m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00452)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
YBX1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1 | ||
| Cell Line | PANC-1 cell line | Homo sapiens |
|
Treatment: siIGF2BP1 PANC-1 cells
Control: siControl PANC-1 cells
|
GSE161087 | |
| Regulation |
![]() ![]() |
logFC: -6.25E-01 p-value: 4.95E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Myeloid leukaemia | ICD-11: 2B33.1 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | Leukemia stem cell line (Leukemia stem cell line) | |||
| Kasumi-1 | Myeloid leukemia with maturation | Homo sapiens | CVCL_0589 | |
| MOLM-13 | Adult acute myeloid leukemia | Homo sapiens | CVCL_2119 | |
| THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 | |
| MV4-11 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0064 | |
| BV-173 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0181 | |
| NOMO-1 | Adult acute monocytic leukemia | Homo sapiens | CVCL_1609 | |
| K-562 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0004 | |
| KG-1a | Adult acute myeloid leukemia | Homo sapiens | CVCL_1824 | |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers. | |||
| Responsed Disease | Lung cancer | ICD-11: 2C25 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H520 | Lung squamous cell carcinoma | Homo sapiens | CVCL_1566 | |
| HBE (Human bronchial epithelial cell line) | ||||
| LTEP-a2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6929 | |
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
| Representative RIP-seq result supporting the interaction between YBX1 and the regulator | ||
| Cell Line | HEK293T | Homo sapiens |
| Regulation | logFC: 1.14E+00 | GSE90639 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Myeloid leukaemia | ICD-11: 2B33.1 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | Leukemia stem cell line (Leukemia stem cell line) | |||
| Kasumi-1 | Myeloid leukemia with maturation | Homo sapiens | CVCL_0589 | |
| MOLM-13 | Adult acute myeloid leukemia | Homo sapiens | CVCL_2119 | |
| THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 | |
| MV4-11 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0064 | |
| BV-173 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0181 | |
| NOMO-1 | Adult acute monocytic leukemia | Homo sapiens | CVCL_1609 | |
| K-562 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0004 | |
| KG-1a | Adult acute myeloid leukemia | Homo sapiens | CVCL_1824 | |
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
| Representative RIP-seq result supporting the interaction between YBX1 and the regulator | ||
| Cell Line | HEK293T | Homo sapiens |
| Regulation | logFC: 2.22E+00 | GSE90639 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Myeloid leukaemia | ICD-11: 2B33.1 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | Leukemia stem cell line (Leukemia stem cell line) | |||
| Kasumi-1 | Myeloid leukemia with maturation | Homo sapiens | CVCL_0589 | |
| MOLM-13 | Adult acute myeloid leukemia | Homo sapiens | CVCL_2119 | |
| THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 | |
| MV4-11 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0064 | |
| BV-173 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0181 | |
| NOMO-1 | Adult acute monocytic leukemia | Homo sapiens | CVCL_1609 | |
| K-562 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0004 | |
| KG-1a | Adult acute myeloid leukemia | Homo sapiens | CVCL_1824 | |
Protein virilizer homolog (VIRMA) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers. | |||
| Responsed Disease | Lung cancer | ICD-11: 2C25 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H520 | Lung squamous cell carcinoma | Homo sapiens | CVCL_1566 | |
| HBE (Human bronchial epithelial cell line) | ||||
| LTEP-a2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6929 | |
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
Malignant haematopoietic neoplasm [ICD-11: 2B33]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1. | |||
| Responsed Disease | Myeloid leukaemia [ICD-11: 2B33.1] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) | READER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | Leukemia stem cell line (Leukemia stem cell line) | |||
| Kasumi-1 | Myeloid leukemia with maturation | Homo sapiens | CVCL_0589 | |
| MOLM-13 | Adult acute myeloid leukemia | Homo sapiens | CVCL_2119 | |
| THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 | |
| MV4-11 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0064 | |
| BV-173 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0181 | |
| NOMO-1 | Adult acute monocytic leukemia | Homo sapiens | CVCL_1609 | |
| K-562 | Chronic myelogenous leukemia | Homo sapiens | CVCL_0004 | |
| KG-1a | Adult acute myeloid leukemia | Homo sapiens | CVCL_1824 | |
Lung cancer [ICD-11: 2C25]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers. | |||
| Responsed Disease | Lung cancer [ICD-11: 2C25] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) | READER | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H520 | Lung squamous cell carcinoma | Homo sapiens | CVCL_1566 | |
| HBE (Human bronchial epithelial cell line) | ||||
| LTEP-a2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6929 | |
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers. | |||
| Responsed Disease | Lung cancer [ICD-11: 2C25] | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H520 | Lung squamous cell carcinoma | Homo sapiens | CVCL_1566 | |
| HBE (Human bronchial epithelial cell line) | ||||
| LTEP-a2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6929 | |
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00452)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE007106 | Click to Show/Hide the Full List | ||
| mod site | chr1:42691887-42691888:+ | [5] | |
| Sequence | TTTATTTTTTTTGAGATGGAATCTCACTCTGTTGCCCAGGC | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12; ENST00000436427.1; ENST00000467957.1 | ||
| External Link | RMBase: RNA-editing_site_4808 | ||
| mod ID: A2ISITE007107 | Click to Show/Hide the Full List | ||
| mod site | chr1:42699681-42699682:+ | [6] | |
| Sequence | TGTTACTCAAGCAGTCTTGAACTCCTGCCCTCAAGTGATCC | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: RNA-editing_site_4809 | ||
2'-O-Methylation (2'-O-Me)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000080 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696902-42696903:+ | [7] | |
| Sequence | GGAGACCCTATGGGCGTCGACCACAGTATTCCAACCCTCCT | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1 | ||
| External Link | RMBase: Nm_site_157 | ||
N6-methyladenosine (m6A)
| In total 43 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE020810 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682456-42682457:+ | [8] | |
| Sequence | GTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26029 | ||
| mod ID: M6ASITE020811 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682508-42682509:+ | [9] | |
| Sequence | CCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26030 | ||
| mod ID: M6ASITE020812 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682583-42682584:+ | [8] | |
| Sequence | CCATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26031 | ||
| mod ID: M6ASITE020813 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682635-42682636:+ | [10] | |
| Sequence | CCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26032 | ||
| mod ID: M6ASITE020814 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682637-42682638:+ | [10] | |
| Sequence | CCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGC | ||
| Motif Score | 2.064285714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26033 | ||
| mod ID: M6ASITE020815 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682649-42682650:+ | [10] | |
| Sequence | CCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGG | ||
| Motif Score | 3.252583333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26034 | ||
| mod ID: M6ASITE020816 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682691-42682692:+ | [9] | |
| Sequence | GCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26035 | ||
| mod ID: M6ASITE020817 | Click to Show/Hide the Full List | ||
| mod site | chr1:42682716-42682717:+ | [11] | |
| Sequence | GGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGGTGAGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34; HepG2; HeLa; A549; U2OS; MT4; H1299; MM6; Jurkat; GSC-11; iSLK; MSC; TREX; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26036 | ||
| mod ID: M6ASITE020818 | Click to Show/Hide the Full List | ||
| mod site | chr1:42683252-42683253:+ | [10] | |
| Sequence | CGTGTGCGGCGGCGGCGGCGACTGCGTGGCCCCGCACCCGG | ||
| Motif Score | 3.287565476 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000467957.1; ENST00000332220.10; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26037 | ||
| mod ID: M6ASITE020819 | Click to Show/Hide the Full List | ||
| mod site | chr1:42683419-42683420:+ | [8] | |
| Sequence | CAGCAACGAAGGTTTTGGGAACAGTAAAATGGTTCAATGTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; CD34; HEK293T; A549; LCLs; H1299; MM6; Huh7 | ||
| Seq Type List | m6A-seq; DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1 | ||
| External Link | RMBase: m6A_site_26038 | ||
| mod ID: M6ASITE020820 | Click to Show/Hide the Full List | ||
| mod site | chr1:42683444-42683445:+ | [10] | |
| Sequence | AAAATGGTTCAATGTAAGGAACGGATATGGTTTCATCAACA | ||
| Motif Score | 2.925321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000467957.1; ENST00000436427.1; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26039 | ||
| mod ID: M6ASITE020821 | Click to Show/Hide the Full List | ||
| mod site | chr1:42693516-42693517:+ | [9] | |
| Sequence | ACCAAGGAAGATGTATTTGTACACCAGGTGAGTGCTTGTGT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000467957.1; ENST00000332220.10; ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26040 | ||
| mod ID: M6ASITE020822 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696217-42696218:+ | [12] | |
| Sequence | GACTGCCATAAAGAAGAATAACCCCAGGAAGTACCTTCGCA | ||
| Motif Score | 2.147452381 | ||
| Cell/Tissue List | AML | ||
| Seq Type List | miCLIP | ||
| Transcript ID List | ENST00000321358.12; ENST00000332220.10; ENST00000436427.1; ENST00000467957.1 | ||
| External Link | RMBase: m6A_site_26041 | ||
| mod ID: M6ASITE020823 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696255-42696256:+ | [8] | |
| Sequence | GCAGTGTAGGAGATGGAGAGACTGTGGAGTTTGATGTTGTT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; BGC823; LCLs; A549; H1299; MM6; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000321358.12; ENST00000467957.1; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26042 | ||
| mod ID: M6ASITE020824 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696662-42696663:+ | [10] | |
| Sequence | GTGCGGAGGCAGCAAATGTTACAGGTCCTGGTGGTGTTCCA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1 | ||
| External Link | RMBase: m6A_site_26043 | ||
| mod ID: M6ASITE020825 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696708-42696709:+ | [8] | |
| Sequence | AGGCAGTAAATATGCAGCAGACCGTAACCATTATAGACGCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; BGC823; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26044 | ||
| mod ID: M6ASITE020826 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696751-42696752:+ | [10] | |
| Sequence | CCACGTCGTAGGGGTCCTCCACGCAATTACCAGCAAAATTA | ||
| Motif Score | 2.027047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000467957.1; ENST00000321358.12; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26045 | ||
| mod ID: M6ASITE020827 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696759-42696760:+ | [10] | |
| Sequence | TAGGGGTCCTCCACGCAATTACCAGCAAAATTACCAGAATA | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000467957.1; ENST00000332220.10; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26046 | ||
| mod ID: M6ASITE020828 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696835-42696836:+ | [9] | |
| Sequence | GCTCCCGAAGGCCAGGCCCAACAACGCCGGCCCTACCGCAG | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26047 | ||
| mod ID: M6ASITE020829 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696876-42696877:+ | [9] | |
| Sequence | GCGAAGGTTCCCACCTTACTACATGCGGAGACCCTATGGGC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1 | ||
| External Link | RMBase: m6A_site_26048 | ||
| mod ID: M6ASITE020830 | Click to Show/Hide the Full List | ||
| mod site | chr1:42696886-42696887:+ | [8] | |
| Sequence | CCACCTTACTACATGCGGAGACCCTATGGGCGTCGACCACA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MT4; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000467957.1; ENST00000332220.10; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26049 | ||
| mod ID: M6ASITE020831 | Click to Show/Hide the Full List | ||
| mod site | chr1:42697186-42697187:+ | [9] | |
| Sequence | TTGTCTTTTTCAGGGTGCTGACAACCAGGGTGCAGGAGAAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000332220.10; ENST00000321358.12; ENST00000467957.1 | ||
| External Link | RMBase: m6A_site_26050 | ||
| mod ID: M6ASITE020832 | Click to Show/Hide the Full List | ||
| mod site | chr1:42697205-42697206:+ | [8] | |
| Sequence | GACAACCAGGGTGCAGGAGAACAAGGTAGACCAGTGAGGCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; CD34; hESC-HEK293T; HepG2; MT4; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10 | ||
| External Link | RMBase: m6A_site_26051 | ||
| mod ID: M6ASITE020833 | Click to Show/Hide the Full List | ||
| mod site | chr1:42697214-42697215:+ | [8] | |
| Sequence | GGTGCAGGAGAACAAGGTAGACCAGTGAGGCAGAATATGTA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MT4; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26052 | ||
| mod ID: M6ASITE020834 | Click to Show/Hide the Full List | ||
| mod site | chr1:42697247-42697248:+ | [8] | |
| Sequence | AATATGTATCGGGGATATAGACCACGATTCCGCAGGTATGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; hNPCs; MT4; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000332220.10; ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26053 | ||
| mod ID: M6ASITE020835 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700798-42700799:+ | [8] | |
| Sequence | AGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGACGGCAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; CD34; HEK293T; HepG2; hNPCs; MT4; A549; H1299; Huh7 | ||
| Seq Type List | m6A-seq; DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26054 | ||
| mod ID: M6ASITE020836 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700850-42700851:+ | [8] | |
| Sequence | AAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; hNPCs; LCLs; MT4; A549; H1299; MM6; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26055 | ||
| mod ID: M6ASITE020837 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700890-42700891:+ | [10] | |
| Sequence | TCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGAC | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26056 | ||
| mod ID: M6ASITE020838 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700909-42700910:+ | [10] | |
| Sequence | AACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACC | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26057 | ||
| mod ID: M6ASITE020839 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700920-42700921:+ | [11] | |
| Sequence | CCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | CD34; HepG2; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26058 | ||
| mod ID: M6ASITE020840 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700927-42700928:+ | [11] | |
| Sequence | AGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | CD34; HepG2; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26059 | ||
| mod ID: M6ASITE020841 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700930-42700931:+ | [13] | |
| Sequence | CGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | brain; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26060 | ||
| mod ID: M6ASITE020842 | Click to Show/Hide the Full List | ||
| mod site | chr1:42700946-42700947:+ | [11] | |
| Sequence | AACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; HEK293T; hESC-HEK293T; HepG2; HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26061 | ||
| mod ID: M6ASITE020843 | Click to Show/Hide the Full List | ||
| mod site | chr1:42701992-42701993:+ | [9] | |
| Sequence | CTTTACAGTTTAGTCATCCAACAAGAAGAAATATGAAATTC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26062 | ||
| mod ID: M6ASITE020844 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702029-42702030:+ | [10] | |
| Sequence | ATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | DART-seq; MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; rmsk_99072; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26063 | ||
| mod ID: M6ASITE020845 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702049-42702050:+ | [8] | |
| Sequence | ACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26064 | ||
| mod ID: M6ASITE020846 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702077-42702078:+ | [10] | |
| Sequence | TGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCT | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26065 | ||
| mod ID: M6ASITE020847 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702091-42702092:+ | [8] | |
| Sequence | CCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; LCLs; H1299; Huh7 | ||
| Seq Type List | m6A-seq; DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26066 | ||
| mod ID: M6ASITE020848 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702134-42702135:+ | [10] | |
| Sequence | ATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTG | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26067 | ||
| mod ID: M6ASITE020849 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702161-42702162:+ | [10] | |
| Sequence | GACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26068 | ||
| mod ID: M6ASITE020850 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702165-42702166:+ | [10] | |
| Sequence | TCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCT | ||
| Motif Score | 2.179660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26069 | ||
| mod ID: M6ASITE020851 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702199-42702200:+ | [10] | |
| Sequence | AAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAA | ||
| Motif Score | 2.084416667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000436427.1; ENST00000321358.12 | ||
| External Link | RMBase: m6A_site_26070 | ||
| mod ID: M6ASITE020852 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702284-42702285:+ | [9] | |
| Sequence | TTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: m6A_site_26071 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000035 | Click to Show/Hide the Full List | ||
| mod site | chr1:42702282-42702283:+ | [14] | |
| Sequence | TTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAA | ||
| Transcript ID List | ENST00000321358.12; ENST00000436427.1 | ||
| External Link | RMBase: Pseudo_site_140 | ||
References

