cooperate to play oncogenic roles. IGF2BP3 cooperates with DMDRMR to regulate Cyclin-dependent kinase 4 (CDK4) by enhancing mRNA stability.
Target Regulation	Up regulation
Responsed Disease	Renal cell carcinoma of kidney		ICD-11: 2C90.0	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Accelerating the G1-S transition
Cell Process	Cell invasion and metastasis
In-vitro Model	769-P	Renal cell carcinoma	Homo sapiens	CVCL_1050
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
In-vivo Model	Stable DMDRMR knockdown (KD) and control cell lines were injected subcutaneously (s.c.; 1 × 10⁷ cells/inoculum) into the flanks of recipient NOD/SCID/IL2Rγ-null (NSG) mice.

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, Cyclin-dependent kinase 4 (CDK4), EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, Cyclin-dependent kinase 4 (CDK4), p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, Cyclin-dependent kinase 4 (CDK4), EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, Cyclin-dependent kinase 4 (CDK4), EGR2, YBX1, and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Protein virilizer homolog (VIRMA)		WRITER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630
Experiment 3 Reporting the m6A-centered Disease Response				[7]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, Cyclin-dependent kinase 4 (CDK4), p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	DMDRMR is a protumorigenic lncRNA that mediates the stabilization of IGF2BP3 targets in an m6A-dependent manner in clear cell renal cell carcinoma. IGF2BP3 and DMDRMR cooperate to play oncogenic roles. IGF2BP3 cooperates with DMDRMR to regulate Cyclin-dependent kinase 4 (CDK4) by enhancing mRNA stability.
Responsed Disease	Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Accelerating the G1-S transition
Cell Process	Cell invasion and metastasis
In-vitro Model	769-P	Renal cell carcinoma	Homo sapiens	CVCL_1050
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
In-vivo Model	Stable DMDRMR knockdown (KD) and control cell lines were injected subcutaneously (s.c.; 1 × 10⁷ cells/inoculum) into the flanks of recipient NOD/SCID/IL2Rγ-null (NSG) mice.

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[7]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, Cyclin-dependent kinase 4 (CDK4), p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: ELAV-like protein 1 (ELAVL1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05003		Crosstalk Info
Epigenetic Regulator	VPS9D1 antisense RNA 1 (VPS9D1-AS1)
Regulated Target	ELAV-like protein 1 (HuR/ELAVL1)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00211)

Cyclin-dependent kinase 4 (CDK4)

2'-O-Methylation (2'-O-Me)

In total 2 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000070		Click to Show/Hide the Full List
mod site	chr12:57749474-57749475:-		[8]
Sequence	CTGTGGAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000549606.5; ENST00000553237.5; ENST00000547281.5; ENST00000552713.5; ENST00000551888.5; ENST00000546489.5; ENST00000550419.5; ENST00000257904.11; ENST00000312990.10
External Link	RMBase: Nm_site_1394
mod ID: 2OMSITE000071		Click to Show/Hide the Full List
mod site	chr12:57752252-57752253:-		[8]
Sequence	CCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGGCCGTAGG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000312990.10; ENST00000551888.5; ENST00000552862.1; ENST00000257904.11; ENST00000546489.5; ENST00000547281.5; ENST00000549606.5; ENST00000550419.5; ENST00000551800.5; ENST00000552388.1; ENST00000553237.5; ENST00000551706.1
External Link	RMBase: Nm_site_1395

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000069		Click to Show/Hide the Full List
mod site	chr12:57748481-57748482:-		[9]
Sequence	AGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000257904.11; ENST00000549606.5; ENST00000552713.5; ENST00000312990.10
External Link	RMBase: m5C_site_10551

N6-methyladenosine (m6A)

In total 37 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013647		Click to Show/Hide the Full List
mod site	chr12:57748071-57748072:-		[10]
Sequence	CTGACAAAGCTTAGAAAGGAACTGAAATTGCTTCTTTGAAT
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195736
mod ID: M6ASITE013648		Click to Show/Hide the Full List
mod site	chr12:57748135-57748136:-		[11]
Sequence	TTTCCTGCAAAACCTTAAAGACTGGTTAAATTACAGGGCCT
Motif Score	3.319380952
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195737
mod ID: M6ASITE013649		Click to Show/Hide the Full List
mod site	chr12:57748144-57748145:-		[12]
Sequence	AGAAGGGACTTTCCTGCAAAACCTTAAAGACTGGTTAAATT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195738
mod ID: M6ASITE013650		Click to Show/Hide the Full List
mod site	chr12:57748157-57748158:-		[12]
Sequence	AAAACCACTTGGAAGAAGGGACTTTCCTGCAAAACCTTAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195739
mod ID: M6ASITE013651		Click to Show/Hide the Full List
mod site	chr12:57748174-57748175:-		[12]
Sequence	CCATTGTGCGATTTGGAAAAACCACTTGGAAGAAGGGACTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195740
mod ID: M6ASITE013652		Click to Show/Hide the Full List
mod site	chr12:57748251-57748252:-		[13]
Sequence	TTTTATACAGGAAAAACAAAACAAAGAAATAATGGTCTTTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195745
mod ID: M6ASITE013653		Click to Show/Hide the Full List
mod site	chr12:57748256-57748257:-		[14]
Sequence	TCCTTTTTTATACAGGAAAAACAAAACAAAGAAATAATGGT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T; HeLa; AML
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq; miCLIP
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195746
mod ID: M6ASITE013654		Click to Show/Hide the Full List
mod site	chr12:57748265-57748266:-		[13]
Sequence	TATTTGGGGTCCTTTTTTATACAGGAAAAACAAAACAAAGA
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195747
mod ID: M6ASITE013655		Click to Show/Hide the Full List
mod site	chr12:57748326-57748327:-		[13]
Sequence	TCTCCTTCCCATTTCTCTACACTAAGGGGTATGTTCCCTCT
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195751
mod ID: M6ASITE013656		Click to Show/Hide the Full List
mod site	chr12:57748328-57748329:-		[13]
Sequence	CTTCTCCTTCCCATTTCTCTACACTAAGGGGTATGTTCCCT
Motif Score	2.078666667
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195752
mod ID: M6ASITE013657		Click to Show/Hide the Full List
mod site	chr12:57748383-57748384:-		[13]
Sequence	ATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T; AML
Seq Type List	DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000312990.10; ENST00000257904.11
External Link	RMBase: m6A_site_195753
mod ID: M6ASITE013658		Click to Show/Hide the Full List
mod site	chr12:57748400-57748401:-		[13]
Sequence	TCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACAT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10
External Link	RMBase: m6A_site_195754
mod ID: M6ASITE013659		Click to Show/Hide the Full List
mod site	chr12:57748472-57748473:-		[12]
Sequence	AGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; kidney; HEK293T; hESC-HEK293T; A549; AML
Seq Type List	m6A-seq; m6A-REF-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000549606.5; ENST00000312990.10; ENST00000552713.5; ENST00000257904.11
External Link	RMBase: m6A_site_195756
mod ID: M6ASITE013660		Click to Show/Hide the Full List
mod site	chr12:57748551-57748552:-		[14]
Sequence	GCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000257904.11; ENST00000552713.5; ENST00000553237.5; ENST00000312990.10; ENST00000549606.5
External Link	RMBase: m6A_site_195757
mod ID: M6ASITE013661		Click to Show/Hide the Full List
mod site	chr12:57748596-57748597:-		[14]
Sequence	GAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000257904.11; ENST00000312990.10; ENST00000553237.5; ENST00000549606.5; ENST00000546489.5; ENST00000552713.5
External Link	RMBase: m6A_site_195758
mod ID: M6ASITE013662		Click to Show/Hide the Full List
mod site	chr12:57748607-57748608:-		[13]
Sequence	TCTCCCCTCAGGAAATGCTGACTTTTAACCCACACAAGCGA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000312990.10; ENST00000552713.5; ENST00000549606.5; ENST00000546489.5; ENST00000553237.5; ENST00000257904.11
External Link	RMBase: m6A_site_195759
mod ID: M6ASITE013663		Click to Show/Hide the Full List
mod site	chr12:57749193-57749194:-		[15]
Sequence	GAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGTACTGGA
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000549606.5; ENST00000546489.5; ENST00000551888.5; ENST00000553237.5; ENST00000312990.10; ENST00000552713.5; ENST00000257904.11
External Link	RMBase: m6A_site_195762
mod ID: M6ASITE013664		Click to Show/Hide the Full List
mod site	chr12:57749290-57749291:-		[13]
Sequence	TGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000312990.10; ENST00000547281.5; ENST00000550419.5; ENST00000257904.11; ENST00000546489.5; ENST00000552713.5; ENST00000549606.5; ENST00000551888.5; ENST00000553237.5
External Link	RMBase: m6A_site_195763
mod ID: M6ASITE013665		Click to Show/Hide the Full List
mod site	chr12:57750700-57750701:-		[14]
Sequence	CACATATGCAACACCTGTGGACATGTGGAGTGTTGGCTGTA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000312990.10; ENST00000547281.5; ENST00000553237.5; ENST00000257904.11; ENST00000550419.5; ENST00000549606.5; ENST00000551888.5; ENST00000552254.5; ENST00000546489.5; ENST00000551800.5
External Link	RMBase: m6A_site_195766
mod ID: M6ASITE013666		Click to Show/Hide the Full List
mod site	chr12:57750710-57750711:-		[15]
Sequence	TTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGT
Motif Score	2.173910714
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000553237.5; ENST00000551800.5; ENST00000257904.11; ENST00000551888.5; ENST00000547281.5; ENST00000552254.5; ENST00000549606.5; ENST00000550419.5; ENST00000546489.5; ENST00000312990.10
External Link	RMBase: m6A_site_195767
mod ID: M6ASITE013667		Click to Show/Hide the Full List
mod site	chr12:57750987-57750988:-		[15]
Sequence	TTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTT
Motif Score	2.951386905
Cell/Tissue List	kidney; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000552388.1; ENST00000551706.1; ENST00000551800.5; ENST00000553237.5; ENST00000312990.10; ENST00000552254.5; ENST00000549606.5; ENST00000257904.11; ENST00000547281.5; ENST00000551888.5; ENST00000546489.5; ENST00000550419.5
External Link	RMBase: m6A_site_195768
mod ID: M6ASITE013668		Click to Show/Hide the Full List
mod site	chr12:57750999-57751000:-		[15]
Sequence	AGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAG
Motif Score	2.859755952
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000257904.11; ENST00000552388.1; ENST00000550419.5; ENST00000551888.5; ENST00000549606.5; ENST00000547281.5; ENST00000551800.5; ENST00000552254.5; ENST00000551706.1; ENST00000312990.10; ENST00000553237.5; ENST00000546489.5
External Link	RMBase: m6A_site_195769
mod ID: M6ASITE013669		Click to Show/Hide the Full List
mod site	chr12:57751010-57751011:-		[15]
Sequence	CCGAGATCTGAAGCCAGAGAACATTCTGGTGACAAGTGGTG
Motif Score	2.951386905
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000549606.5; ENST00000550419.5; ENST00000552388.1; ENST00000553237.5; ENST00000552254.5; ENST00000257904.11; ENST00000551800.5; ENST00000551706.1; ENST00000546489.5; ENST00000551888.5; ENST00000547281.5; ENST00000312990.10
External Link	RMBase: m6A_site_195770
mod ID: M6ASITE013670		Click to Show/Hide the Full List
mod site	chr12:57751246-57751247:-		[14]
Sequence	GGACCTAAGGACATATCTGGACAAGGCACCCCCACCAGGCT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; peripheral-blood; endometrial
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000553237.5; ENST00000257904.11; ENST00000551888.5; ENST00000552862.1; ENST00000552388.1; ENST00000550419.5; ENST00000547281.5; ENST00000549606.5; ENST00000552254.5; ENST00000546489.5; ENST00000551800.5; ENST00000551706.1; ENST00000312990.10
External Link	RMBase: m6A_site_195771
mod ID: M6ASITE013671		Click to Show/Hide the Full List
mod site	chr12:57751256-57751257:-		[13]
Sequence	ATGTAGACCAGGACCTAAGGACATATCTGGACAAGGCACCC
Motif Score	3.643047619
Cell/Tissue List	HEK293T; hESC-HEK293T; peripheral-blood; endometrial
Seq Type List	DART-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000546489.5; ENST00000312990.10; ENST00000551888.5; ENST00000551706.1; ENST00000552388.1; ENST00000549606.5; ENST00000552862.1; ENST00000547281.5; ENST00000257904.11; ENST00000550419.5; ENST00000553237.5; ENST00000551800.5; ENST00000552254.5
External Link	RMBase: m6A_site_195772
mod ID: M6ASITE013672		Click to Show/Hide the Full List
mod site	chr12:57751264-57751265:-		[16]
Sequence	GTTTGAGCATGTAGACCAGGACCTAAGGACATATCTGGACA
Motif Score	3.622404762
Cell/Tissue List	peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000551800.5; ENST00000550419.5; ENST00000549606.5; ENST00000552388.1; ENST00000552862.1; ENST00000551888.5; ENST00000547281.5; ENST00000552254.5; ENST00000553237.5; ENST00000257904.11; ENST00000546489.5; ENST00000312990.10; ENST00000551706.1
External Link	RMBase: m6A_site_195773
mod ID: M6ASITE013673		Click to Show/Hide the Full List
mod site	chr12:57751270-57751271:-		[16]
Sequence	CCTGGTGTTTGAGCATGTAGACCAGGACCTAAGGACATATC
Motif Score	2.876744048
Cell/Tissue List	peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000549606.5; ENST00000257904.11; ENST00000551888.5; ENST00000312990.10; ENST00000550419.5; ENST00000551800.5; ENST00000552862.1; ENST00000553237.5; ENST00000551706.1; ENST00000552388.1; ENST00000552254.5; ENST00000547281.5; ENST00000546489.5
External Link	RMBase: m6A_site_195774
mod ID: M6ASITE013674		Click to Show/Hide the Full List
mod site	chr12:57751313-57751314:-		[16]
Sequence	ACGTCTGTGCCACATCCCGAACTGACCGGGAGATCAAGGTA
Motif Score	3.373380952
Cell/Tissue List	peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000551706.1; ENST00000257904.11; ENST00000550419.5; ENST00000547281.5; ENST00000551800.5; ENST00000549606.5; ENST00000551888.5; ENST00000552388.1; ENST00000546489.5; ENST00000553237.5; ENST00000552862.1; ENST00000312990.10; ENST00000552254.5
External Link	RMBase: m6A_site_195775
mod ID: M6ASITE013675		Click to Show/Hide the Full List
mod site	chr12:57751322-57751323:-		[15]
Sequence	GGCTGATGGACGTCTGTGCCACATCCCGAACTGACCGGGAG
Motif Score	2.053113095
Cell/Tissue List	brain; HEK293; kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000550419.5; ENST00000552862.1; ENST00000546489.5; ENST00000551706.1; ENST00000257904.11; ENST00000547281.5; ENST00000552254.5; ENST00000312990.10; ENST00000553237.5; ENST00000551800.5; ENST00000549606.5; ENST00000552388.1; ENST00000551888.5
External Link	RMBase: m6A_site_195776
mod ID: M6ASITE013676		Click to Show/Hide the Full List
mod site	chr12:57751411-57751412:-		[16]
Sequence	TGATCTGTAGAGAAGTGGGGACCCTGAGGAAATAATGAGAG
Motif Score	3.622404762
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000553237.5; ENST00000257904.11; ENST00000552254.5; ENST00000546489.5; ENST00000551800.5; ENST00000551706.1; ENST00000547281.5; ENST00000550419.5; ENST00000552388.1; ENST00000549606.5; ENST00000312990.10; ENST00000552862.1; ENST00000551888.5
External Link	RMBase: m6A_site_195777
mod ID: M6ASITE013677		Click to Show/Hide the Full List
mod site	chr12:57751453-57751454:-		[16]
Sequence	GTGGGGAGTAAAGGGAAAAGACAGCCTATAGGTGGGGTGTG
Motif Score	2.897386905
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000551800.5; ENST00000552862.1; ENST00000552388.1; ENST00000549606.5; ENST00000550419.5; ENST00000547281.5; ENST00000552254.5; ENST00000312990.10; ENST00000546489.5; ENST00000257904.11; ENST00000551706.1; ENST00000551888.5; ENST00000553237.5
External Link	RMBase: m6A_site_195778
mod ID: M6ASITE013678		Click to Show/Hide the Full List
mod site	chr12:57751560-57751561:-		[15]
Sequence	GAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTA
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000549606.5; ENST00000552254.5; ENST00000551706.1; ENST00000551800.5; ENST00000312990.10; ENST00000257904.11; ENST00000551888.5; ENST00000553237.5; ENST00000552862.1; ENST00000546489.5; ENST00000550419.5; ENST00000547281.5; ENST00000552388.1
External Link	RMBase: m6A_site_195779
mod ID: M6ASITE013679		Click to Show/Hide the Full List
mod site	chr12:57751655-57751656:-		[13]
Sequence	CGGTGCCTATGGGACAGTGTACAAGGCCCGTGATCCCCACA
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000550419.5; ENST00000257904.11; ENST00000549606.5; ENST00000552254.5; ENST00000547281.5; ENST00000552862.1; ENST00000551888.5; ENST00000551706.1; ENST00000552388.1; ENST00000551800.5; ENST00000546489.5; ENST00000312990.10; ENST00000553237.5
External Link	RMBase: m6A_site_195780
mod ID: M6ASITE013680		Click to Show/Hide the Full List
mod site	chr12:57751662-57751663:-		[15]
Sequence	TTGGTGTCGGTGCCTATGGGACAGTGTACAAGGCCCGTGAT
Motif Score	3.643047619
Cell/Tissue List	HEK293; HEK293T; hESC-HEK293T; HepG2; peripheral-blood; AML
Seq Type List	m6A-REF-seq; DART-seq; MAZTER-seq; m6A-seq; miCLIP
Transcript ID List	ENST00000552862.1; ENST00000257904.11; ENST00000551888.5; ENST00000550419.5; ENST00000551800.5; ENST00000552254.5; ENST00000312990.10; ENST00000553237.5; ENST00000546489.5; ENST00000547281.5; ENST00000551706.1; ENST00000549606.5; ENST00000552388.1
External Link	RMBase: m6A_site_195781
mod ID: M6ASITE013681		Click to Show/Hide the Full List
mod site	chr12:57752230-57752231:-		[12]
Sequence	GGGTGTATGGGGCCGTAGGAACCGGCTCCGGGGCCCCGATA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000547281.5; ENST00000552388.1; ENST00000312990.10; ENST00000549606.5; ENST00000552862.1; ENST00000550419.5; ENST00000553237.5; ENST00000551800.5; ENST00000551706.1; ENST00000551888.5; ENST00000546489.5; ENST00000257904.11
External Link	RMBase: m6A_site_195782
mod ID: M6ASITE013682		Click to Show/Hide the Full List
mod site	chr12:57752259-57752260:-		[12]
Sequence	TCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551706.1; ENST00000552388.1; ENST00000551888.5; ENST00000546489.5; ENST00000312990.10; ENST00000549606.5; ENST00000547281.5; ENST00000552862.1; ENST00000553237.5; ENST00000551800.5; ENST00000550419.5; ENST00000257904.11
External Link	RMBase: m6A_site_195783
mod ID: M6ASITE013683		Click to Show/Hide the Full List
mod site	chr12:57752342-57752343:-		[14]
Sequence	CGCCTCTTTGGCAGCTGGTCACATGGTGAGGGTGGGGGTGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000552862.1; ENST00000551706.1; ENST00000549606.5; ENST00000551800.5; ENST00000312990.10
External Link	RMBase: m6A_site_195784

Ref 1	Identification of pathology-specific regulators of m(6)A RNA modification to optimize lung cancer management in the context of predictive, preventive, and personalized medicine. EPMA J. 2020 Jul 29;11(3):485-504. doi: 10.1007/s13167-020-00220-3. eCollection 2020 Sep.
Ref 2	Clinical pipeline report, company report or official report of Regeneron Pharmaceuticals.
Ref 3	Nonclinical pharmacokinetics of oseltamivir and oseltamivir carboxylate in the central nervous system. Antimicrob Agents Chemother. 2009 Nov;53(11):4753-61. doi: 10.1128/AAC.01541-08. Epub 2009 Aug 31.
Ref 4	Structural determinants of P-glycoprotein-mediated transport of glucocorticoids. Pharm Res. 2003 Nov;20(11):1794-803. doi: 10.1023/b:pham.0000003377.39548.f6.
Ref 5	DMDRMR-Mediated Regulation of m(6)A-Modified CDK4 by m(6)A Reader IGF2BP3 Drives ccRCC Progression. Cancer Res. 2021 Feb 15;81(4):923-934. doi: 10.1158/0008-5472.CAN-20-1619. Epub 2020 Dec 8.
Ref 6	Clinical pipeline report, company report or official report of Eli Lilly.
Ref 7	YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nat Commun. 2019 Oct 25;10(1):4892. doi: 10.1038/s41467-019-12801-6.
Ref 8	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 9	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 12	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 13	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 16	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map