m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00137)
Target Name microRNA 126 (MIR126)
Synonyms
MIR126; MIRN126; hsa-mir-126
    Click to Show/Hide
Gene Name MIR126
Chromosomal Location 9q34.3
Family MicroRNAs
Gene ID 406913
HGNC ID
HGNC:31508
miRBase ID
MI0000471
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MIR126 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary The METTL3/m6A/miR126 pathway, whose inhibition contributes to endometriosis development by enhancing cellular migration and invasion.
Target Regulation Up regulation
Responsed Disease Endometriosis ICD-11: GA10
 Disease Info 
In-vitro Model HESC (Human endometrial stromal cells)
Idiopathic interstitial pneumonitis [ICD-11: CB03]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A modification of pri-miRNA-126 and its binding with DGCR8 decreases blocked microRNA 126 (MIR126) maturation, and then activated the PI3K/AKT/mTOR pathway, which drove the fibro genesis in the lung after CB exposure.
Responsed Disease Pulmonary Fibrosis [ICD-11: CB03.4]
Pathway Response MAPK signaling pathway hsa04010
PI3K-Akt signaling pathway hsa04151
Cell Process RNA maturation
In-vitro Model ()
In-vivo Model Rats inhaled CB at dose of 0, 5 or 30 mg/m3 for 28 days, 6 h/day, respectively. The rats inhaled CB at dose of 0 or 30 mg/m3 for 14 days, 28 days and 90 days, respectively. In vitro experiments, the normal human bronchial epithelial cell line (16HBE) was treated with CB (0, 50, 100 and 200 ug/mL) for 24 h.
Endometriosis [ICD-11: GA10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary The METTL3/m6A/miR126 pathway, whose inhibition contributes to endometriosis development by enhancing cellular migration and invasion.
Responsed Disease Endometriosis [ICD-11: GA10]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model HESC (Human endometrial stromal cells)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: Methyltransferase-like 14 (METTL14)
 Regulator Info 
In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00624
 Crosstalk Info 
Epigenetic Regulator Interferon-inducible protein 4 (ADAR1)
Regulated Target Nuclear paraspeckle assembly transcript 1 (NEAT1)
Crosstalk relationship A-to-I → m6A
Crosstalk ID: M6ACROT00625
 Crosstalk Info 
Epigenetic Regulator Alpha-ketoglutarate-dependent dioxygenase alkB homolog 3 (ALKBH3)
Regulated Target Vascular endothelial growth factor A (VEGFA)
Crosstalk relationship m6A → m1A
Crosstalk ID: M6ACROT00626
 Crosstalk Info 
Epigenetic Regulator Methyltransferase-like protein 1 (METTL1)
Regulated Target Vascular endothelial growth factor A (VEGFA)
Crosstalk relationship m6A → m7G
Crosstalk ID: M6ACROT00627
 Crosstalk Info 
Epigenetic Regulator Fat mass and obesity-associated protein (FTO)
Regulated Target C-X-C chemokine receptor type 4 (CXCR4)
Crosstalk relationship m6A → m6Am
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 8 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05595
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Crosstalk relationship m6A → ncRNA
Disease Endometriosis
 Disease Info 
Crosstalk ID: M6ACROT05681
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target ADAM metallopeptidase domain 9 (ADAM9)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05924
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Scaffold protein ILK (ILK)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05926
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Cyclin-dependent kinase 3 (CDK3)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05932
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Target of Myb1 membrane trafficking protein (TOM1)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05934
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target High affinity immunoglobulin gamma Fc receptor I (FCGR1A)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05936
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Ficolin-1 (FCN1)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05938
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Leucine-rich repeat and calponin homology domain-containing protein 4 (LRCH4)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 7 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05682
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target ADAM metallopeptidase domain 9 (ADAM9)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05925
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Scaffold protein ILK (ILK)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05927
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Cyclin-dependent kinase 3 (CDK3)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05933
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Target of Myb1 membrane trafficking protein (TOM1)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05935
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target High affinity immunoglobulin gamma Fc receptor I (FCGR1A)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05937
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Ficolin-1 (FCN1)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
Crosstalk ID: M6ACROT05939
 Crosstalk Info 
Epigenetic Regulator MicroRNA 126 (MIR126)
Regulated Target Leucine-rich repeat and calponin homology domain-containing protein 4 (LRCH4)
Crosstalk relationship m6A → ncRNA
Disease Acute myeloid leukaemia
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00137)
microRNA 126 (MIR126)
N6-methyladenosine (m6A)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M6ASITE090525 Click to Show/Hide the Full List
mod site chr9:136670614-136670615:+ [3]
Sequence ACGCCTCCGCTGGCGACGGGACATTATTACTTTTGGTACGC
Motif Score 3.643047619
Cell/Tissue List BGC823
Seq Type List m6A-seq
Transcript ID List ENST00000371698.3; ENST00000492002.1; ENST00000406555.7; ENST00000371699.5; ENST00000308874.12; ENST00000362291.1
External Link RMBase: m6A_site_847714
mod ID: M6ASITE090526 Click to Show/Hide the Full List
mod site chr9:136670650-136670651:+ [3]
Sequence TACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAATAAT
Motif Score 2.627720238
Cell/Tissue List BGC823
Seq Type List m6A-seq
Transcript ID List ENST00000362291.1; ENST00000406555.7; ENST00000308874.12; ENST00000371698.3; ENST00000371699.5; ENST00000492002.1
External Link RMBase: m6A_site_847715