m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00452)

Target Name	Y-box-binding protein 1 (YBX1)
Synonyms	YB-1; CCAAT-binding transcription factor I subunit A; CBF-A; DNA-binding protein B; DBPB; Enhancer factor I subunit A; EFI-A; Nuclease-sensitive element-binding protein 1; Y-box transcription factor; NSEP1; YB1 Click to Show/Hide
Gene Name	YBX1
Chromosomal Location	1p34.2
Family	YBX1 family
Function	DNA- and RNA-binding protein involved in various processes, such as translational repression, RNA stabilization, mRNA splicing, DNA repair and transcription regulation. Predominantly acts as a RNA-binding protein: binds preferentially to the 5'-[CU]CUGCG-3' RNA motif and specifically recognizes mRNA transcripts modified by C5-methylcytosine (m5C). Promotes mRNA stabilization: acts by binding to m5C-containing mRNAs and recruiting the mRNA stability maintainer ELAVL1, thereby preventing mRNA decay. Component of the CRD-mediated complex that promotes MYC mRNA stability. Contributes to the regulation of translation by modulating the interaction between the mRNA and eukaryotic initiation factors (By similarity). Plays a key role in RNA composition of extracellular exosomes by defining the sorting of small non-coding RNAs, such as tRNAs, Y RNAs, Vault RNAs and miRNAs. Probably sorts RNAs in exosomes by recognizing and binding C5-methylcytosine (m5C)-containing RNAs. Acts as a key effector of epidermal progenitors by preventing epidermal progenitor senescence: acts by regulating the translation of a senescence-associated subset of cytokine mRNAs, possibly by binding to m5C-containing mRNAs. Also involved in pre-mRNA alternative splicing regulation: binds to splice sites in pre-mRNA and regulates splice site selection. Also able to bind DNA: regulates transcription of the multidrug resistance gene MDR1 is enhanced in presence of the APEX1 acetylated form at 'Lys-6' and 'Lys-7'. Binds to promoters that contain a Y-box (5'-CTGATTGGCCAA-3'), such as MDR1 and HLA class II genes. Promotes separation of DNA strands that contain mismatches or are modified by cisplatin. Has endonucleolytic activity and can introduce nicks or breaks into double-stranded DNA, suggesting a role in DNA repair. The secreted form acts as an extracellular mitogen and stimulates cell migration and proliferation. Click to Show/Hide
Gene ID	4904
Uniprot ID	YBOX1_HUMAN
HGNC ID	HGNC:8014
KEGG ID	hsa:4904

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

YBX1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	PANC-1 cell line	Homo sapiens
Treatment: siIGF2BP1 PANC-1 cells Control: siControl PANC-1 cells		GSE161087
Regulation		logFC: -6.25E-01 p-value: 4.95E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation	Up regulation
Responsed Disease	Myeloid leukaemia		ICD-11: 2B33.1	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	Leukemia stem cell line (Leukemia stem cell line)
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	BV-173	Chronic myelogenous leukemia	Homo sapiens	CVCL_0181
	NOMO-1	Adult acute monocytic leukemia	Homo sapiens	CVCL_1609
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KG-1a	Adult acute myeloid leukemia	Homo sapiens	CVCL_1824
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between YBX1 and the regulator*
Cell Line	HEK293T	Homo sapiens
Regulation	logFC: 1.14E+00	GSE90639

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation	Up regulation
Responsed Disease	Myeloid leukaemia		ICD-11: 2B33.1	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	Leukemia stem cell line (Leukemia stem cell line)
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	BV-173	Chronic myelogenous leukemia	Homo sapiens	CVCL_0181
	NOMO-1	Adult acute monocytic leukemia	Homo sapiens	CVCL_1609
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KG-1a	Adult acute myeloid leukemia	Homo sapiens	CVCL_1824

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between YBX1 and the regulator*
Cell Line	HEK293T	Homo sapiens
Regulation	logFC: 2.22E+00	GSE90639

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Target Regulation	Up regulation
Responsed Disease	Myeloid leukaemia		ICD-11: 2B33.1	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	Leukemia stem cell line (Leukemia stem cell line)
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	BV-173	Chronic myelogenous leukemia	Homo sapiens	CVCL_0181
	NOMO-1	Adult acute monocytic leukemia	Homo sapiens	CVCL_1609
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KG-1a	Adult acute myeloid leukemia	Homo sapiens	CVCL_1824

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Malignant haematopoietic neoplasm [ICD-11: 2B33]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Y-box-binding protein 1 (YBX1) selectively functions in regulating survival of myeloid leukemia cells. YBX1 interacts with insulin-like growth factor 2 messenger RNA (mRNA)-binding proteins (IGF2BPs) and stabilizes m6A-tagged RNA. YBX1 deficiency dysregulates the expression of apoptosis-related genes and promotes mRNA decay of MYC and BCL2 in an m6A-dependent manner, which contributes to the defective survival that results from deletion of YBX1.
Responsed Disease	Myeloid leukaemia [ICD-11: 2B33.1]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis
In-vitro Model	Leukemia stem cell line (Leukemia stem cell line)
	Kasumi-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_0589
	MOLM-13	Adult acute myeloid leukemia	Homo sapiens	CVCL_2119
	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	BV-173	Chronic myelogenous leukemia	Homo sapiens	CVCL_0181
	NOMO-1	Adult acute monocytic leukemia	Homo sapiens	CVCL_1609
	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KG-1a	Adult acute myeloid leukemia	Homo sapiens	CVCL_1824

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, EGR2, Y-box-binding protein 1 (YBX1), and TLX, which were associated with lung cancers.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Protein virilizer homolog (VIRMA)		WRITER	Regulator Info
Cell Process	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBE (Human bronchial epithelial cell line)
	LTEP-a2	Endocervical adenocarcinoma	Homo sapiens	CVCL_6929
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00452)

Y-box-binding protein 1 (YBX1)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007106		Click to Show/Hide the Full List
mod site	chr1:42691887-42691888:+		[5]
Sequence	TTTATTTTTTTTGAGATGGAATCTCACTCTGTTGCCCAGGC
Transcript ID List	ENST00000332220.10; ENST00000321358.12; ENST00000436427.1; ENST00000467957.1
External Link	RMBase: RNA-editing_site_4808
mod ID: A2ISITE007107		Click to Show/Hide the Full List
mod site	chr1:42699681-42699682:+		[6]
Sequence	TGTTACTCAAGCAGTCTTGAACTCCTGCCCTCAAGTGATCC
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: RNA-editing_site_4809

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000080		Click to Show/Hide the Full List
mod site	chr1:42696902-42696903:+		[7]
Sequence	GGAGACCCTATGGGCGTCGACCACAGTATTCCAACCCTCCT
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1
External Link	RMBase: Nm_site_157

N6-methyladenosine (m6A)

In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE020810		Click to Show/Hide the Full List
mod site	chr1:42682456-42682457:+		[8]
Sequence	GTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26029
mod ID: M6ASITE020811		Click to Show/Hide the Full List
mod site	chr1:42682508-42682509:+		[9]
Sequence	CCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26030
mod ID: M6ASITE020812		Click to Show/Hide the Full List
mod site	chr1:42682583-42682584:+		[8]
Sequence	CCATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26031
mod ID: M6ASITE020813		Click to Show/Hide the Full List
mod site	chr1:42682635-42682636:+		[10]
Sequence	CCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGG
Motif Score	2.865571429
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000321358.12; ENST00000332220.10
External Link	RMBase: m6A_site_26032
mod ID: M6ASITE020814		Click to Show/Hide the Full List
mod site	chr1:42682637-42682638:+		[10]
Sequence	CCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGC
Motif Score	2.064285714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26033
mod ID: M6ASITE020815		Click to Show/Hide the Full List
mod site	chr1:42682649-42682650:+		[10]
Sequence	CCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGG
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26034
mod ID: M6ASITE020816		Click to Show/Hide the Full List
mod site	chr1:42682691-42682692:+		[9]
Sequence	GCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26035
mod ID: M6ASITE020817		Click to Show/Hide the Full List
mod site	chr1:42682716-42682717:+		[11]
Sequence	GGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGGTGAGG
Motif Score	3.643047619
Cell/Tissue List	CD34; HepG2; HeLa; A549; U2OS; MT4; H1299; MM6; Jurkat; GSC-11; iSLK; MSC; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26036
mod ID: M6ASITE020818		Click to Show/Hide the Full List
mod site	chr1:42683252-42683253:+		[10]
Sequence	CGTGTGCGGCGGCGGCGGCGACTGCGTGGCCCCGCACCCGG
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000467957.1; ENST00000332220.10; ENST00000321358.12
External Link	RMBase: m6A_site_26037
mod ID: M6ASITE020819		Click to Show/Hide the Full List
mod site	chr1:42683419-42683420:+		[8]
Sequence	CAGCAACGAAGGTTTTGGGAACAGTAAAATGGTTCAATGTA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; A549; LCLs; H1299; MM6; Huh7
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1
External Link	RMBase: m6A_site_26038
mod ID: M6ASITE020820		Click to Show/Hide the Full List
mod site	chr1:42683444-42683445:+		[10]
Sequence	AAAATGGTTCAATGTAAGGAACGGATATGGTTTCATCAACA
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000321358.12; ENST00000467957.1; ENST00000436427.1; ENST00000332220.10
External Link	RMBase: m6A_site_26039
mod ID: M6ASITE020821		Click to Show/Hide the Full List
mod site	chr1:42693516-42693517:+		[9]
Sequence	ACCAAGGAAGATGTATTTGTACACCAGGTGAGTGCTTGTGT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000467957.1; ENST00000332220.10; ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26040
mod ID: M6ASITE020822		Click to Show/Hide the Full List
mod site	chr1:42696217-42696218:+		[12]
Sequence	GACTGCCATAAAGAAGAATAACCCCAGGAAGTACCTTCGCA
Motif Score	2.147452381
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000321358.12; ENST00000332220.10; ENST00000436427.1; ENST00000467957.1
External Link	RMBase: m6A_site_26041
mod ID: M6ASITE020823		Click to Show/Hide the Full List
mod site	chr1:42696255-42696256:+		[8]
Sequence	GCAGTGTAGGAGATGGAGAGACTGTGGAGTTTGATGTTGTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; BGC823; LCLs; A549; H1299; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000321358.12; ENST00000467957.1; ENST00000436427.1
External Link	RMBase: m6A_site_26042
mod ID: M6ASITE020824		Click to Show/Hide the Full List
mod site	chr1:42696662-42696663:+		[10]
Sequence	GTGCGGAGGCAGCAAATGTTACAGGTCCTGGTGGTGTTCCA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1
External Link	RMBase: m6A_site_26043
mod ID: M6ASITE020825		Click to Show/Hide the Full List
mod site	chr1:42696708-42696709:+		[8]
Sequence	AGGCAGTAAATATGCAGCAGACCGTAACCATTATAGACGCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; BGC823; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10
External Link	RMBase: m6A_site_26044
mod ID: M6ASITE020826		Click to Show/Hide the Full List
mod site	chr1:42696751-42696752:+		[10]
Sequence	CCACGTCGTAGGGGTCCTCCACGCAATTACCAGCAAAATTA
Motif Score	2.027047619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000467957.1; ENST00000321358.12; ENST00000332220.10
External Link	RMBase: m6A_site_26045
mod ID: M6ASITE020827		Click to Show/Hide the Full List
mod site	chr1:42696759-42696760:+		[10]
Sequence	TAGGGGTCCTCCACGCAATTACCAGCAAAATTACCAGAATA
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000321358.12; ENST00000467957.1; ENST00000332220.10; ENST00000436427.1
External Link	RMBase: m6A_site_26046
mod ID: M6ASITE020828		Click to Show/Hide the Full List
mod site	chr1:42696835-42696836:+		[9]
Sequence	GCTCCCGAAGGCCAGGCCCAACAACGCCGGCCCTACCGCAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10
External Link	RMBase: m6A_site_26047
mod ID: M6ASITE020829		Click to Show/Hide the Full List
mod site	chr1:42696876-42696877:+		[9]
Sequence	GCGAAGGTTCCCACCTTACTACATGCGGAGACCCTATGGGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000332220.10; ENST00000467957.1
External Link	RMBase: m6A_site_26048
mod ID: M6ASITE020830		Click to Show/Hide the Full List
mod site	chr1:42696886-42696887:+		[8]
Sequence	CCACCTTACTACATGCGGAGACCCTATGGGCGTCGACCACA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000321358.12; ENST00000467957.1; ENST00000332220.10; ENST00000436427.1
External Link	RMBase: m6A_site_26049
mod ID: M6ASITE020831		Click to Show/Hide the Full List
mod site	chr1:42697186-42697187:+		[9]
Sequence	TTGTCTTTTTCAGGGTGCTGACAACCAGGGTGCAGGAGAAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000436427.1; ENST00000332220.10; ENST00000321358.12; ENST00000467957.1
External Link	RMBase: m6A_site_26050
mod ID: M6ASITE020832		Click to Show/Hide the Full List
mod site	chr1:42697205-42697206:+		[8]
Sequence	GACAACCAGGGTGCAGGAGAACAAGGTAGACCAGTGAGGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; hESC-HEK293T; HepG2; MT4; A549; H1299; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12; ENST00000467957.1; ENST00000332220.10
External Link	RMBase: m6A_site_26051
mod ID: M6ASITE020833		Click to Show/Hide the Full List
mod site	chr1:42697214-42697215:+		[8]
Sequence	GGTGCAGGAGAACAAGGTAGACCAGTGAGGCAGAATATGTA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26052
mod ID: M6ASITE020834		Click to Show/Hide the Full List
mod site	chr1:42697247-42697248:+		[8]
Sequence	AATATGTATCGGGGATATAGACCACGATTCCGCAGGTATGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; hNPCs; MT4; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000332220.10; ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26053
mod ID: M6ASITE020835		Click to Show/Hide the Full List
mod site	chr1:42700798-42700799:+		[8]
Sequence	AGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGACGGCAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; MT4; A549; H1299; Huh7
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26054
mod ID: M6ASITE020836		Click to Show/Hide the Full List
mod site	chr1:42700850-42700851:+		[8]
Sequence	AAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; hNPCs; LCLs; MT4; A549; H1299; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26055
mod ID: M6ASITE020837		Click to Show/Hide the Full List
mod site	chr1:42700890-42700891:+		[10]
Sequence	TCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGAC
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26056
mod ID: M6ASITE020838		Click to Show/Hide the Full List
mod site	chr1:42700909-42700910:+		[10]
Sequence	AACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACC
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26057
mod ID: M6ASITE020839		Click to Show/Hide the Full List
mod site	chr1:42700920-42700921:+		[11]
Sequence	CCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCA
Motif Score	2.185083333
Cell/Tissue List	CD34; HepG2; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26058
mod ID: M6ASITE020840		Click to Show/Hide the Full List
mod site	chr1:42700927-42700928:+		[11]
Sequence	AGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGAC
Motif Score	2.185083333
Cell/Tissue List	CD34; HepG2; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26059
mod ID: M6ASITE020841		Click to Show/Hide the Full List
mod site	chr1:42700930-42700931:+		[13]
Sequence	CGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAA
Motif Score	2.053113095
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26060
mod ID: M6ASITE020842		Click to Show/Hide the Full List
mod site	chr1:42700946-42700947:+		[11]
Sequence	AACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCA
Motif Score	2.897386905
Cell/Tissue List	CD34; HEK293T; hESC-HEK293T; HepG2; HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26061
mod ID: M6ASITE020843		Click to Show/Hide the Full List
mod site	chr1:42701992-42701993:+		[9]
Sequence	CTTTACAGTTTAGTCATCCAACAAGAAGAAATATGAAATTC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26062
mod ID: M6ASITE020844		Click to Show/Hide the Full List
mod site	chr1:42702029-42702030:+		[10]
Sequence	ATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hESC-HEK293T; HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	DART-seq; MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; rmsk_99072; ENST00000321358.12
External Link	RMBase: m6A_site_26063
mod ID: M6ASITE020845		Click to Show/Hide the Full List
mod site	chr1:42702049-42702050:+		[8]
Sequence	ACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; hNPCs; LCLs; A549; H1299; MM6; Huh7; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26064
mod ID: M6ASITE020846		Click to Show/Hide the Full List
mod site	chr1:42702077-42702078:+		[10]
Sequence	TGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCT
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26065
mod ID: M6ASITE020847		Click to Show/Hide the Full List
mod site	chr1:42702091-42702092:+		[8]
Sequence	CCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; hNPCs; LCLs; H1299; Huh7
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26066
mod ID: M6ASITE020848		Click to Show/Hide the Full List
mod site	chr1:42702134-42702135:+		[10]
Sequence	ATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTG
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26067
mod ID: M6ASITE020849		Click to Show/Hide the Full List
mod site	chr1:42702161-42702162:+		[10]
Sequence	GACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAA
Motif Score	2.168095238
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26068
mod ID: M6ASITE020850		Click to Show/Hide the Full List
mod site	chr1:42702165-42702166:+		[10]
Sequence	TCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCT
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26069
mod ID: M6ASITE020851		Click to Show/Hide the Full List
mod site	chr1:42702199-42702200:+		[10]
Sequence	AAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAA
Motif Score	2.084416667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000436427.1; ENST00000321358.12
External Link	RMBase: m6A_site_26070
mod ID: M6ASITE020852		Click to Show/Hide the Full List
mod site	chr1:42702284-42702285:+		[9]
Sequence	TTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: m6A_site_26071

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000035		Click to Show/Hide the Full List
mod site	chr1:42702282-42702283:+		[14]
Sequence	TTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAA
Transcript ID List	ENST00000321358.12; ENST00000436427.1
External Link	RMBase: Pseudo_site_140

Ref 1	YBX1 is required for maintaining myeloid leukemia cell survival by regulating BCL2 stability in an m6A-dependent manner. Blood. 2021 Jul 8;138(1):71-85. doi: 10.1182/blood.2020009676.
Ref 2	Identification of pathology-specific regulators of m(6)A RNA modification to optimize lung cancer management in the context of predictive, preventive, and personalized medicine. EPMA J. 2020 Jul 29;11(3):485-504. doi: 10.1007/s13167-020-00220-3. eCollection 2020 Sep.
Ref 3	The impact of P-glycoprotein and breast cancer resistance protein on the brain pharmacokinetics and pharmacodynamics of a panel of MEK inhibitors. Int J Cancer. 2018 Jan 15;142(2):381-391. doi: 10.1002/ijc.31052. Epub 2017 Oct 4.
Ref 4	Caco-2 permeability, P-glycoprotein transport ratios and brain penetration of heterocyclic drugs. Int J Pharm. 2003 Sep 16;263(1-2):113-22. doi: 10.1016/s0378-5173(03)00372-7.
Ref 5	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 6	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 7	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 11	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 12	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 13	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 14	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map