m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00485)

Target Name	microRNA let-7b (MIRLET7B)
Synonyms	hsa-let-7b; MIRNLET7B Click to Show/Hide
Gene Name	MIRLET7B
Chromosomal Location	22q13.31
Family	MicroRNA MIRLET7 family
Gene ID	406884
HGNC ID	HGNC:31479
miRBase ID	MI0000063

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MIRLET7B can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Responsed Drug	Metformin		Approved	Drug Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Responsed Drug	Osimertinib		Approved	Drug Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

NF-kappa-B-activating protein (NKAP) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Responsed Drug	Metformin		Approved	Drug Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Responsed Drug	Metformin		Approved	Drug Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Drug	Osimertinib		Approved	Drug Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

Metformin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

Osimertinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	The participation of Metformin decreased the bindings of DNMT3a/b to the METTL3 promoter with the help of the readers of NKAP and HNRNPA2B1.the mediation of m6A formation on pri-Let-7b processing increased the mature microRNA let-7b (MIRLET7B), whose key role is to suppress the Notch signaling and to re-captivate the Osimertinib treatment.The findings open up future drug development, targeting this pathway for lung cancer patients.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	Notch signaling pathway			hsa04330
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	H1975OR (Osimertinib resistant H1975 cells)
	HCC827OR (Osimertinib resistant HCC827 cells)

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02058		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02061		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02064		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02067		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

m6A Regulator: NF-kappa-B-activating protein (NKAP)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02059		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02062		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02065		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02068		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02060		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02063		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02066		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02069		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03380		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT03393		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05549		Crosstalk Info
Epigenetic Regulator	MicroRNA let-7b (MIRLET7B)
Crosstalk relationship	m6A → ncRNA
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

m6A Regulator: NF-kappa-B-activating protein (NKAP)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05550		Crosstalk Info
Epigenetic Regulator	MicroRNA let-7b (MIRLET7B)
Crosstalk relationship	m6A → ncRNA
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info

m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05551		Crosstalk Info
Epigenetic Regulator	MicroRNA let-7b (MIRLET7B)
Crosstalk relationship	m6A → ncRNA
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00485)

microRNA let-7b (MIRLET7B)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011447		Click to Show/Hide the Full List
mod site	chr22:46113751-46113752:+		[2]
Sequence	CCTCGGAAGATAACTATACAACCTACTGCCTTCCCTGAGGA
Transcript ID List	ENST00000385140.1; MIMAT0004482; ENST00000360737.4
External Link	RMBase: RNA-editing_site_94017

Ref 1	Stimulation of Let-7 Maturation by Metformin Improved the Response to Tyrosine Kinase Inhibitor Therapy in an m6A Dependent Manner. Front Oncol. 2022 Jan 6;11:731561. doi: 10.3389/fonc.2021.731561. eCollection 2021.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map