m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00551)
Target Name Poly [ADP-ribose] polymerase 1 (PARP1)
Synonyms
PARP-1; ADP-ribosyltransferase diphtheria toxin-like 1; ARTD1; DNA ADP-ribosyltransferase PARP1; NAD(+) ADP-ribosyltransferase 1; ADPRT 1; Poly[ADP-ribose] synthase 1; Protein poly-ADP-ribosyltransferase PARP1
    Click to Show/Hide
Gene Name PARP1
Chromosomal Location 1q42.12
Family ARTD/PARP family
Function
Poly-ADP-ribosyltransferase that mediates poly-ADP-ribosylation of proteins and plays a key role in DNA repair. Mediates glutamate, aspartate, serine or tyrosine ADP-ribosylation of proteins: the ADP-D-ribosyl group of NAD(+) is transferred to the acceptor carboxyl group of target residues and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units . Serine ADP-ribosylation of proteins constitutes the primary form of ADP-ribosylation of proteins in response to DNA damage. Mainly mediates glutamate and aspartate ADP-ribosylation of target proteins in absence of HPF1. Following interaction with HPF1, catalyzes serine ADP-ribosylation of target proteins; HPF1 conferring serine specificity by completing the PARP1 active site . Also catalyzes tyrosine ADP-ribosylation of target proteins following interaction with HPF1. PARP1 initiates the repair of DNA breaks: recognizes and binds DNA breaks within chromatin and recruits HPF1, licensing serine ADP-ribosylation of target proteins, such as histones, thereby promoting decompaction of chromatin and the recruitment of repair factors leading to the reparation of DNA strand breaks . In addition to base excision repair (BER) pathway, also involved in double-strand breaks (DSBs) repair: together with TIMELESS, accumulates at DNA damage sites and promotes homologous recombination repair by mediating poly-ADP-ribosylation. Mediates the poly(ADP-ribosyl)ation of a number of proteins, including itself, APLF and CHFR. In addition to proteins, also able to ADP-ribosylate DNA: catalyzes ADP-ribosylation of DNA strand break termini containing terminal phosphates and a 2'-OH group in single- and double-stranded DNA, respectively. Required for PARP9 and DTX3L recruitment to DNA damage sites . PARP1-dependent PARP9-DTX3L-mediated ubiquitination promotes the rapid and specific recruitment of 53BP1/TP53BP1, UIMC1/RAP80, and BRCA1 to DNA damage sites. Acts as a regulator of transcription: positively regulates the transcription of MTUS1 and negatively regulates the transcription of MTUS2/TIP150. Plays a role in the positive regulation of IFNG transcription in T-helper 1 cells as part of an IFNG promoter-binding complex with TXK and EEF1A1. Involved in the synthesis of ATP in the nucleus, together with NMNAT1, PARG and NUDT5. Nuclear ATP generation is required for extensive chromatin remodeling events that are energy-consuming.
    Click to Show/Hide
Gene ID 142
Uniprot ID
PARP1_HUMAN
HGNC ID
HGNC:270
KEGG ID
hsa:142
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PARP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line MOLM-13 cell line Homo sapiens
Treatment: shMETTL3 MOLM13 cells
Control: MOLM13 cells
 GSE98623
Regulation
logFC: 1.69E+00
p-value: 1.05E-54
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting Poly [ADP-ribose] polymerase 1 (PARP1) mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting YTHDF1 to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Oxaliplatin Approved
 Drug Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between PARP1 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.06E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting PARP1 mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting Poly [ADP-ribose] polymerase 1 (PARP1) to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Oxaliplatin Approved
 Drug Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Targeting FTO significantly suppresses cancer cell growth and enhances chemotherapy sensitivity, which not only mediating the balance of intracellular ROS by regulating G6PD expression, but also maintaining genome instability by regulating Poly [ADP-ribose] polymerase 1 (PARP1) expression. These findings shed light on new molecular mechanisms of CRC development and treatments mediated by m6A modification.
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
In-vitro Model LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model For CDX model, nude mice (female, 4-6-week-old) were subcutaneously injected with 5 × 106 HCT116 cells on the both flank. For PDX model, the patient tumors were divided into small pieces and then inoculated on both flank of nude mice. For knockdown FTO mice model, FTO mice model, two weeks after inoculation, the shFTO#3 lenti-virus injected into the tumor for three consecutive days. For combined medication mice model, intraperitoneal injection of Rhein and Olaparib was started one week after inoculation.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting Poly [ADP-ribose] polymerase 1 (PARP1) mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting YTHDF1 to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Oxaliplatin Approved
 Drug Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting PARP1 mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting Poly [ADP-ribose] polymerase 1 (PARP1) to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Oxaliplatin Approved
 Drug Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary Targeting FTO significantly suppresses cancer cell growth and enhances chemotherapy sensitivity, which not only mediating the balance of intracellular ROS by regulating G6PD expression, but also maintaining genome instability by regulating Poly [ADP-ribose] polymerase 1 (PARP1) expression. These findings shed light on new molecular mechanisms of CRC development and treatments mediated by m6A modification.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Glutathione metabolism hsa00480
In-vitro Model LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model For CDX model, nude mice (female, 4-6-week-old) were subcutaneously injected with 5 × 106 HCT116 cells on the both flank. For PDX model, the patient tumors were divided into small pieces and then inoculated on both flank of nude mice. For knockdown FTO mice model, FTO mice model, two weeks after inoculation, the shFTO#3 lenti-virus injected into the tumor for three consecutive days. For combined medication mice model, intraperitoneal injection of Rhein and Olaparib was started one week after inoculation.
Oxaliplatin [Approved]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting Poly [ADP-ribose] polymerase 1 (PARP1) mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting YTHDF1 to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary m6A methyltransferase METTL3 facilitates oxaliplatin resistance in CD133+ gastric cancer stem cells by Promoting PARP1 mRNA stability which increases base excision repair pathway activity. METTTL3 enhances the stability of PARP1 by recruiting Poly [ADP-ribose] polymerase 1 (PARP1) to target the 3'-untranslated Region (3'-UTR) of PARP1 mRNA.
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Nucleotide excision repair hsa03420
Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process RNA stability
Excision repair
In-vitro Model SNU-719 Gastric tubular adenocarcinoma Homo sapiens CVCL_5086
MKN74 Gastric tubular adenocarcinoma Homo sapiens CVCL_2791
HEK293T Normal Homo sapiens CVCL_0063
AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
In-vivo Model 100,000 pLKO and PARP1-sh1 (PT1 and PT2) cells were mixed with matrix gel and inoculate into BALB/C nude mice, respectively. After 25 days, 6 organoid transplanted tumor mice were treated with oxaliplatin (Sellekchem, s1224) twice a week for 4 weeks at a dose of 5 mg/kg.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Fat mass and obesity-associated protein (FTO)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03445
 Crosstalk Info 
Epigenetic Regulator Histone deacetylase 1 (HDAC1)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03656
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
 Disease Info 
Drug Oxaliplatin
 Drug Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00551)
Poly [ADP-ribose] polymerase 1 (PARP1)
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004673 Click to Show/Hide the Full List
mod site chr1:226383118-226383119:- [3]
Sequence ACAGGACCGTATATTCCCCCCAGAAACCAGCGCCTCCGTGG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m5C_site_4827
mod ID: M5CSITE004674 Click to Show/Hide the Full List
mod site chr1:226408075-226408076:- [3]
Sequence ATCAGCAATCTATCAGGGAACGGCGGTGGCCGGTGCGGCGT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000366794.10; ENST00000629232.1
External Link RMBase: m5C_site_4828
N6-methyladenosine (m6A)
In total 87 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087903 Click to Show/Hide the Full List
mod site chr1:226360719-226360720:- [4]
Sequence ACCCAAGGGCTAATAGTAATACTCGATTAAAAATGCAGATG
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82067
mod ID: M6ASITE087904 Click to Show/Hide the Full List
mod site chr1:226360751-226360752:- [5]
Sequence TTCCAAATTAAAACTCTACCACAAATATACTTACCCAAGGG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82068
mod ID: M6ASITE087905 Click to Show/Hide the Full List
mod site chr1:226360759-226360760:- [4]
Sequence CTTTTGTCTTCCAAATTAAAACTCTACCACAAATATACTTA
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82069
mod ID: M6ASITE087906 Click to Show/Hide the Full List
mod site chr1:226360794-226360795:- [4]
Sequence AGTTGCATTTGAAATTCTTGACTTTCTTATGGGCACTTTTG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82070
mod ID: M6ASITE087907 Click to Show/Hide the Full List
mod site chr1:226360846-226360847:- [6]
Sequence TCCTTCTCCAGGAATACTGAACATGGGAGCTCTTGAAATAT
Motif Score 2.951386905
Cell/Tissue List brain; HEK293T; hESC-HEK293T
Seq Type List m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82071
mod ID: M6ASITE087908 Click to Show/Hide the Full List
mod site chr1:226360887-226360888:- [4]
Sequence GAACGCTAACAATTTCTCATACTTAGAAACAAAAAGAGCTT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82072
mod ID: M6ASITE087909 Click to Show/Hide the Full List
mod site chr1:226360977-226360978:- [4]
Sequence GATTTTCTTTTTTATCTTGCACTTATTGTCCCCTTTTTAGT
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82073
mod ID: M6ASITE087910 Click to Show/Hide the Full List
mod site chr1:226361005-226361006:- [4]
Sequence AAAATAAAAACTAATTTCATACTATTTAGATTTTCTTTTTT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82074
mod ID: M6ASITE087911 Click to Show/Hide the Full List
mod site chr1:226361016-226361017:- [4]
Sequence ATTTTTAGTTAAAAATAAAAACTAATTTCATACTATTTAGA
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82075
mod ID: M6ASITE087912 Click to Show/Hide the Full List
mod site chr1:226361101-226361102:- [4]
Sequence TTCCCCAGGGAAGGAAAAATACACTTCCACCCTTTTTTCTA
Motif Score 2.110482143
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82076
mod ID: M6ASITE087913 Click to Show/Hide the Full List
mod site chr1:226361127-226361128:- [4]
Sequence TTCGTTAGAATGTCTGCCTTACTGGTTTCCCCAGGGAAGGA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82077
mod ID: M6ASITE087919 Click to Show/Hide the Full List
mod site chr1:226361154-226361155:- [7]
Sequence AGACTAGTCCTATGGAAAAAACCAAGCTTCGTTAGAATGTC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82078
mod ID: M6ASITE087920 Click to Show/Hide the Full List
mod site chr1:226361172-226361173:- [7]
Sequence AGAGAGATTCTGTTGCATAGACTAGTCCTATGGAAAAAACC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82079
mod ID: M6ASITE087921 Click to Show/Hide the Full List
mod site chr1:226361210-226361211:- [4]
Sequence TTGCCAGGTAGATAAAACTGACATAGAGAAAAGGCTGGAGA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82080
mod ID: M6ASITE087922 Click to Show/Hide the Full List
mod site chr1:226361214-226361215:- [7]
Sequence TTTCTTGCCAGGTAGATAAAACTGACATAGAGAAAAGGCTG
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82081
mod ID: M6ASITE087923 Click to Show/Hide the Full List
mod site chr1:226361300-226361301:- [4]
Sequence CGTGTTAAAGGTTTTCTCTAACTTCTCAAGTCCCTTGTTTT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82082
mod ID: M6ASITE087924 Click to Show/Hide the Full List
mod site chr1:226361321-226361322:- [4]
Sequence TCAGAAAGGATTTTACAGAAACGTGTTAAAGGTTTTCTCTA
Motif Score 2.179660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000463968.5
External Link RMBase: m6A_site_82083
mod ID: M6ASITE087925 Click to Show/Hide the Full List
mod site chr1:226361327-226361328:- [4]
Sequence ACCACCTCAGAAAGGATTTTACAGAAACGTGTTAAAGGTTT
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10; ENST00000463968.5; ENST00000490921.5
External Link RMBase: m6A_site_82084
mod ID: M6ASITE087926 Click to Show/Hide the Full List
mod site chr1:226361352-226361353:- [4]
Sequence TGCTGATGGGTAGTACCTGTACTAAACCACCTCAGAAAGGA
Motif Score 3.278136905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000463968.5; ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82085
mod ID: M6ASITE087927 Click to Show/Hide the Full List
mod site chr1:226361387-226361388:- [4]
Sequence AAGCGCTTCTGCACCAACTCACCTGGCCGCTAAGTTGCTGA
Motif Score 2.026654762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000463968.5
External Link RMBase: m6A_site_82086
mod ID: M6ASITE087928 Click to Show/Hide the Full List
mod site chr1:226361438-226361439:- [5]
Sequence TTGGGAGAGGTAGCCGAGTCACACCCGGTGGCTCTGGTATG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000491816.1; ENST00000463968.5
External Link RMBase: m6A_site_82087
mod ID: M6ASITE087929 Click to Show/Hide the Full List
mod site chr1:226361473-226361474:- [7]
Sequence AACTGAAATTCAATTTTAAGACCTCCCTGTGGTAATTGGGA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; ENST00000490921.5; ENST00000491816.1; ENST00000463968.5
External Link RMBase: m6A_site_82088
mod ID: M6ASITE087930 Click to Show/Hide the Full List
mod site chr1:226361492-226361493:- [7]
Sequence AATCTGAAGTATCTGCTGAAACTGAAATTCAATTTTAAGAC
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000463968.5; ENST00000366794.10; ENST00000490921.5; ENST00000491816.1
External Link RMBase: m6A_site_82089
mod ID: M6ASITE087931 Click to Show/Hide the Full List
mod site chr1:226361538-226361539:- [5]
Sequence TAACAAGCTTCCCCTCAGGTACATTGTCTATGATATTGCTC
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000463968.5; ENST00000491816.1
External Link RMBase: m6A_site_82090
mod ID: M6ASITE087932 Click to Show/Hide the Full List
mod site chr1:226361732-226361733:- [7]
Sequence CCTCAGTCTGCCTGAAGAAGACTTAGAGTAACTTTCAGGCT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; ENST00000463968.5; ENST00000490921.5; ENST00000468608.1; ENST00000491816.1
External Link RMBase: m6A_site_82091
mod ID: M6ASITE087933 Click to Show/Hide the Full List
mod site chr1:226361979-226361980:- [4]
Sequence GGTGTGAATGACACCTCTCTACTATATAACGAGTATCCTTT
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10; ENST00000468608.1; ENST00000491816.1; ENST00000490921.5; ENST00000463968.5
External Link RMBase: m6A_site_82092
mod ID: M6ASITE087934 Click to Show/Hide the Full List
mod site chr1:226361989-226361990:- [5]
Sequence GATTTCATCTGGTGTGAATGACACCTCTCTACTATATAACG
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000463968.5; ENST00000491816.1; ENST00000468608.1; ENST00000490921.5; ENST00000366794.10
External Link RMBase: m6A_site_82093
mod ID: M6ASITE087935 Click to Show/Hide the Full List
mod site chr1:226362028-226362029:- [4]
Sequence CATTAGTCTGGATGGTGTAGACGTTCCTCTTGGGACCGGGA
Motif Score 2.871321429
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000463968.5; ENST00000366794.10; ENST00000491816.1; ENST00000468608.1; ENST00000490921.5
External Link RMBase: m6A_site_82094
mod ID: M6ASITE087936 Click to Show/Hide the Full List
mod site chr1:226362049-226362050:- [4]
Sequence TACCCCTGATCCTTCAGCTAACATTAGTCTGGATGGTGTAG
Motif Score 2.168095238
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000366794.10; ENST00000463968.5; ENST00000490921.5; ENST00000491816.1; ENST00000468608.1
External Link RMBase: m6A_site_82095
mod ID: M6ASITE087937 Click to Show/Hide the Full List
mod site chr1:226363153-226363154:- [7]
Sequence CCTCTTTTGAATAGGTATGAACTGAAGCACGCTTCACATAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000490921.5; ENST00000468608.1; ENST00000366794.10; ENST00000463968.5
External Link RMBase: m6A_site_82096
mod ID: M6ASITE087938 Click to Show/Hide the Full List
mod site chr1:226363945-226363946:- [7]
Sequence GGGAGAAGTTGCCCTTGGAAACATGTGAGTAAACCTGGCTC
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000366794.10; ENST00000490921.5; ENST00000463968.5
External Link RMBase: m6A_site_82097
mod ID: M6ASITE087939 Click to Show/Hide the Full List
mod site chr1:226363987-226363988:- [7]
Sequence CTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; ENST00000463968.5; ENST00000490921.5
External Link RMBase: m6A_site_82098
mod ID: M6ASITE087940 Click to Show/Hide the Full List
mod site chr1:226364032-226364033:- [5]
Sequence TAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCA
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10; ENST00000463968.5; ENST00000490921.5
External Link RMBase: m6A_site_82099
mod ID: M6ASITE087941 Click to Show/Hide the Full List
mod site chr1:226364069-226364070:- [7]
Sequence TCCCTTTTCCGACCTTCCAGACAGGCTACATGTTTGGTAAA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000463968.5; ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82100
mod ID: M6ASITE087942 Click to Show/Hide the Full List
mod site chr1:226364128-226364129:- [7]
Sequence CTCAAGTTGGCACTCAGTGAACAGCTGCTCCTAATTTCCCA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; rmsk_401830; ENST00000463968.5; ENST00000490921.5
External Link RMBase: m6A_site_82101
mod ID: M6ASITE087943 Click to Show/Hide the Full List
mod site chr1:226365063-226365064:- [7]
Sequence TGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82102
mod ID: M6ASITE087944 Click to Show/Hide the Full List
mod site chr1:226365116-226365117:- [5]
Sequence TGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10; ENST00000498787.1; ENST00000490921.5
External Link RMBase: m6A_site_82103
mod ID: M6ASITE087945 Click to Show/Hide the Full List
mod site chr1:226365981-226365982:- [5]
Sequence GAACACTCATGCAACCACACACAATGCGTATGACTTGGAAG
Motif Score 2.084928571
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10; ENST00000498787.1; ENST00000490921.5
External Link RMBase: m6A_site_82104
mod ID: M6ASITE087946 Click to Show/Hide the Full List
mod site chr1:226365999-226366000:- [7]
Sequence CATCAGGAAGTATGTTAAGAACACTCATGCAACCACACACA
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000498787.1
External Link RMBase: m6A_site_82105
mod ID: M6ASITE087947 Click to Show/Hide the Full List
mod site chr1:226366044-226366045:- [4]
Sequence TCTGTTTATCCAGGTGGTTGACAGAGATTCTGAAGAAGCCG
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000498787.1; ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82106
mod ID: M6ASITE087948 Click to Show/Hide the Full List
mod site chr1:226366186-226366187:- [7]
Sequence GCCCAGCCCACAGGCCTGGGACACAGGCTCTCGGTCATGCC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000498787.1; ENST00000490921.5; ENST00000366794.10
External Link RMBase: m6A_site_82107
mod ID: M6ASITE087949 Click to Show/Hide the Full List
mod site chr1:226367486-226367487:- [4]
Sequence CTATGAGAAGCTCAAAACTGACATTAAGGTAACAGGGTCAG
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000498787.1; ENST00000490921.5; ENST00000366794.10
External Link RMBase: m6A_site_82108
mod ID: M6ASITE087950 Click to Show/Hide the Full List
mod site chr1:226367490-226367491:- [7]
Sequence TCAACTATGAGAAGCTCAAAACTGACATTAAGGTAACAGGG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10; ENST00000490921.5; ENST00000498787.1
External Link RMBase: m6A_site_82109
mod ID: M6ASITE087951 Click to Show/Hide the Full List
mod site chr1:226367576-226367577:- [7]
Sequence AATGCTTGACAACCTGCTGGACATCGAGGTGGCCTACAGTC
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000498787.1
External Link RMBase: m6A_site_82110
mod ID: M6ASITE087952 Click to Show/Hide the Full List
mod site chr1:226368208-226368209:- [7]
Sequence TCCGCTCCTGAACAATGCAGACAGTGTGCAGGTAGCGCAAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10; ENST00000498787.1
External Link RMBase: m6A_site_82111
mod ID: M6ASITE087953 Click to Show/Hide the Full List
mod site chr1:226368217-226368218:- [7]
Sequence GAAGAAGCCTCCGCTCCTGAACAATGCAGACAGTGTGCAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T; HepG2
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000498787.1; ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82112
mod ID: M6ASITE087954 Click to Show/Hide the Full List
mod site chr1:226368247-226368248:- [4]
Sequence TTACACCCTGATCCCCCACGACTTTGGGATGAAGAAGCCTC
Motif Score 3.287565476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000498787.1; ENST00000366794.10; ENST00000490921.5
External Link RMBase: m6A_site_82113
mod ID: M6ASITE087955 Click to Show/Hide the Full List
mod site chr1:226368265-226368266:- [5]
Sequence GGATCTCTCAAATCGCTTTTACACCCTGATCCCCCACGACT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000490921.5; ENST00000498787.1; ENST00000366794.10
External Link RMBase: m6A_site_82114
mod ID: M6ASITE087956 Click to Show/Hide the Full List
mod site chr1:226370669-226370670:- [7]
Sequence ATGGTGGGGTGGGGCTACAGACTCTGGATTTGGGTCACTGG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000490921.5; ENST00000366794.10
External Link RMBase: m6A_site_82115
mod ID: M6ASITE087957 Click to Show/Hide the Full List
mod site chr1:226374283-226374284:- [7]
Sequence GCTCCCCAAGCCAGTTCAGGACCTCATCAAGATGATCTTTG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82116
mod ID: M6ASITE087958 Click to Show/Hide the Full List
mod site chr1:226377117-226377118:- [4]
Sequence GTTCTACCCCCTGGAGATTGACTATGGCCAGGTAACCACAT
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82117
mod ID: M6ASITE087959 Click to Show/Hide the Full List
mod site chr1:226377184-226377185:- [7]
Sequence TGAAATTATATGAAGAAAAAACCGGGAACGCTTGGCACTCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82118
mod ID: M6ASITE087960 Click to Show/Hide the Full List
mod site chr1:226377242-226377243:- [7]
Sequence ATCGGTAGCAACAAACTGGAACAGATGCCGTCCAAGGAGGA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82119
mod ID: M6ASITE087961 Click to Show/Hide the Full List
mod site chr1:226377248-226377249:- [7]
Sequence ACGGTGATCGGTAGCAACAAACTGGAACAGATGCCGTCCAA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82120
mod ID: M6ASITE087962 Click to Show/Hide the Full List
mod site chr1:226377252-226377253:- [5]
Sequence GGGTACGGTGATCGGTAGCAACAAACTGGAACAGATGCCGT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82121
mod ID: M6ASITE087963 Click to Show/Hide the Full List
mod site chr1:226379144-226379145:- [7]
Sequence TCTGGAGGACGACAAGGAAAACAGGTGAGTTCTGCAGGTGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82122
mod ID: M6ASITE087964 Click to Show/Hide the Full List
mod site chr1:226379153-226379154:- [4]
Sequence GCTGCAGCTTCTGGAGGACGACAAGGAAAACAGGTGAGTTC
Motif Score 2.865571429
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82123
mod ID: M6ASITE087965 Click to Show/Hide the Full List
mod site chr1:226379190-226379191:- [7]
Sequence TGGTGGACATCGTTAAAGGAACCAACTCCTACTACAAGCTG
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82124
mod ID: M6ASITE087966 Click to Show/Hide the Full List
mod site chr1:226379204-226379205:- [7]
Sequence TGCCACCCTTGGCCTGGTGGACATCGTTAAAGGAACCAACT
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82125
mod ID: M6ASITE087967 Click to Show/Hide the Full List
mod site chr1:226379266-226379267:- [7]
Sequence TCCTCTGGGACAGGACTGGAACACTCTGCGCATGTCCTGGA
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82126
mod ID: M6ASITE087968 Click to Show/Hide the Full List
mod site chr1:226379634-226379635:- [5]
Sequence TGTTCTCCTCCAAGGTATCAACAAATCTGAAAAGAGAATGA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82127
mod ID: M6ASITE087969 Click to Show/Hide the Full List
mod site chr1:226380037-226380038:- [5]
Sequence TCAGGAGTTGTTCTTAGCGCACATCTTGTCCCCTTGGGGGG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82128
mod ID: M6ASITE087970 Click to Show/Hide the Full List
mod site chr1:226380094-226380095:- [7]
Sequence CATCCGAGTTGTGTCTGAGGACTTCCTCCAGGACGTCTCCG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82129
mod ID: M6ASITE087971 Click to Show/Hide the Full List
mod site chr1:226380115-226380116:- [5]
Sequence GGAGGAAGTAAAGGAAGCCAACATCCGAGTTGTGTCTGAGG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82130
mod ID: M6ASITE087972 Click to Show/Hide the Full List
mod site chr1:226381096-226381097:- [5]
Sequence GAAGTTGACGGGGACGGCCAACAAGGCTTCCCTGTGCATCA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82131
mod ID: M6ASITE087973 Click to Show/Hide the Full List
mod site chr1:226381125-226381126:- [7]
Sequence GTGAAGGCCATGATTGAGAAACTCGGGGGGAAGTTGACGGG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82132
mod ID: M6ASITE087974 Click to Show/Hide the Full List
mod site chr1:226381156-226381157:- [7]
Sequence TCTCGGGAAGCTGTCCCGGAACAAGGATGAAGTGAAGGCCA
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82133
mod ID: M6ASITE087975 Click to Show/Hide the Full List
mod site chr1:226381192-226381193:- [5]
Sequence CCCAGATAAGCCATTATCCAACATGAAGATCCTGACTCTCG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82134
mod ID: M6ASITE087981 Click to Show/Hide the Full List
mod site chr1:226383052-226383053:- [7]
Sequence CTCGGCTCCTGCTGCTGTGAACTCCTCTGCTTCAGCAGGTA
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82135
mod ID: M6ASITE087992 Click to Show/Hide the Full List
mod site chr1:226383113-226383114:- [7]
Sequence ACCGTATATTCCCCCCAGAAACCAGCGCCTCCGTGGCGGCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82136
mod ID: M6ASITE088003 Click to Show/Hide the Full List
mod site chr1:226383133-226383134:- [7]
Sequence ATTGAAGGTTAAAAAACAGGACCGTATATTCCCCCCAGAAA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82137
mod ID: M6ASITE088007 Click to Show/Hide the Full List
mod site chr1:226383138-226383139:- [7]
Sequence AAGAAATTGAAGGTTAAAAAACAGGACCGTATATTCCCCCC
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82138
mod ID: M6ASITE088008 Click to Show/Hide the Full List
mod site chr1:226385535-226385536:- [7]
Sequence AGTGTATGGTCAAGACACAGACACCCAACCGGAAGGAGTGG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; hESC-HEK293T; MT4; Huh7
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82139
mod ID: M6ASITE088009 Click to Show/Hide the Full List
mod site chr1:226385541-226385542:- [7]
Sequence GGACCAAGTGTATGGTCAAGACACAGACACCCAACCGGAAG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82140
mod ID: M6ASITE088010 Click to Show/Hide the Full List
mod site chr1:226385559-226385560:- [7]
Sequence CTGGGGACGTCACTGCCTGGACCAAGTGTATGGTCAAGACA
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82141
mod ID: M6ASITE088011 Click to Show/Hide the Full List
mod site chr1:226385672-226385673:- [7]
Sequence CCACTGGCTGCAGATCTTGGACCGAGTAGCTGATGGCATGG
Motif Score 3.622404762
Cell/Tissue List HeLa; Huh7; peripheral-blood; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82142
mod ID: M6ASITE088012 Click to Show/Hide the Full List
mod site chr1:226386356-226386357:- [5]
Sequence GAAGGAGCTACTCATCTTCAACAAGCAGCAAGTGCCTTCTG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82143
mod ID: M6ASITE088013 Click to Show/Hide the Full List
mod site chr1:226386419-226386420:- [7]
Sequence TCAGAACGACCTGATCTGGAACATCAAGGACGAGCTAAAGA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; hNPCs; LCLs; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82144
mod ID: M6ASITE088014 Click to Show/Hide the Full List
mod site chr1:226388686-226388687:- [7]
Sequence GAAATCTAAAAAAGAAAAAGACAAGGATAGTAAGCTTGAAA
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; U2OS; hNPCs; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000366794.10
External Link RMBase: m6A_site_82145
mod ID: M6ASITE088015 Click to Show/Hide the Full List
mod site chr1:226390529-226390530:- [7]
Sequence TCCAGGCTGCTTTGTCAAGAACAGGGAGGAGCTGGGTTTCC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; U2OS; hNPCs; HEK293T; fibroblasts; A549; LCLs; H1299; MM6; Huh7; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10; ENST00000469663.1
External Link RMBase: m6A_site_82146
mod ID: M6ASITE088016 Click to Show/Hide the Full List
mod site chr1:226390592-226390593:- [7]
Sequence CCTGTCCAAGAAGATGGTGGACCCGGAGAAGCCACAGCTAG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; U2OS; hNPCs; HEK293T; fibroblasts; LCLs; MT4; A549; H1299; MM6; Huh7; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000469663.1; ENST00000366794.10
External Link RMBase: m6A_site_82147
mod ID: M6ASITE088017 Click to Show/Hide the Full List
mod site chr1:226392230-226392231:- [4]
Sequence ATGCCAAGTCCAACAGAAGTACGTGCAAGGGGTGTATGGAG
Motif Score 2.830077381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000366794.10; ENST00000469663.1
External Link RMBase: m6A_site_82148
mod ID: M6ASITE088018 Click to Show/Hide the Full List
mod site chr1:226392275-226392276:- [7]
Sequence TTGGTAGCAAGGCAGAGAAGACTCTGGGTGACTTTGCAGCA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; U2OS; hNPCs; HEK293T; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; peripheral-blood; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366794.10; ENST00000366792.3; ENST00000469663.1
External Link RMBase: m6A_site_82149
mod ID: M6ASITE088019 Click to Show/Hide the Full List
mod site chr1:226402216-226402217:- [6]
Sequence CAGCGGAAGCTGGAGGAGTGACAGGTGTGTACATACTGGGG
Motif Score 2.859755952
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000366790.3; ENST00000629232.1; ENST00000366792.3; ENST00000366794.10
External Link RMBase: m6A_site_82150
mod ID: M6ASITE088020 Click to Show/Hide the Full List
mod site chr1:226402237-226402238:- [7]
Sequence ACCAGCAGAAAGTCAAGAAGACAGCGGAAGCTGGAGGAGTG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; peripheral-blood; endometrial; NB4; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000629232.1; ENST00000366792.3; ENST00000366794.10; ENST00000366790.3
External Link RMBase: m6A_site_82151
mod ID: M6ASITE088021 Click to Show/Hide the Full List
mod site chr1:226402352-226402353:- [5]
Sequence ATGTTTGATGGAAAAGTCCCACACTGGTACCACTTCTCCTG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000366792.3; ENST00000366790.3; ENST00000629232.1; ENST00000366794.10
External Link RMBase: m6A_site_82152
mod ID: M6ASITE088022 Click to Show/Hide the Full List
mod site chr1:226407837-226407838:- [7]
Sequence CAGCGAGAGCATCCCCAAGGACTCGCTCCGGATGGCCATCA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; U2OS; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; endometrial; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000366790.3; ENST00000629232.1; ENST00000366794.10; ENST00000366792.3
External Link RMBase: m6A_site_82153
2'-O-Methylation (2'-O-Me)
In total 3 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000339 Click to Show/Hide the Full List
mod site chr1:226361350-226361351:- [8]
Sequence CTGATGGGTAGTACCTGTACTAAACCACCTCAGAAAGGATT
Cell/Tissue List HEK293
Seq Type List Nm-seq
Transcript ID List ENST00000463968.5; ENST00000490921.5; ENST00000366794.10
External Link RMBase: Nm_site_524
mod ID: 2OMSITE000340 Click to Show/Hide the Full List
mod site chr1:226385666-226385667:- [8]
Sequence GCTGCAGATCTTGGACCGAGTAGCTGATGGCATGGTGTTCG
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000366794.10
External Link RMBase: Nm_site_525
mod ID: 2OMSITE000344 Click to Show/Hide the Full List
mod site chr1:226386423-226386424:- [8]
Sequence AGGCTCAGAACGACCTGATCTGGAACATCAAGGACGAGCTA
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000366794.10
External Link RMBase: Nm_site_526