m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00190)

Target Name	Ubiquitin-like modifier-activating enzyme ATG7 (ATG7)
Synonyms	ATG12-activating enzyme E1 ATG7; Autophagy-related protein 7; APG7-like; hAGP7; Ubiquitin-activating enzyme E1-like protein; APG7L Click to Show/Hide
Gene Name	ATG7
Chromosomal Location	3p25.3
Family	ATG7 family
Function	E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy. Activates ATG12 for its conjugation with ATG5 as well as the ATG8 family proteins for their conjugation with phosphatidylethanolamine. Both systems are needed for the ATG8 association to Cvt vesicles and autophagosomes membranes. Required for autophagic death induced by caspase-8 inhibition. Required for mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Modulates p53/TP53 activity to regulate cell cycle and survival during metabolic stress. Plays also a key role in the maintenance of axonal homeostasis, the prevention of axonal degeneration, the maintenance of hematopoietic stem cells, the formation of Paneth cell granules, as well as in adipose differentiation. Plays a role in regulating the liver clock and glucose metabolism by mediating the autophagic degradation of CRY1 (clock repressor) in a time-dependent manner (By similarity). Click to Show/Hide
Gene ID	10533
Uniprot ID	ATG7_HUMAN
HGNC ID	HGNC:16935
KEGG ID	hsa:10533

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ATG7 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 6.17E-01 p-value: 3.67E-05
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ATG7 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 4.77E+00	GSE60213

In total 6 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Target Regulation	Up regulation
Responsed Disease	Enterovirus		ICD-11: 1A2Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation and metastasis
	Cell apoptosis
	Cell autophagy
In-vitro Model	Schwann cells (A type of glial cell that surrounds neurons)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib		Approved	Drug Info
Pathway Response	FoxO signaling pathway			hsa04068
	Autophagy			hsa04140
Cell Process	Cell autophagy
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	In osteoarthritis METTL3-mediated m6A modification decreased the expression of autophagy-related 7, an E-1 enzyme crucial for the formation of autophagosomes, by attenuating its RNA stability. Silencing METTL3 enhanced autophagic flux and inhibited Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) expression in OA-FLS.
Target Regulation	Down regulation
Responsed Disease	Osteoarthritis		ICD-11: FA05	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular senescence
	Cell autophagy
In-vitro Model	C-28/I2	Normal	Homo sapiens	CVCL_0187
	FLS (Rat fibroblast synovial cell line)
In-vivo Model	Mice were anaesthetized with isoflurane supplied in a mouse anaesthesia apparatus, followed with joint surgery on the right joint by sectioning the medial meniscotibial ligament.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: shFTO NB4 cells Control: shNS NB4 cells		GSE103494
Regulation		logFC: 1.18E+00 p-value: 1.81E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with ATG101. CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A.
Target Regulation	Up regulation
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary		ICD-11: 2B5D.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Atg5 and Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Atg5 and Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

Enterovirus [ICD-11: 1A2Y]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Responsed Disease	Enterovirus [ICD-11: 1A2Y]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy		hsa04140
Cell Process	Cell proliferation and metastasis
	Cell apoptosis
	Cell autophagy
In-vitro Model	Schwann cells (A type of glial cell that surrounds neurons)

Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with ATG101. CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A.
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy
Experiment 2 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Obesity [ICD-11: 5B81]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	Atg5 and Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).
Experiment 2 Reporting the m6A-centered Disease Response				[6]
Response Summary	Atg5 and Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

Osteoarthritis [ICD-11: FA05]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	In osteoarthritis METTL3-mediated m6A modification decreased the expression of autophagy-related 7, an E-1 enzyme crucial for the formation of autophagosomes, by attenuating its RNA stability. Silencing METTL3 enhanced autophagic flux and inhibited Ubiquitin-like modifier-activating enzyme ATG7 (ATG7) expression in OA-FLS.
Responsed Disease	Osteoarthritis [ICD-11: FA05]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular senescence
	Cell autophagy
In-vitro Model	C-28/I2	Normal	Homo sapiens	CVCL_0187
	FLS (Rat fibroblast synovial cell line)
In-vivo Model	Mice were anaesthetized with isoflurane supplied in a mouse anaesthesia apparatus, followed with joint surgery on the right joint by sectioning the medial meniscotibial ligament.

Chloroquine [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Gefitinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Sorafenib [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy
Experiment 2 Reporting the m6A-centered Drug Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), ATG12, and ATG16L1.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

Beta-Elemen [Phase 3]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, Ubiquitin-like modifier-activating enzyme ATG7 (ATG7), LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05873		Crosstalk Info
Epigenetic Regulator	Circ_RAB11FIP1
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Ovarian cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00190)

Ubiquitin-like modifier-activating enzyme ATG7 (ATG7)

Adenosine-to-Inosine editing (A-to-I)

In total 28 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011496		Click to Show/Hide the Full List
mod site	chr3:11283916-11283917:+		[9]
Sequence	ACTCCAGCCTGGACGACAGAACGAGACTCTGTCTCAAAGAA
Transcript ID List	ENST00000419112.5; ENST00000451830.5; ENST00000354956.9; rmsk_887454; ENST00000444619.5; ENST00000460444.5; ENST00000451513.5; ENST00000354449.7; ENST00000418682.5; ENST00000469654.2; ENST00000423116.1; ENST00000446450.6; ENST00000470474.1; ENST00000435760.5
External Link	RMBase: RNA-editing_site_94731
mod ID: A2ISITE011497		Click to Show/Hide the Full List
mod site	chr3:11314635-11314636:+		[9]
Sequence	CATTGCATTATGTACTTTAAATGGGTGAATTGGGCCAGGCA
Transcript ID List	rmsk_887527; ENST00000451830.5; ENST00000354956.9; ENST00000354449.7; ENST00000418682.5; ENST00000488924.5; ENST00000424071.5; ENST00000434066.6; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94732
mod ID: A2ISITE011498		Click to Show/Hide the Full List
mod site	chr3:11334837-11334838:+		[9]
Sequence	TGTGGTGGCGGGCGTCTGTAATCCCAGCTCTCAGGAGGCTG
Transcript ID List	ENST00000461278.1; ENST00000424071.5; ENST00000434066.6; ENST00000478638.5; ENST00000354956.9; ENST00000354449.7; rmsk_887581; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94733
mod ID: A2ISITE011499		Click to Show/Hide the Full List
mod site	chr3:11399226-11399227:+		[9]
Sequence	GTATGGTGGCCTGTACATATAGTCCCAGCTACTCAGGAGGC
Transcript ID List	ENST00000446450.6; ENST00000427759.5; rmsk_887721; ENST00000354449.7; ENST00000354956.9; ENST00000414717.5; ENST00000446110.1
External Link	RMBase: RNA-editing_site_94734
mod ID: A2ISITE011500		Click to Show/Hide the Full List
mod site	chr3:11428091-11428092:+		[9]
Sequence	ACTTGCCATTAGTCCTTTTAAGTTGCAATTCTTCCCACCAG
Transcript ID List	ENST00000354956.9; ENST00000446110.1; ENST00000446450.6; ENST00000427759.5; ENST00000414717.5; ENST00000354449.7
External Link	RMBase: RNA-editing_site_94735
mod ID: A2ISITE011501		Click to Show/Hide the Full List
mod site	chr3:11428129-11428130:+		[9]
Sequence	CAGCTAAAGAGAAATATATAAATTATTTCTAGCTAGGTGGC
Transcript ID List	ENST00000354449.7; ENST00000427759.5; ENST00000354956.9; ENST00000446110.1; ENST00000414717.5; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94736
mod ID: A2ISITE011502		Click to Show/Hide the Full List
mod site	chr3:11428143-11428144:+		[10]
Sequence	TATATAAATTATTTCTAGCTAGGTGGCAAAACTCCCCCAGC
Transcript ID List	ENST00000446110.1; ENST00000354956.9; ENST00000427759.5; ENST00000446450.6; ENST00000354449.7; ENST00000414717.5
External Link	RMBase: RNA-editing_site_94737
mod ID: A2ISITE011503		Click to Show/Hide the Full List
mod site	chr3:11428193-11428194:+		[9]
Sequence	AAATGATTGCATGGGTGCAAAGATCTATAAATTCCTCCATA
Transcript ID List	ENST00000427759.5; ENST00000446450.6; ENST00000354449.7; ENST00000354956.9; ENST00000446110.1; ENST00000414717.5
External Link	RMBase: RNA-editing_site_94738
mod ID: A2ISITE011504		Click to Show/Hide the Full List
mod site	chr3:11428714-11428715:+		[11]
Sequence	GTACTGCCTGATGGTATGGAAGAGGTAACATAGATGTTTGT
Transcript ID List	ENST00000354449.7; ENST00000414717.5; ENST00000446450.6; ENST00000446110.1; ENST00000354956.9; ENST00000427759.5
External Link	RMBase: RNA-editing_site_94739
mod ID: A2ISITE011505		Click to Show/Hide the Full List
mod site	chr3:11428725-11428726:+		[9]
Sequence	TGGTATGGAAGAGGTAACATAGATGTTTGTAAACATACAGT
Transcript ID List	ENST00000446450.6; ENST00000427759.5; ENST00000354956.9; ENST00000414717.5; ENST00000446110.1; ENST00000354449.7
External Link	RMBase: RNA-editing_site_94740
mod ID: A2ISITE011506		Click to Show/Hide the Full List
mod site	chr3:11428741-11428742:+		[12]
Sequence	ACATAGATGTTTGTAAACATACAGTCATTTGATGGCTAAGG
Transcript ID List	ENST00000427759.5; ENST00000354449.7; ENST00000354956.9; ENST00000446450.6; ENST00000414717.5; ENST00000446110.1
External Link	RMBase: RNA-editing_site_94741
mod ID: A2ISITE011507		Click to Show/Hide the Full List
mod site	chr3:11428758-11428759:+		[9]
Sequence	CATACAGTCATTTGATGGCTAAGGAAGTTTTGCCACCCAGC
Transcript ID List	ENST00000446450.6; ENST00000446110.1; ENST00000354956.9; ENST00000414717.5; ENST00000427759.5; ENST00000354449.7
External Link	RMBase: RNA-editing_site_94742
mod ID: A2ISITE011508		Click to Show/Hide the Full List
mod site	chr3:11428759-11428760:+		[12]
Sequence	ATACAGTCATTTGATGGCTAAGGAAGTTTTGCCACCCAGCT
Transcript ID List	ENST00000354449.7; ENST00000446450.6; ENST00000354956.9; ENST00000414717.5; ENST00000446110.1; ENST00000427759.5
External Link	RMBase: RNA-editing_site_94743
mod ID: A2ISITE011509		Click to Show/Hide the Full List
mod site	chr3:11431604-11431605:+		[9]
Sequence	TAATCTTCTTTCTGTCTGTAAGGATTTTTCTATTCTGGACA
Transcript ID List	ENST00000354449.7; ENST00000414717.5; ENST00000446450.6; ENST00000354956.9; ENST00000446110.1; ENST00000427759.5
External Link	RMBase: RNA-editing_site_94744
mod ID: A2ISITE011510		Click to Show/Hide the Full List
mod site	chr3:11436783-11436784:+		[12]
Sequence	GGATGAACATTGAAAATGTTACACTAATTGAAGAAGCCAGT
Transcript ID List	ENST00000354449.7; rmsk_887804; ENST00000354956.9; ENST00000446110.1; ENST00000446450.6; ENST00000427759.5; ENST00000414717.5
External Link	RMBase: RNA-editing_site_94745
mod ID: A2ISITE011511		Click to Show/Hide the Full List
mod site	chr3:11442809-11442810:+		[9]
Sequence	ACATGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGATGGGA
Transcript ID List	ENST00000446450.6; ENST00000354956.9; ENST00000354449.7; ENST00000414717.5; ENST00000446110.1; ENST00000427759.5; rmsk_887820
External Link	RMBase: RNA-editing_site_94746
mod ID: A2ISITE011512		Click to Show/Hide the Full List
mod site	chr3:11446769-11446770:+		[9]
Sequence	CTGGAACCAAGGCACAGTCAAGGTGAACCAGCTATGCTCCA
Transcript ID List	ENST00000354956.9; ENST00000427759.5; ENST00000414717.5; ENST00000354449.7; ENST00000446110.1; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94747
mod ID: A2ISITE011513		Click to Show/Hide the Full List
mod site	chr3:11467505-11467506:+		[12]
Sequence	TCTGCCTCAGCCTCCCGAGTAGCTGGATTATAGGCATCCAC
Transcript ID List	ENST00000354956.9; ENST00000427759.5; ENST00000354449.7; ENST00000446110.1; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94748
mod ID: A2ISITE011514		Click to Show/Hide the Full List
mod site	chr3:11500665-11500666:+		[12]
Sequence	TTTTTTTGTTTGTTTGTCTGAGACGGAGTTTTGCTCTTGTT
Transcript ID List	ENST00000446450.6; ENST00000446110.1; ENST00000354449.7; ENST00000354956.9
External Link	RMBase: RNA-editing_site_94749
mod ID: A2ISITE011515		Click to Show/Hide the Full List
mod site	chr3:11506540-11506541:+		[13]
Sequence	CAGCCTGGTCAACATGGTGAAACCCCATCTCTACAAAAAAA
Transcript ID List	ENST00000354956.9; ENST00000446110.1; ENST00000354449.7; rmsk_887944; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94750
mod ID: A2ISITE011516		Click to Show/Hide the Full List
mod site	chr3:11506546-11506547:+		[13]
Sequence	GGTCAACATGGTGAAACCCCATCTCTACAAAAAAAAAAAAA
Transcript ID List	rmsk_887944; ENST00000354449.7; ENST00000446450.6; ENST00000354956.9; ENST00000446110.1
External Link	RMBase: RNA-editing_site_94751
mod ID: A2ISITE011517		Click to Show/Hide the Full List
mod site	chr3:11506630-11506631:+		[13]
Sequence	AGGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGA
Transcript ID List	rmsk_887944; ENST00000446450.6; ENST00000446110.1; ENST00000354956.9; ENST00000354449.7
External Link	RMBase: RNA-editing_site_94752
mod ID: A2ISITE011518		Click to Show/Hide the Full List
mod site	chr3:11506643-11506644:+		[13]
Sequence	CCCAGCTACTCAGGAGGCTGAGGCAGGACAATCACTTGAAC
Transcript ID List	ENST00000354449.7; ENST00000446110.1; ENST00000354956.9; rmsk_887944; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94753
mod ID: A2ISITE011519		Click to Show/Hide the Full List
mod site	chr3:11506662-11506663:+		[13]
Sequence	GAGGCAGGACAATCACTTGAACCCAGGAGGCAGAGGTTGTG
Transcript ID List	rmsk_887944; ENST00000446110.1; ENST00000354449.7; ENST00000354956.9; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94754
mod ID: A2ISITE011520		Click to Show/Hide the Full List
mod site	chr3:11506911-11506912:+		[9]
Sequence	TTCCCTAGGTAAGGATTCATAGCATTTTTTGTGCCATGGAT
Transcript ID List	ENST00000446110.1; ENST00000446450.6; ENST00000354449.7; ENST00000354956.9
External Link	RMBase: RNA-editing_site_94755
mod ID: A2ISITE011521		Click to Show/Hide the Full List
mod site	chr3:11521570-11521571:+		[9]
Sequence	TTTTTTGTTTTTTTTTTTTTAAGACGGAGTCTCGCTCTGTC
Transcript ID List	ENST00000354956.9; ENST00000354449.7; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94756
mod ID: A2ISITE011522		Click to Show/Hide the Full List
mod site	chr3:11524529-11524530:+		[9]
Sequence	GCACTTTGAGAGGCCTAGGCAGGAGGATCACTTGAGCCCAG
Transcript ID List	ENST00000354956.9; ENST00000354449.7; ENST00000446450.6; rmsk_887982
External Link	RMBase: RNA-editing_site_94757
mod ID: A2ISITE011523		Click to Show/Hide the Full List
mod site	chr3:11526366-11526367:+		[9]
Sequence	ACTCCACTGCACTCCAGCCTAGGTGGCAGAGTGAGACTCAA
Transcript ID List	ENST00000354449.7; ENST00000354956.9; rmsk_887988; ENST00000446450.6
External Link	RMBase: RNA-editing_site_94758

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003044		Click to Show/Hide the Full List
mod site	chr3:11556843-11556844:+
Sequence	GAATGCCAAAGCTTGGAAGCCCAGTACAGTGGGAGTGAAAT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m5C_site_31632

N6-methyladenosine (m6A)

In total 62 m6A sequence/site(s) in this target gene
mod ID: M6ASITE059491		Click to Show/Hide the Full List
mod site	chr3:11272587-11272588:+		[14]
Sequence	TGGTCCTTCCTCCTCCAGGGACTCACTGATTCCGGCTGGCG
Motif Score	4.065041667
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000435760.5; ENST00000451513.5; ENST00000418682.5; ENST00000469654.2; ENST00000446450.6; ENST00000354956.9; ENST00000460444.5; ENST00000470474.1; ENST00000419112.5; ENST00000444619.5; ENST00000451830.5; ENST00000354449.7
External Link	RMBase: m6A_site_577081
mod ID: M6ASITE059492		Click to Show/Hide the Full List
mod site	chr3:11272636-11272637:+		[14]
Sequence	CTGTAGCCGCGTCCCCTCAGACTGGTTCAGTCCGGGGTCTT
Motif Score	3.319380952
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000470474.1; ENST00000435760.5; ENST00000460444.5; ENST00000419112.5; ENST00000469654.2; ENST00000354449.7; ENST00000444619.5; ENST00000418682.5; ENST00000446450.6; ENST00000354956.9; ENST00000451513.5; ENST00000451830.5
External Link	RMBase: m6A_site_577082
mod ID: M6ASITE059493		Click to Show/Hide the Full List
mod site	chr3:11282240-11282241:+		[15]
Sequence	CAGTGCATCCGTTCTCAAAAACTGAAGCTGATGGACACCAG
Motif Score	2.627720238
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000354449.7; ENST00000451830.5; ENST00000469654.2; ENST00000444619.5; ENST00000451513.5; ENST00000435760.5; ENST00000446450.6; ENST00000419112.5; ENST00000354956.9; ENST00000418682.5; ENST00000470474.1; ENST00000423116.1; ENST00000460444.5
External Link	RMBase: m6A_site_577083
mod ID: M6ASITE059494		Click to Show/Hide the Full List
mod site	chr3:11282254-11282255:+		[15]
Sequence	TCAAAAACTGAAGCTGATGGACACCAGATTGCATGTGAAGG
Motif Score	3.643047619
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000460444.5; ENST00000354449.7; ENST00000354956.9; ENST00000451513.5; ENST00000469654.2; ENST00000451830.5; ENST00000418682.5; ENST00000446450.6; ENST00000419112.5; ENST00000470474.1; ENST00000444619.5; ENST00000435760.5; ENST00000423116.1
External Link	RMBase: m6A_site_577084
mod ID: M6ASITE059495		Click to Show/Hide the Full List
mod site	chr3:11282299-11282300:+		[16]
Sequence	GGATATTATAGCAGAAGGAAACCAAAATAAAAGAAAAACAG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000435760.5; ENST00000444619.5; ENST00000470474.1; ENST00000460444.5; ENST00000451830.5; ENST00000423116.1; ENST00000354449.7; ENST00000354956.9; ENST00000418682.5; ENST00000419112.5; ENST00000446450.6; ENST00000451513.5; ENST00000469654.2
External Link	RMBase: m6A_site_577085
mod ID: M6ASITE059496		Click to Show/Hide the Full List
mod site	chr3:11282316-11282317:+		[16]
Sequence	GAAACCAAAATAAAAGAAAAACAGCTCCTGGAAGTAACCAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7; ENST00000423116.1; ENST00000418682.5; ENST00000470474.1; ENST00000446450.6; ENST00000460444.5; ENST00000444619.5; ENST00000419112.5; ENST00000451830.5; ENST00000469654.2; ENST00000354956.9; ENST00000435760.5; ENST00000451513.5
External Link	RMBase: m6A_site_577086
mod ID: M6ASITE059497		Click to Show/Hide the Full List
mod site	chr3:11282345-11282346:+		[16]
Sequence	GGAAGTAACCAATGAGAAGGACAGATAAGAGTTTGAAGACT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; Huh7; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354956.9; ENST00000460444.5; ENST00000419112.5; ENST00000354449.7; ENST00000418682.5; ENST00000444619.5; ENST00000451830.5; ENST00000469654.2; ENST00000446450.6; ENST00000451513.5; ENST00000470474.1; ENST00000423116.1; ENST00000435760.5
External Link	RMBase: m6A_site_577087
mod ID: M6ASITE059498		Click to Show/Hide the Full List
mod site	chr3:11282363-11282364:+		[16]
Sequence	GGACAGATAAGAGTTTGAAGACTGTGGATGTGACTGCTTGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000451830.5; ENST00000354956.9; ENST00000469654.2; ENST00000418682.5; ENST00000354449.7; ENST00000444619.5; ENST00000451513.5; ENST00000446450.6; ENST00000419112.5; ENST00000460444.5; ENST00000423116.1; ENST00000435760.5; ENST00000470474.1
External Link	RMBase: m6A_site_577088
mod ID: M6ASITE059499		Click to Show/Hide the Full List
mod site	chr3:11288704-11288705:+		[16]
Sequence	TGGGGATTTGATCTTAAAAAACAAAAGATTTAGATCCATGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000451830.5; ENST00000444619.5; ENST00000451513.5; ENST00000469654.2; ENST00000354449.7; ENST00000423116.1; ENST00000446450.6; ENST00000470474.1; ENST00000418682.5; ENST00000354956.9; ENST00000419112.5; ENST00000435760.5; ENST00000460444.5
External Link	RMBase: m6A_site_577089
mod ID: M6ASITE059500		Click to Show/Hide the Full List
mod site	chr3:11288727-11288728:+		[16]
Sequence	AAAGATTTAGATCCATGTGGACAGAAACTTTTGGTAAGTAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460444.5; ENST00000444619.5; ENST00000446450.6; ENST00000469654.2; ENST00000418682.5; ENST00000435760.5; ENST00000419112.5; ENST00000470474.1; ENST00000451830.5; ENST00000354449.7; ENST00000451513.5; ENST00000354956.9; ENST00000423116.1
External Link	RMBase: m6A_site_577090
mod ID: M6ASITE059501		Click to Show/Hide the Full List
mod site	chr3:11288733-11288734:+		[16]
Sequence	TTAGATCCATGTGGACAGAAACTTTTGGTAAGTACTCATTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354956.9; ENST00000419112.5; ENST00000435760.5; ENST00000354449.7; ENST00000460444.5; ENST00000423116.1; ENST00000470474.1; ENST00000446450.6; ENST00000444619.5; ENST00000451513.5; ENST00000469654.2; ENST00000418682.5; ENST00000451830.5
External Link	RMBase: m6A_site_577091
mod ID: M6ASITE059502		Click to Show/Hide the Full List
mod site	chr3:11298721-11298722:+		[17]
Sequence	GCAGCTACGGGGGATCCTGGACTCTCTAAACTGCAGTTTGC
Motif Score	4.065041667
Cell/Tissue List	A549; iSLK; TIME; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000435760.5; ENST00000444619.5; ENST00000419112.5; ENST00000354449.7; ENST00000418682.5; ENST00000460444.5; ENST00000470474.1; ENST00000451830.5; ENST00000451513.5; ENST00000446450.6; ENST00000423116.1; ENST00000469654.2; ENST00000354956.9
External Link	RMBase: m6A_site_577092
mod ID: M6ASITE059503		Click to Show/Hide the Full List
mod site	chr3:11298730-11298731:+		[17]
Sequence	GGGGATCCTGGACTCTCTAAACTGCAGTTTGCCCCTTTTAG
Motif Score	2.627720238
Cell/Tissue List	A549; iSLK; TIME; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000354956.9; ENST00000470474.1; ENST00000451830.5; ENST00000451513.5; ENST00000418682.5; ENST00000460444.5; ENST00000423116.1; ENST00000435760.5; ENST00000446450.6; ENST00000419112.5; ENST00000469654.2; ENST00000354449.7; ENST00000444619.5
External Link	RMBase: m6A_site_577093
mod ID: M6ASITE059504		Click to Show/Hide the Full List
mod site	chr3:11298831-11298832:+		[16]
Sequence	GCTGGATGAAGCTCCCAAGGACATTAAGGGTTATTACTACA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; MSC
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000460444.5; ENST00000446450.6; ENST00000469654.2; ENST00000451513.5; ENST00000451830.5; ENST00000354956.9; ENST00000418682.5; ENST00000470474.1; ENST00000423116.1; ENST00000419112.5; ENST00000435760.5; ENST00000354449.7; ENST00000444619.5
External Link	RMBase: m6A_site_577094
mod ID: M6ASITE059505		Click to Show/Hide the Full List
mod site	chr3:11299412-11299413:+		[18]
Sequence	ATTGGAGTTCAGTGCTTTTGACATGTGAGTATTTATTTGTT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000451830.5; ENST00000469654.2; ENST00000423116.1; ENST00000418682.5; ENST00000354449.7; ENST00000444619.5; ENST00000419112.5; ENST00000354956.9; ENST00000451513.5; ENST00000446450.6; ENST00000460444.5
External Link	RMBase: m6A_site_577095
mod ID: M6ASITE059506		Click to Show/Hide the Full List
mod site	chr3:11306982-11306983:+		[18]
Sequence	GTTGCTGCCCAGCTATTGGAACACTGTATAACACCAACACA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000418682.5; ENST00000423116.1; ENST00000451513.5; ENST00000419112.5; ENST00000451830.5; ENST00000354956.9; ENST00000444619.5; ENST00000354449.7; ENST00000446450.6
External Link	RMBase: m6A_site_577096
mod ID: M6ASITE059507		Click to Show/Hide the Full List
mod site	chr3:11307018-11307019:+		[16]
Sequence	ACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7; ENST00000423116.1; ENST00000446450.6; ENST00000451830.5; ENST00000354956.9; ENST00000418682.5; ENST00000451513.5
External Link	RMBase: m6A_site_577097
mod ID: M6ASITE059508		Click to Show/Hide the Full List
mod site	chr3:11307044-11307045:+		[16]
Sequence	GATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000451513.5; ENST00000423116.1; ENST00000354956.9; ENST00000451830.5; ENST00000418682.5; ENST00000354449.7; ENST00000446450.6
External Link	RMBase: m6A_site_577098
mod ID: M6ASITE059509		Click to Show/Hide the Full List
mod site	chr3:11309035-11309036:+		[18]
Sequence	TGAAAACCCTGTACTCCTCAACAAGTTCCTCCTCTTGACAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000451513.5; ENST00000418682.5; ENST00000451830.5; ENST00000446450.6; ENST00000424071.5; ENST00000354449.7; ENST00000488924.5; ENST00000464282.1; ENST00000354956.9
External Link	RMBase: m6A_site_577099
mod ID: M6ASITE059510		Click to Show/Hide the Full List
mod site	chr3:11309052-11309053:+		[19]
Sequence	TCAACAAGTTCCTCCTCTTGACATTTGCAGTAAGTAAATGG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000354956.9; ENST00000446450.6; ENST00000464282.1; ENST00000354449.7; ENST00000451513.5; ENST00000451830.5; ENST00000488924.5; ENST00000424071.5; ENST00000418682.5
External Link	RMBase: m6A_site_577100
mod ID: M6ASITE059511		Click to Show/Hide the Full List
mod site	chr3:11315431-11315432:+		[16]
Sequence	CTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000446450.6; ENST00000488924.5; ENST00000434066.6; ENST00000354956.9; ENST00000354449.7; ENST00000418682.5; ENST00000424071.5
External Link	RMBase: m6A_site_577101
mod ID: M6ASITE059512		Click to Show/Hide the Full List
mod site	chr3:11315456-11315457:+		[16]
Sequence	GTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354956.9; ENST00000424071.5; ENST00000488924.5; ENST00000434066.6; ENST00000446450.6; ENST00000418682.5; ENST00000354449.7
External Link	RMBase: m6A_site_577102
mod ID: M6ASITE059513		Click to Show/Hide the Full List
mod site	chr3:11331342-11331343:+		[18]
Sequence	GTCTTTTTTGTTCACAGATAACAATTGGTGTATATGATCCC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000446450.6; ENST00000354956.9; ENST00000488924.5; ENST00000434066.6; ENST00000424071.5; ENST00000354449.7
External Link	RMBase: m6A_site_577103
mod ID: M6ASITE059514		Click to Show/Hide the Full List
mod site	chr3:11340674-11340675:+		[16]
Sequence	AGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGAC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000446450.6; ENST00000434066.6; ENST00000478638.5; ENST00000461278.1; ENST00000354956.9; ENST00000424071.5; ENST00000354449.7
External Link	RMBase: m6A_site_577104
mod ID: M6ASITE059515		Click to Show/Hide the Full List
mod site	chr3:11340693-11340694:+		[16]
Sequence	AACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354956.9; ENST00000354449.7; ENST00000478638.5; ENST00000461278.1; ENST00000424071.5; ENST00000446450.6; ENST00000434066.6
External Link	RMBase: m6A_site_577105
mod ID: M6ASITE059516		Click to Show/Hide the Full List
mod site	chr3:11340707-11340708:+		[16]
Sequence	CATGGGACCAAGGATGGTGAACCTCAGTGAATGTATGGACC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000446450.6; ENST00000424071.5; ENST00000434066.6; ENST00000354956.9; ENST00000461278.1; ENST00000478638.5; ENST00000354449.7
External Link	RMBase: m6A_site_577106
mod ID: M6ASITE059517		Click to Show/Hide the Full List
mod site	chr3:11340725-11340726:+		[16]
Sequence	GAACCTCAGTGAATGTATGGACCCTAAAAGGTATATTTGGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000446450.6; ENST00000354956.9; ENST00000424071.5; ENST00000478638.5; ENST00000434066.6; ENST00000354449.7; ENST00000461278.1
External Link	RMBase: m6A_site_577107
mod ID: M6ASITE059518		Click to Show/Hide the Full List
mod site	chr3:11342199-11342200:+		[16]
Sequence	GAGATTGGTTCCTACTTTAGACTTGGACAAGGTTGTGTCTG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000424071.5; ENST00000354956.9; ENST00000446450.6; ENST00000354449.7; ENST00000460291.1; ENST00000461278.1; ENST00000478638.5; ENST00000434066.6
External Link	RMBase: m6A_site_577108
mod ID: M6ASITE059519		Click to Show/Hide the Full List
mod site	chr3:11342205-11342206:+		[16]
Sequence	GGTTCCTACTTTAGACTTGGACAAGGTTGTGTCTGTCAAAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000354449.7; ENST00000461278.1; ENST00000434066.6; ENST00000354956.9; ENST00000478638.5; ENST00000424071.5; ENST00000446450.6; ENST00000460291.1
External Link	RMBase: m6A_site_577109
mod ID: M6ASITE059521		Click to Show/Hide the Full List
mod site	chr3:11346538-11346539:+		[16]
Sequence	TTTGCAGATTAGCCATTTAAACTGTGTAGCATTCCAGGAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7; ENST00000424071.5; ENST00000478638.5; ENST00000460291.1; ENST00000354956.9; ENST00000446450.6
External Link	RMBase: m6A_site_577110
mod ID: M6ASITE059522		Click to Show/Hide the Full List
mod site	chr3:11346558-11346559:+		[16]
Sequence	ACTGTGTAGCATTCCAGGAAACCAAAAGTTAAGTGTGTGCA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000424071.5; ENST00000460291.1; ENST00000354449.7; ENST00000446450.6; ENST00000354956.9; ENST00000478638.5
External Link	RMBase: m6A_site_577111
mod ID: M6ASITE059523		Click to Show/Hide the Full List
mod site	chr3:11347890-11347891:+		[16]
Sequence	ACACAGGGTTGGGGCGTGAGACACATCACATTTGTGGACAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000446450.6; ENST00000354449.7; ENST00000424071.5; ENST00000460291.1; ENST00000354956.9; ENST00000478638.5
External Link	RMBase: m6A_site_577112
mod ID: M6ASITE059524		Click to Show/Hide the Full List
mod site	chr3:11347907-11347908:+		[18]
Sequence	GAGACACATCACATTTGTGGACAATGCCAAGATCTCCTACT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000478638.5; ENST00000354956.9; ENST00000460291.1; ENST00000424071.5; ENST00000446450.6; ENST00000354449.7
External Link	RMBase: m6A_site_577113
mod ID: M6ASITE059525		Click to Show/Hide the Full List
mod site	chr3:11348006-11348007:+		[16]
Sequence	CAAGGCTCTGGCAGCAGCGGACCGGCTCCAGAAAATATTCC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7; ENST00000354956.9; ENST00000446450.6; ENST00000460291.1; ENST00000424071.5
External Link	RMBase: m6A_site_577114
mod ID: M6ASITE059526		Click to Show/Hide the Full List
mod site	chr3:11358433-11358434:+		[18]
Sequence	CTAGAATGCCAGAGGATTCAACATGAGCATACCTATGCCTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000446450.6; ENST00000354956.9; ENST00000354449.7; ENST00000424071.5
External Link	RMBase: m6A_site_577115
mod ID: M6ASITE059527		Click to Show/Hide the Full List
mod site	chr3:11358559-11358560:+		[18]
Sequence	TGTCGTCTTCCTATTGATGGACACCAGGGAGAGCCGGTGGC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000446450.6; ENST00000424071.5; ENST00000354449.7; ENST00000354956.9
External Link	RMBase: m6A_site_577116
mod ID: M6ASITE059528		Click to Show/Hide the Full List
mod site	chr3:11360627-11360628:+		[18]
Sequence	GACACATTTGTTGTCATGAGACATGGTCTGAAGAAACCAAA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000467121.1; ENST00000354956.9; ENST00000446450.6; ENST00000354449.7
External Link	RMBase: m6A_site_577117
mod ID: M6ASITE059529		Click to Show/Hide the Full List
mod site	chr3:11360725-11360726:+		[18]
Sequence	GGGCTCATCGCTTTTTGCCAACATCCCTGGTTACAAGCTTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000467121.1; ENST00000354956.9; ENST00000354449.7; ENST00000446450.6
External Link	RMBase: m6A_site_577118
mod ID: M6ASITE059530		Click to Show/Hide the Full List
mod site	chr3:11380026-11380027:+		[19]
Sequence	TCCCGTCAGCCTGGCATTTGACAAATGTACAGCTTGTTCTT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000354449.7; ENST00000414717.5; ENST00000446450.6; ENST00000427759.5; ENST00000354956.9; ENST00000446110.1
External Link	RMBase: m6A_site_577119
mod ID: M6ASITE059532		Click to Show/Hide the Full List
mod site	chr3:11426862-11426863:+		[18]
Sequence	GCCAAGGTGTTTAATTCTTCACATTCCTTCTTAGAAGACTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000446450.6; ENST00000446110.1; ENST00000427759.5; ENST00000354956.9; ENST00000354449.7; ENST00000414717.5
External Link	RMBase: m6A_site_577120
mod ID: M6ASITE059533		Click to Show/Hide the Full List
mod site	chr3:11426911-11426912:+		[16]
Sequence	TTACATTGCTGCATCAAGAAACCCAAGCTGCTGAGGTAAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000414717.5; ENST00000446450.6; ENST00000354449.7; ENST00000354956.9; ENST00000446110.1; ENST00000427759.5
External Link	RMBase: m6A_site_577121
mod ID: M6ASITE059534		Click to Show/Hide the Full List
mod site	chr3:11446549-11446550:+		[16]
Sequence	TTGATACCTACTGTGACAAAACACACATCCAATGACAGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000414717.5; ENST00000446110.1; ENST00000427759.5; ENST00000354449.7; ENST00000446450.6; ENST00000354956.9
External Link	RMBase: m6A_site_577122
mod ID: M6ASITE059535		Click to Show/Hide the Full List
mod site	chr3:11510298-11510299:+		[16]
Sequence	TCTACCAGCTCTCAAGCAGAACAATTCCTTGCATTCATACT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354956.9; ENST00000354449.7; ENST00000446110.1; ENST00000446450.6
External Link	RMBase: m6A_site_577123
mod ID: M6ASITE059536		Click to Show/Hide the Full List
mod site	chr3:11554817-11554818:+		[16]
Sequence	CTTCTCCATGCAGATCTGGGACATGAGCGATGATGAGACCA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354956.9; ENST00000446450.6; ENST00000354449.7
External Link	RMBase: m6A_site_577124
mod ID: M6ASITE059537		Click to Show/Hide the Full List
mod site	chr3:11554834-11554835:+		[16]
Sequence	GGGACATGAGCGATGATGAGACCATCTGAGATGGCCCCGCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000446450.6; ENST00000354449.7; ENST00000354956.9
External Link	RMBase: m6A_site_577125
mod ID: M6ASITE059538		Click to Show/Hide the Full List
mod site	chr3:11554911-11554912:+		[16]
Sequence	CTCTCCATCGCCAGAGCAGGACTGCTGACCCCAGGCCTGGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000354956.9; ENST00000354449.7; ENST00000446450.6
External Link	RMBase: m6A_site_577126
mod ID: M6ASITE059539		Click to Show/Hide the Full List
mod site	chr3:11555082-11555083:+		[16]
Sequence	GGCCTTGCTATTGACCTGGGACTTGGTCCTCCATGCAGTTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; MM6; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7; ENST00000354956.9; rmsk_888046
External Link	RMBase: m6A_site_577127
mod ID: M6ASITE059540		Click to Show/Hide the Full List
mod site	chr3:11555180-11555181:+		[16]
Sequence	GAGGGGGTGACCCAACACAGACCAAATGGGGAAATGAGCAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577128
mod ID: M6ASITE059541		Click to Show/Hide the Full List
mod site	chr3:11555312-11555313:+		[16]
Sequence	TGGGCATGGGTGAGGGTGGGACCCCGTGAGCGCACTGCACC
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; MM6; CD4T; peripheral-blood; HEK293T; HEK293A-TOA; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577129
mod ID: M6ASITE059542		Click to Show/Hide the Full List
mod site	chr3:11555381-11555382:+		[16]
Sequence	AGAGCCGAGCTGGGTACGAGACTAAAGGGCCCACATGACCC
Motif Score	3.319380952
Cell/Tissue List	HeLa; A549; H1A; MM6; CD4T; peripheral-blood; HEK293T; HEK293A-TOA; iSLK; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577130
mod ID: M6ASITE059543		Click to Show/Hide the Full List
mod site	chr3:11555426-11555427:+		[16]
Sequence	ACGCCAGATTTCCACCAAGGACTGAGTGAGCTGCTCAGACA
Motif Score	4.065041667
Cell/Tissue List	HeLa; H1A; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577131
mod ID: M6ASITE059544		Click to Show/Hide the Full List
mod site	chr3:11555444-11555445:+		[16]
Sequence	GGACTGAGTGAGCTGCTCAGACATGGCTTTCTGCCTCCCAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; H1A; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577132
mod ID: M6ASITE059545		Click to Show/Hide the Full List
mod site	chr3:11555995-11555996:+		[16]
Sequence	CTCATGGGAGCTTCATGGGGACACAGCCGGCACAGGTGCAG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577133
mod ID: M6ASITE059546		Click to Show/Hide the Full List
mod site	chr3:11556248-11556249:+		[16]
Sequence	GCAGCGCGGCTCTGGGAAGAACTTCACGGAGCCCCTTCTTA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; MM6; Jurkat; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577136
mod ID: M6ASITE059547		Click to Show/Hide the Full List
mod site	chr3:11556377-11556378:+		[16]
Sequence	GATAGGTCAGTGCACCAGGGACCCGGCCGCCAGCACCGCCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577139
mod ID: M6ASITE059549		Click to Show/Hide the Full List
mod site	chr3:11556437-11556438:+		[16]
Sequence	CCTTGTTCACTGACAAAGAGACCTGTCCCAGGAGTGTCCTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; Jurkat; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577141
mod ID: M6ASITE059550		Click to Show/Hide the Full List
mod site	chr3:11556519-11556520:+		[20]
Sequence	CTCAGTAGCCTGTAGCAATAACAAACTCGTGGCTATGAATG
Motif Score	2.168095238
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577147
mod ID: M6ASITE059551		Click to Show/Hide the Full List
mod site	chr3:11556523-11556524:+		[16]
Sequence	GTAGCCTGTAGCAATAACAAACTCGTGGCTATGAATGCAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577148
mod ID: M6ASITE059552		Click to Show/Hide the Full List
mod site	chr3:11556596-11556597:+		[20]
Sequence	CTTTTACAGACAAATCTACGACAAAAAAAAAGATCAACTTT
Motif Score	2.865571429
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577152
mod ID: M6ASITE059553		Click to Show/Hide the Full List
mod site	chr3:11556689-11556690:+		[19]
Sequence	TAAATAGCTACATATCATTAACAAATTAATGTTCTTCAAAA
Motif Score	2.168095238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577153
mod ID: M6ASITE059554		Click to Show/Hide the Full List
mod site	chr3:11556932-11556933:+		[20]
Sequence	CCTGCAGCCACTCTGTGACTACAAGAGCCAGTCCTCCGACC
Motif Score	2.078666667
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577158
mod ID: M6ASITE059555		Click to Show/Hide the Full List
mod site	chr3:11557257-11557258:+		[20]
Sequence	AAATAATAAATGCAGTAATAACAGTATAAAGTCAGAGGAAT
Motif Score	2.168095238
Cell/Tissue List	brain; HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000354449.7
External Link	RMBase: m6A_site_577166

Ref 1	Knockdown of METTL3 inhibits enterovirus 71-induced apoptosis of mouse Schwann cell through regulation of autophagy. Pathog Dis. 2021 Jul 28;79(6):ftab036. doi: 10.1093/femspd/ftab036.
Ref 2	RNA N6-methyladenosine: a new player in autophagy-mediated anti-cancer drug resistance. Br J Cancer. 2021 May;124(10):1621-1622. doi: 10.1038/s41416-021-01314-z. Epub 2021 Mar 15.
Ref 3	The mechanism of m(6)A methyltransferase METTL3-mediated autophagy in reversing gefitinib resistance in NSCLC cells by Beta-elemene. Cell Death Dis. 2020 Nov 11;11(11):969. doi: 10.1038/s41419-020-03148-8.
Ref 4	METTL3-mediated m(6)A modification of ATG7 regulates autophagy-GATA4 axis to promote cellular senescence and osteoarthritis progression. Ann Rheum Dis. 2022 Jan;81(1):87-99. doi: 10.1136/annrheumdis-2021-221091. Epub 2021 Oct 27.
Ref 5	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. Cell Death Dis. 2021 Feb 26;12(2):219. doi: 10.1038/s41419-021-03486-1.
Ref 6	m(6)A mRNA methylation controls autophagy and adipogenesis by targeting Atg5 and Atg7. Autophagy. 2020 Jul;16(7):1221-1235. doi: 10.1080/15548627.2019.1659617. Epub 2019 Aug 26.
Ref 7	Association of the ABCG2 C421A polymorphism with prostate cancer risk and survival. BJU Int. 2008 Dec;102(11):1694-9. doi: 10.1111/j.1464-410X.2008.07913.x. Epub 2008 Aug 14.
Ref 8	Cyclosporin A, tacrolimus and sirolimus are potent inhibitors of the human breast cancer resistance protein (ABCG2) and reverse resistance to mitoxantrone and topotecan. Cancer Chemother Pharmacol. 2006 Sep;58(3):374-83. doi: 10.1007/s00280-005-0173-6. Epub 2006 Jan 11.
Ref 9	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 10	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 11	Genome-wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science. 2009 May 29;324(5931):1210-3. doi: 10.1126/science.1170995.
Ref 12	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 13	A survey of RNA editing in human brain. Genome Res. 2004 Dec;14(12):2379-87. doi: 10.1101/gr.2951204. Epub 2004 Nov 15.
Ref 14	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.
Ref 15	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 16	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 17	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 18	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 19	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 20	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map