m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00446)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
VEGFA
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP2 | ||
| Cell Line | ES-2 cell line | Homo sapiens |
|
Treatment: siIGF2BP2 ES-2 cells
Control: siControl ES-2 cells
|
GSE109604 | |
| Regulation |
![]() ![]() |
logFC: -6.36E-01 p-value: 3.11E-02 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP2-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | MOLM-13 cell line | Homo sapiens |
|
Treatment: shMETTL3 MOLM13 cells
Control: MOLM13 cells
|
GSE98623 | |
| Regulation |
![]() ![]() |
logFC: -8.11E-01 p-value: 1.38E-19 |
| More Results | Click to View More RNA-seq Results | |
| In total 3 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | Deletion of Mettl3 leads to the suppression of TEK and Vascular endothelial growth factor A (VEGFA),ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Cell Process | Cellular proliferation and survival | |||
| In-vitro Model | UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene. | |||
| Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene | [3] | |||
| Response Summary | Mettl3 knockdown not only reduced the expression of Vascular endothelial growth factor A (VEGFA) but also decreased the level of its splice variants, vegfa-164 and vegfa-188, in Mettl3-deficient BMSCs. These findings contribute to novel progress in understanding the role of epitranscriptomic regulation in the osteogenic differentiation of BMSCs. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Diseases of the musculoskeletal system | ICD-11: FC0Z | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Alternative splicing | |||
| In-vitro Model | BMSCs (BMSCs were obtained from the femurs and tibias of 2-3-week-old Sprague-Dawley male rats (Animal Center of Sun Yat-sen University)) | |||
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [4] | |||
| Response Summary | Knockdown of IGF2BP3 repressed DNA replication in the S phase of cell cycle and angiogenesis via reading m6A modification of CCND1 and Vascular endothelial growth factor A (VEGFA) respectively. Knockdown of IGF2BP3 repressed angiogenesis in colon cancer via regulating VEGF. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colon cancer | ICD-11: 2B90 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| VEGF signaling pathway | hsa04370 | |||
| Cell Process | Arrest cell cycle at S phase | |||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW1116 | Colon adenocarcinoma | Homo sapiens | CVCL_0544 | |
| RKO | Colon carcinoma | Homo sapiens | CVCL_0504 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| In-vivo Model | All the mice (n = 12) were equally and randomly divided into the HCT-scr and HCT-shMETTL3 group. 3 × 106 HCT-scr or HCT-shIGF2BP3 cells suspended in 100 uL PBS were injected subcutaneously from the axilla of each nude mice. After 1 weeks, the long (L) and short (S) diameter of the tumors were measured with vernier caliper every 3 days (tumor volume = L*S2/2). The growth curve of subcutaneous tumors was drawn on the basis of the measured tumor volume. All mice were killed after 17 days since injection of colon cancer cells and subcutaneous tumors were removed completely. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP3-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
Colon cancer [ICD-11: 2B90]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [4] | |||
| Response Summary | Knockdown of IGF2BP3 repressed DNA replication in the S phase of cell cycle and angiogenesis via reading m6A modification of CCND1 and Vascular endothelial growth factor A (VEGFA) respectively. Knockdown of IGF2BP3 repressed angiogenesis in colon cancer via regulating VEGF. | |||
| Responsed Disease | Colon cancer [ICD-11: 2B90] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Cell cycle | hsa04110 | ||
| VEGF signaling pathway | hsa04370 | |||
| Cell Process | Arrest cell cycle at S phase | |||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW1116 | Colon adenocarcinoma | Homo sapiens | CVCL_0544 | |
| RKO | Colon carcinoma | Homo sapiens | CVCL_0504 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| In-vivo Model | All the mice (n = 12) were equally and randomly divided into the HCT-scr and HCT-shMETTL3 group. 3 × 106 HCT-scr or HCT-shIGF2BP3 cells suspended in 100 uL PBS were injected subcutaneously from the axilla of each nude mice. After 1 weeks, the long (L) and short (S) diameter of the tumors were measured with vernier caliper every 3 days (tumor volume = L*S2/2). The growth curve of subcutaneous tumors was drawn on the basis of the measured tumor volume. All mice were killed after 17 days since injection of colon cancer cells and subcutaneous tumors were removed completely. | |||
Colorectal cancer [ICD-11: 2B91]
| In total 3 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP2-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP3-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
| Experiment 3 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | EphA2 and Vascular endothelial growth factor A (VEGFA) targeted by METTL3 via different IGF2BP-dependent mechanisms were found to promote vasculogenic mimicry (VM) formation via PI3K/AKT/mTOR and ERK1/2 signaling in CRC. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| In-vitro Model | SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| NCM460 | Normal | Homo sapiens | CVCL_0460 | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 | |
| In-vivo Model | A total of 8 × 106 wild-type (WT) or METTL3-knockdown cells were injected into the dorsal flanks of 6-week-old nude mice. Seven mice were randomly selected to calculate the volume according to the following formula: V = (width2 × length)/2. Mice were euthanized three weeks after injection and tumors removed, weighed, fixed, and embedded for immunohistochemical analysis. | |||
Bladder cancer [ICD-11: 2C94]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | Deletion of Mettl3 leads to the suppression of TEK and Vascular endothelial growth factor A (VEGFA),ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cellular proliferation and survival | |||
| In-vitro Model | UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene. | |||
Diseases of the musculoskeletal system [ICD-11: FC0Z]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [3] | |||
| Response Summary | Mettl3 knockdown not only reduced the expression of Vascular endothelial growth factor A (VEGFA) but also decreased the level of its splice variants, vegfa-164 and vegfa-188, in Mettl3-deficient BMSCs. These findings contribute to novel progress in understanding the role of epitranscriptomic regulation in the osteogenic differentiation of BMSCs. | |||
| Responsed Disease | Diseases of the musculoskeletal system [ICD-11: FC0Z] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Alternative splicing | |||
| In-vitro Model | BMSCs (BMSCs were obtained from the femurs and tibias of 2-3-week-old Sprague-Dawley male rats (Animal Center of Sun Yat-sen University)) | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03579 | ||
| Epigenetic Regulator | Histone acetyltransferase p300 (P300) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
| Crosstalk ID: M6ACROT03624 | ||
| Epigenetic Regulator | N-lysine methyltransferase SMYD2 (SMYD2) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00446)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE001514 | Click to Show/Hide the Full List | ||
| mod site | chr6:43772317-43772318:+ | [10] | |
| Sequence | TGGCCCCAGAGTCCAGGGAAAGGATGATCACTGTCAGAAGT | ||
| Transcript ID List | ENST00000230480.10; ENST00000523125.5; ENST00000519767.5; ENST00000425836.6; ENST00000640499.1; ENST00000372055.8; ENST00000372077.8; ENST00000518689.5; ENST00000518538.5; ENST00000640482.1; ENST00000617771.5; ENST00000512683.1; ENST00000413642.7; ENST00000523950.5; ENST00000482630.6; ENST00000523873.5; ENST00000457104.6; ENST00000518824.5; ENST00000520948.5; ENST00000615393.5; ENST00000324450.10; ENST00000372064.8; ENST00000640653.1; ENST00000611736.5; ENST00000476772.5; ENST00000417285.6; ENST00000372067.7; ENST00000621747.5 | ||
| External Link | RMBase: RNA-editing_site_116648 | ||
| mod ID: A2ISITE001515 | Click to Show/Hide the Full List | ||
| mod site | chr6:43774372-43774373:+ | [10] | |
| Sequence | GCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGG | ||
| Transcript ID List | ENST00000520948.5; ENST00000413642.7; ENST00000640482.1; ENST00000523873.5; ENST00000640499.1; ENST00000519767.5; ENST00000520265.1; ENST00000640653.1; ENST00000518824.5; ENST00000518538.5; ENST00000617771.5; ENST00000523950.5; ENST00000512683.1; ENST00000372055.8; ENST00000372067.7; ENST00000611736.5; ENST00000372077.8; ENST00000230480.10; ENST00000615393.5; ENST00000480614.1; ENST00000621747.5; ENST00000457104.6; ENST00000372064.8; ENST00000518689.5; ENST00000476772.5; ENST00000324450.10; ENST00000417285.6; ENST00000523125.5; ENST00000425836.6; ENST00000482630.6 | ||
| External Link | RMBase: RNA-editing_site_116649 | ||
5-methylcytidine (m5C)
| In total 7 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE004017 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771124-43771125:+ | [11] | |
| Sequence | GCGCGCTCCCCAGGCCCTGGCCCGGGCCTCGGGCCGGGGAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000617771.5; ENST00000372067.7; ENST00000372055.8; ENST00000611736.5; ENST00000520948.5; ENST00000482630.6; ENST00000413642.7; ENST00000519767.5; ENST00000372064.8; ENST00000640482.1; ENST00000417285.6; ENST00000615393.5; ENST00000324450.10; ENST00000476772.5; ENST00000372077.8; ENST00000640499.1; ENST00000621747.5; ENST00000640653.1; ENST00000425836.6 | ||
| External Link | RMBase: m5C_site_38174 | ||
| mod ID: M5CSITE004018 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771125-43771126:+ | [11] | |
| Sequence | CGCGCTCCCCAGGCCCTGGCCCGGGCCTCGGGCCGGGGAGG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000417285.6; ENST00000476772.5; ENST00000372067.7; ENST00000482630.6; ENST00000640482.1; ENST00000519767.5; ENST00000413642.7; ENST00000372064.8; ENST00000520948.5; ENST00000617771.5; ENST00000324450.10; ENST00000372055.8; ENST00000372077.8; ENST00000615393.5; ENST00000640499.1; ENST00000640653.1; ENST00000621747.5; ENST00000425836.6; ENST00000611736.5 | ||
| External Link | RMBase: m5C_site_38175 | ||
| mod ID: M5CSITE004019 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771137-43771138:+ | [11] | |
| Sequence | GCCCTGGCCCGGGCCTCGGGCCGGGGAGGAAGAGTAGCTCG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000621747.5; ENST00000640482.1; ENST00000519767.5; ENST00000417285.6; ENST00000640653.1; ENST00000372055.8; ENST00000372077.8; ENST00000520948.5; ENST00000615393.5; ENST00000324450.10; ENST00000413642.7; ENST00000640499.1; ENST00000372067.7; ENST00000611736.5; ENST00000476772.5; ENST00000482630.6; ENST00000617771.5; ENST00000425836.6 | ||
| External Link | RMBase: m5C_site_38176 | ||
| mod ID: M5CSITE004020 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771138-43771139:+ | [11] | |
| Sequence | CCCTGGCCCGGGCCTCGGGCCGGGGAGGAAGAGTAGCTCGC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000417285.6; ENST00000640499.1; ENST00000520948.5; ENST00000611736.5; ENST00000640482.1; ENST00000372077.8; ENST00000372055.8; ENST00000324450.10; ENST00000519767.5; ENST00000621747.5; ENST00000425836.6; ENST00000615393.5; ENST00000640653.1; ENST00000372067.7; ENST00000617771.5; ENST00000476772.5; ENST00000482630.6; ENST00000413642.7; ENST00000372064.8 | ||
| External Link | RMBase: m5C_site_38177 | ||
| mod ID: M5CSITE004021 | Click to Show/Hide the Full List | ||
| mod site | chr6:43781200-43781201:+ | ||
| Sequence | GCTGAGGGTGGTGGGGAGGGCAGACATGGCCCAAGAAGGGC | ||
| Cell/Tissue List | spleen | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000497139.5; ENST00000523873.5; ENST00000372055.8; ENST00000518824.5; ENST00000425836.6; ENST00000640499.1; ENST00000372064.8; ENST00000523950.5; ENST00000520948.5; ENST00000482630.6; ENST00000611736.5; ENST00000372077.8; ENST00000640482.1; ENST00000417285.6; ENST00000523125.5; ENST00000617771.5; ENST00000518689.5; ENST00000640653.1; ENST00000372067.7; ENST00000413642.7; ENST00000324450.10; ENST00000230480.10; ENST00000621747.5; ENST00000520265.1; ENST00000493786.2; ENST00000519767.5; ENST00000457104.6; ENST00000615393.5; ENST00000480614.1 | ||
| External Link | RMBase: m5C_site_38178 | ||
| mod ID: M5CSITE004022 | Click to Show/Hide the Full List | ||
| mod site | chr6:43783831-43783832:+ | ||
| Sequence | GAAGCCGCCGAATTGTCTCTCCCCATCCTAAGTGAAGCAGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000611736.5; ENST00000372064.8; ENST00000372077.8; ENST00000520265.1; ENST00000324450.10; ENST00000617771.5; ENST00000480614.1; ENST00000518689.5; ENST00000372055.8; ENST00000621747.5; ENST00000640482.1; ENST00000230480.10; ENST00000640499.1; ENST00000518824.5; ENST00000417285.6; ENST00000523873.5; ENST00000425836.6; ENST00000615393.5; ENST00000372067.7; ENST00000523950.5; ENST00000457104.6; ENST00000519767.5; ENST00000493786.2; ENST00000520948.5; ENST00000523125.5; ENST00000640653.1; ENST00000497139.5; ENST00000413642.7; ENST00000482630.6 | ||
| External Link | RMBase: m5C_site_38179 | ||
| mod ID: M5CSITE004024 | Click to Show/Hide the Full List | ||
| mod site | chr6:43783919-43783920:+ | ||
| Sequence | GCAGCTCAAGAGAGATGAGGCCTACAGCCACAGTGGGAGGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000518824.5; ENST00000497139.5; ENST00000417285.6; ENST00000372055.8; ENST00000621747.5; ENST00000493786.2; ENST00000372067.7; ENST00000372064.8; ENST00000230480.10; ENST00000615393.5; ENST00000523950.5; ENST00000520265.1; ENST00000457104.6; ENST00000324450.10; ENST00000520948.5; ENST00000519767.5; ENST00000518689.5; ENST00000617771.5; ENST00000640653.1; ENST00000640482.1; ENST00000523125.5; ENST00000413642.7; ENST00000523873.5; ENST00000640499.1; ENST00000480614.1; ENST00000372077.8; ENST00000425836.6; ENST00000482630.6; ENST00000611736.5 | ||
| External Link | RMBase: m5C_site_38180 | ||
N6-methyladenosine (m6A)
| In total 115 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE075268 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770299-43770300:+ | [12] | |
| Sequence | GAGGCGCAGCGGTTAGGTGGACCGGTCAGCGGACTCACCGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; LCLs; HEK293A-TOA; TREX; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000476772.5; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718862 | ||
| mod ID: M6ASITE075269 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770311-43770312:+ | [12] | |
| Sequence | TTAGGTGGACCGGTCAGCGGACTCACCGGCCAGGGCGCTCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; LCLs; HEK293A-TOA; TREX; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718863 | ||
| mod ID: M6ASITE075270 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770387-43770388:+ | [12] | |
| Sequence | TCCCTCTTCTTTTTTCTTAAACATTTTTTTTTAAAACTGTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; LCLs | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718864 | ||
| mod ID: M6ASITE075271 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770402-43770403:+ | [12] | |
| Sequence | CTTAAACATTTTTTTTTAAAACTGTATTGTTTCTCGTTTTA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718865 | ||
| mod ID: M6ASITE075272 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770512-43770513:+ | [12] | |
| Sequence | AATCACTGTGGATTTTGGAAACCAGCAGAAAGAGGAAAGAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; U2OS; H1A; H1B; hNPCs; fibroblasts; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718866 | ||
| mod ID: M6ASITE075273 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770614-43770615:+ | [13] | |
| Sequence | GCGTGCGAGCAGCGAAAGCGACAGGGGCAAAGTGAGTGACC | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718867 | ||
| mod ID: M6ASITE075274 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770713-43770714:+ | [12] | |
| Sequence | CTGACCAGTCGCGCTGACGGACAGACAGACAGACACCGCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000324450.10; ENST00000621747.5; ENST00000425836.6; ENST00000482630.6; ENST00000476772.5; ENST00000617771.5; ENST00000640499.1; ENST00000413642.7; ENST00000372067.7; ENST00000615393.5; ENST00000640653.1; ENST00000372055.8; ENST00000611736.5; ENST00000372064.8; ENST00000640482.1; ENST00000417285.6 | ||
| External Link | RMBase: m6A_site_718868 | ||
| mod ID: M6ASITE075275 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770717-43770718:+ | [13] | |
| Sequence | CCAGTCGCGCTGACGGACAGACAGACAGACACCGCCCCCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000372055.8; ENST00000417285.6; ENST00000425836.6; ENST00000372067.7; ENST00000372064.8; ENST00000476772.5; ENST00000640499.1; ENST00000611736.5; ENST00000413642.7; ENST00000640482.1; ENST00000615393.5; ENST00000640653.1; ENST00000621747.5; ENST00000482630.6; ENST00000324450.10; ENST00000617771.5 | ||
| External Link | RMBase: m6A_site_718869 | ||
| mod ID: M6ASITE075276 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770721-43770722:+ | [12] | |
| Sequence | TCGCGCTGACGGACAGACAGACAGACACCGCCCCCAGCCCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000640482.1; ENST00000372055.8; ENST00000425836.6; ENST00000640653.1; ENST00000615393.5; ENST00000417285.6; ENST00000482630.6; ENST00000611736.5; ENST00000621747.5; ENST00000372067.7; ENST00000324450.10; ENST00000617771.5; ENST00000476772.5; ENST00000640499.1; ENST00000413642.7 | ||
| External Link | RMBase: m6A_site_718870 | ||
| mod ID: M6ASITE075277 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770725-43770726:+ | [14] | |
| Sequence | GCTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; hESC-HEK293T; AML | ||
| Seq Type List | m6A-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000640653.1; ENST00000615393.5; ENST00000476772.5; ENST00000372064.8; ENST00000324450.10; ENST00000640499.1; ENST00000425836.6; ENST00000621747.5; ENST00000417285.6; ENST00000372055.8; ENST00000617771.5; ENST00000372067.7; ENST00000482630.6; ENST00000640482.1; ENST00000611736.5; ENST00000413642.7 | ||
| External Link | RMBase: m6A_site_718871 | ||
| mod ID: M6ASITE075278 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770772-43770773:+ | [12] | |
| Sequence | TCCTCCCCGGCCGGCGGCGGACAGTGGACGCGGCGGCGAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000621747.5; ENST00000640499.1; ENST00000413642.7; ENST00000425836.6; ENST00000372067.7; ENST00000640482.1; ENST00000372064.8; ENST00000417285.6; ENST00000372055.8; ENST00000617771.5; ENST00000615393.5; ENST00000324450.10; ENST00000611736.5; ENST00000640653.1; ENST00000476772.5; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718872 | ||
| mod ID: M6ASITE075279 | Click to Show/Hide the Full List | ||
| mod site | chr6:43770864-43770865:+ | [12] | |
| Sequence | GCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000425836.6; ENST00000615393.5; ENST00000324450.10; ENST00000417285.6; ENST00000617771.5; ENST00000372067.7; ENST00000640482.1; ENST00000482630.6; ENST00000640499.1; ENST00000372064.8; ENST00000519767.5; ENST00000640653.1; ENST00000611736.5; ENST00000372055.8; ENST00000413642.7; ENST00000476772.5; ENST00000621747.5; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718873 | ||
| mod ID: M6ASITE075280 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771088-43771089:+ | [12] | |
| Sequence | TGAGGCGGCGGTGTGCGCAGACAGTGCTCCAGCCGCGCGCG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000372077.8; ENST00000621747.5; ENST00000520948.5; ENST00000640482.1; ENST00000611736.5; ENST00000640653.1; ENST00000324450.10; ENST00000417285.6; ENST00000476772.5; ENST00000482630.6; ENST00000519767.5; ENST00000615393.5; ENST00000617771.5; ENST00000372055.8; ENST00000425836.6; ENST00000640499.1; ENST00000413642.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718874 | ||
| mod ID: M6ASITE075281 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771243-43771244:+ | [12] | |
| Sequence | GCCCCGGTCGGGCCTCCGAAACCATGAACTTTCTGCTGTCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; LCLs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000640653.1; ENST00000621747.5; ENST00000372064.8; ENST00000523873.5; ENST00000372077.8; ENST00000617771.5; ENST00000476772.5; ENST00000523950.5; ENST00000640482.1; ENST00000519767.5; ENST00000640499.1; ENST00000520948.5; ENST00000372067.7; ENST00000413642.7; ENST00000518538.5; ENST00000615393.5; ENST00000482630.6; ENST00000425836.6; ENST00000611736.5; ENST00000372055.8; ENST00000417285.6; ENST00000324450.10 | ||
| External Link | RMBase: m6A_site_718875 | ||
| mod ID: M6ASITE075282 | Click to Show/Hide the Full List | ||
| mod site | chr6:43771250-43771251:+ | [12] | |
| Sequence | TCGGGCCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; LCLs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000518824.5; ENST00000640499.1; ENST00000617771.5; ENST00000523125.5; ENST00000611736.5; ENST00000372064.8; ENST00000523950.5; ENST00000372077.8; ENST00000621747.5; ENST00000518538.5; ENST00000413642.7; ENST00000425836.6; ENST00000518689.5; ENST00000615393.5; ENST00000457104.6; ENST00000417285.6; ENST00000523873.5; ENST00000640482.1; ENST00000372055.8; ENST00000482630.6; ENST00000324450.10; ENST00000640653.1; ENST00000512683.1; ENST00000520948.5; ENST00000519767.5; ENST00000372067.7; ENST00000476772.5 | ||
| External Link | RMBase: m6A_site_718876 | ||
| mod ID: M6ASITE075283 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773254-43773255:+ | [12] | |
| Sequence | GGAGAGGGAAAGAAAGATGGACAGTGGGACTCTCCCCTAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000457104.6; ENST00000480614.1; ENST00000617771.5; ENST00000476772.5; ENST00000518689.5; ENST00000425836.6; ENST00000372055.8; ENST00000519767.5; ENST00000372077.8; ENST00000611736.5; ENST00000615393.5; ENST00000512683.1; ENST00000324450.10; ENST00000372064.8; ENST00000518824.5; ENST00000520948.5; ENST00000640499.1; ENST00000621747.5; ENST00000523873.5; ENST00000482630.6; ENST00000230480.10; ENST00000413642.7; ENST00000518538.5; ENST00000417285.6; ENST00000523125.5; ENST00000640482.1; ENST00000372067.7; ENST00000640653.1; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718877 | ||
| mod ID: M6ASITE075284 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773262-43773263:+ | [12] | |
| Sequence | AAAGAAAGATGGACAGTGGGACTCTCCCCTAGCAGGGTCTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000324450.10; ENST00000617771.5; ENST00000372055.8; ENST00000476772.5; ENST00000640653.1; ENST00000372067.7; ENST00000640499.1; ENST00000520948.5; ENST00000523950.5; ENST00000425836.6; ENST00000413642.7; ENST00000621747.5; ENST00000480614.1; ENST00000512683.1; ENST00000518689.5; ENST00000518824.5; ENST00000615393.5; ENST00000518538.5; ENST00000372064.8; ENST00000523125.5; ENST00000523873.5; ENST00000372077.8; ENST00000417285.6; ENST00000611736.5; ENST00000457104.6; ENST00000482630.6; ENST00000640482.1; ENST00000519767.5; ENST00000230480.10 | ||
| External Link | RMBase: m6A_site_718878 | ||
| mod ID: M6ASITE075285 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773354-43773355:+ | [12] | |
| Sequence | GGAGTTGGTGAGAGCTGGAGACCCCCAGGAAGGGCTGGCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000230480.10; ENST00000372067.7; ENST00000476772.5; ENST00000518689.5; ENST00000425836.6; ENST00000519767.5; ENST00000413642.7; ENST00000523125.5; ENST00000372055.8; ENST00000480614.1; ENST00000518824.5; ENST00000482630.6; ENST00000617771.5; ENST00000372064.8; ENST00000372077.8; ENST00000523950.5; ENST00000640499.1; ENST00000611736.5; ENST00000640653.1; ENST00000640482.1; ENST00000615393.5; ENST00000523873.5; ENST00000324450.10; ENST00000518538.5; ENST00000457104.6; ENST00000621747.5; ENST00000520948.5; ENST00000512683.1; ENST00000417285.6 | ||
| External Link | RMBase: m6A_site_718879 | ||
| mod ID: M6ASITE075286 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773626-43773627:+ | [12] | |
| Sequence | CACCCTGGGAGGGAGAAGAAACCAGGGAACAGGTAGGAGTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413642.7; ENST00000324450.10; ENST00000476772.5; ENST00000615393.5; ENST00000523950.5; ENST00000518824.5; ENST00000520948.5; ENST00000372064.8; ENST00000372055.8; ENST00000640653.1; ENST00000480614.1; ENST00000372067.7; ENST00000519767.5; ENST00000482630.6; ENST00000457104.6; ENST00000512683.1; ENST00000640482.1; ENST00000621747.5; ENST00000523125.5; ENST00000230480.10; ENST00000518689.5; ENST00000640499.1; ENST00000372077.8; ENST00000518538.5; ENST00000617771.5; ENST00000425836.6; ENST00000417285.6; ENST00000523873.5; ENST00000611736.5 | ||
| External Link | RMBase: m6A_site_718880 | ||
| mod ID: M6ASITE075287 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773634-43773635:+ | [12] | |
| Sequence | GAGGGAGAAGAAACCAGGGAACAGGTAGGAGTGGGAGACAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000621747.5; ENST00000640653.1; ENST00000482630.6; ENST00000372064.8; ENST00000611736.5; ENST00000523950.5; ENST00000476772.5; ENST00000230480.10; ENST00000518689.5; ENST00000480614.1; ENST00000617771.5; ENST00000324450.10; ENST00000640499.1; ENST00000457104.6; ENST00000372055.8; ENST00000413642.7; ENST00000425836.6; ENST00000518538.5; ENST00000372067.7; ENST00000523125.5; ENST00000520948.5; ENST00000640482.1; ENST00000518824.5; ENST00000615393.5; ENST00000519767.5; ENST00000512683.1; ENST00000372077.8; ENST00000523873.5; ENST00000417285.6 | ||
| External Link | RMBase: m6A_site_718881 | ||
| mod ID: M6ASITE075288 | Click to Show/Hide the Full List | ||
| mod site | chr6:43773651-43773652:+ | [12] | |
| Sequence | GGAACAGGTAGGAGTGGGAGACAGGTGAGGCTTTGGAAATC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000640653.1; ENST00000230480.10; ENST00000518538.5; ENST00000611736.5; ENST00000482630.6; ENST00000324450.10; ENST00000615393.5; ENST00000518824.5; ENST00000617771.5; ENST00000523950.5; ENST00000518689.5; ENST00000457104.6; ENST00000417285.6; ENST00000512683.1; ENST00000523873.5; ENST00000372077.8; ENST00000640482.1; ENST00000372055.8; ENST00000476772.5; ENST00000413642.7; ENST00000519767.5; ENST00000480614.1; ENST00000640499.1; ENST00000372064.8; ENST00000372067.7; ENST00000621747.5; ENST00000520948.5; ENST00000425836.6; ENST00000523125.5 | ||
| External Link | RMBase: m6A_site_718882 | ||
| mod ID: M6ASITE075289 | Click to Show/Hide the Full List | ||
| mod site | chr6:43774188-43774189:+ | [12] | |
| Sequence | CATATTCTGTGCCCGTGGGGACCCCCGGTTGTGTCCTGTTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000640499.1; ENST00000523873.5; ENST00000482630.6; ENST00000425836.6; ENST00000480614.1; ENST00000621747.5; ENST00000640653.1; ENST00000640482.1; ENST00000324450.10; ENST00000523950.5; ENST00000372064.8; ENST00000523125.5; ENST00000417285.6; ENST00000512683.1; ENST00000230480.10; ENST00000372055.8; ENST00000518689.5; ENST00000617771.5; ENST00000518538.5; ENST00000518824.5; ENST00000457104.6; ENST00000519767.5; ENST00000615393.5; ENST00000413642.7; ENST00000372067.7; ENST00000611736.5; ENST00000476772.5; ENST00000520948.5 | ||
| External Link | RMBase: m6A_site_718883 | ||
| mod ID: M6ASITE075290 | Click to Show/Hide the Full List | ||
| mod site | chr6:43774219-43774220:+ | [12] | |
| Sequence | TGTCCTGTTCGACTCAGAAGACTTGGAGAAGCCAGAGGCTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413642.7; ENST00000518538.5; ENST00000617771.5; ENST00000640653.1; ENST00000372067.7; ENST00000512683.1; ENST00000372077.8; ENST00000480614.1; ENST00000523873.5; ENST00000519767.5; ENST00000482630.6; ENST00000417285.6; ENST00000520948.5; ENST00000523950.5; ENST00000615393.5; ENST00000230480.10; ENST00000640499.1; ENST00000621747.5; ENST00000518824.5; ENST00000425836.6; ENST00000523125.5; ENST00000324450.10; ENST00000457104.6; ENST00000611736.5; ENST00000372055.8; ENST00000476772.5; ENST00000640482.1; ENST00000518689.5; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718884 | ||
| mod ID: M6ASITE075291 | Click to Show/Hide the Full List | ||
| mod site | chr6:43774471-43774472:+ | [12] | |
| Sequence | CTAATTCCTTTTTCTTCAGAACTGTGGGGAGGAAGGGGAAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000621747.5; ENST00000372064.8; ENST00000324450.10; ENST00000512683.1; ENST00000425836.6; ENST00000615393.5; ENST00000523125.5; ENST00000457104.6; ENST00000372077.8; ENST00000640499.1; ENST00000372055.8; ENST00000640653.1; ENST00000518689.5; ENST00000482630.6; ENST00000518538.5; ENST00000476772.5; ENST00000230480.10; ENST00000523873.5; ENST00000520948.5; ENST00000640482.1; ENST00000520265.1; ENST00000617771.5; ENST00000519767.5; ENST00000611736.5; ENST00000413642.7; ENST00000518824.5; ENST00000480614.1; ENST00000417285.6; ENST00000372067.7; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718885 | ||
| mod ID: M6ASITE075292 | Click to Show/Hide the Full List | ||
| mod site | chr6:43775318-43775319:+ | [12] | |
| Sequence | TCTGGTCTGGGAGAGGCAGGACAAAGGTCTTTGTTTGCTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000518689.5; ENST00000457104.6; ENST00000372064.8; ENST00000480614.1; ENST00000230480.10; ENST00000518824.5; ENST00000512683.1; ENST00000640653.1; ENST00000476772.5; ENST00000482630.6; ENST00000372067.7; ENST00000523950.5; ENST00000324450.10; ENST00000640482.1; ENST00000520265.1; ENST00000518538.5; ENST00000615393.5; ENST00000519767.5; ENST00000611736.5; ENST00000372077.8; ENST00000425836.6; ENST00000520948.5; ENST00000621747.5; ENST00000523873.5; ENST00000523125.5; ENST00000617771.5; ENST00000413642.7; ENST00000640499.1; ENST00000417285.6; ENST00000372055.8 | ||
| External Link | RMBase: m6A_site_718886 | ||
| mod ID: M6ASITE075293 | Click to Show/Hide the Full List | ||
| mod site | chr6:43775369-43775370:+ | [12] | |
| Sequence | GTCTGCGATAAATAAGGAAAACCACGAAAGCCTGGTTGTTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000640482.1; ENST00000640499.1; ENST00000518538.5; ENST00000615393.5; ENST00000425836.6; ENST00000372067.7; ENST00000372064.8; ENST00000417285.6; ENST00000482630.6; ENST00000523873.5; ENST00000519767.5; ENST00000457104.6; ENST00000640653.1; ENST00000621747.5; ENST00000372055.8; ENST00000520265.1; ENST00000523125.5; ENST00000324450.10; ENST00000611736.5; ENST00000476772.5; ENST00000372077.8; ENST00000512683.1; ENST00000523950.5; ENST00000480614.1; ENST00000518824.5; ENST00000520948.5; ENST00000617771.5; ENST00000413642.7; ENST00000518689.5; ENST00000230480.10 | ||
| External Link | RMBase: m6A_site_718887 | ||
| mod ID: M6ASITE075294 | Click to Show/Hide the Full List | ||
| mod site | chr6:43775823-43775824:+ | [12] | |
| Sequence | TCTGGATAAAAGAAATAGAGACCTCACAGGAAGCAGTGGAC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000640499.1; ENST00000518689.5; ENST00000518824.5; ENST00000480614.1; ENST00000621747.5; ENST00000520265.1; ENST00000372064.8; ENST00000523873.5; ENST00000413642.7; ENST00000482630.6; ENST00000523950.5; ENST00000457104.6; ENST00000520948.5; ENST00000425836.6; ENST00000617771.5; ENST00000372067.7; ENST00000640482.1; ENST00000611736.5; ENST00000372055.8; ENST00000372077.8; ENST00000512683.1; ENST00000519767.5; ENST00000640653.1; ENST00000476772.5; ENST00000324450.10; ENST00000523125.5; ENST00000615393.5; ENST00000518538.5; ENST00000417285.6; ENST00000230480.10 | ||
| External Link | RMBase: m6A_site_718888 | ||
| mod ID: M6ASITE075295 | Click to Show/Hide the Full List | ||
| mod site | chr6:43775842-43775843:+ | [12] | |
| Sequence | GACCTCACAGGAAGCAGTGGACTGGCCTGTTTCCCCACTGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000520948.5; ENST00000476772.5; ENST00000523873.5; ENST00000372055.8; ENST00000372067.7; ENST00000417285.6; ENST00000615393.5; ENST00000523125.5; ENST00000611736.5; ENST00000519767.5; ENST00000617771.5; ENST00000640653.1; ENST00000457104.6; ENST00000425836.6; ENST00000520265.1; ENST00000324450.10; ENST00000372064.8; ENST00000512683.1; ENST00000518538.5; ENST00000518824.5; ENST00000482630.6; ENST00000518689.5; ENST00000372077.8; ENST00000230480.10; ENST00000480614.1; ENST00000640482.1; ENST00000523950.5; ENST00000621747.5; ENST00000413642.7; ENST00000640499.1 | ||
| External Link | RMBase: m6A_site_718889 | ||
| mod ID: M6ASITE075296 | Click to Show/Hide the Full List | ||
| mod site | chr6:43776735-43776736:+ | [12] | |
| Sequence | GCTCATGTCTGGGGAAGAGGACTGGCAGGGGGAAAGGTGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000640499.1; ENST00000640482.1; ENST00000457104.6; ENST00000324450.10; ENST00000480614.1; ENST00000518824.5; ENST00000523873.5; ENST00000518538.5; ENST00000617771.5; ENST00000520265.1; ENST00000372077.8; ENST00000519767.5; ENST00000413642.7; ENST00000611736.5; ENST00000372067.7; ENST00000482630.6; ENST00000615393.5; ENST00000425836.6; ENST00000417285.6; ENST00000523950.5; ENST00000512683.1; ENST00000523125.5; ENST00000476772.5; ENST00000621747.5; ENST00000230480.10; ENST00000640653.1; ENST00000518689.5; ENST00000520948.5; ENST00000372055.8 | ||
| External Link | RMBase: m6A_site_718890 | ||
| mod ID: M6ASITE075297 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777518-43777519:+ | [12] | |
| Sequence | GCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000520948.5; ENST00000480614.1; ENST00000617771.5; ENST00000417285.6; ENST00000372055.8; ENST00000523950.5; ENST00000518824.5; ENST00000372064.8; ENST00000520265.1; ENST00000476772.5; ENST00000230480.10; ENST00000621747.5; ENST00000523873.5; ENST00000640653.1; ENST00000457104.6; ENST00000615393.5; ENST00000324450.10; ENST00000640499.1; ENST00000372067.7; ENST00000512683.1; ENST00000640482.1; ENST00000413642.7; ENST00000518538.5; ENST00000372077.8; ENST00000611736.5; ENST00000482630.6; ENST00000518689.5; ENST00000425836.6; ENST00000519767.5; ENST00000523125.5 | ||
| External Link | RMBase: m6A_site_718891 | ||
| mod ID: M6ASITE075298 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777528-43777529:+ | [12] | |
| Sequence | TCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372055.8; ENST00000324450.10; ENST00000621747.5; ENST00000476772.5; ENST00000518689.5; ENST00000230480.10; ENST00000457104.6; ENST00000611736.5; ENST00000617771.5; ENST00000512683.1; ENST00000523125.5; ENST00000372064.8; ENST00000417285.6; ENST00000520265.1; ENST00000518824.5; ENST00000523873.5; ENST00000372077.8; ENST00000372067.7; ENST00000413642.7; ENST00000615393.5; ENST00000640653.1; ENST00000520948.5; ENST00000640482.1; ENST00000425836.6; ENST00000480614.1; ENST00000640499.1; ENST00000523950.5; ENST00000482630.6; ENST00000519767.5; ENST00000518538.5 | ||
| External Link | RMBase: m6A_site_718892 | ||
| mod ID: M6ASITE075299 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777561-43777562:+ | [13] | |
| Sequence | GTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000611736.5; ENST00000372077.8; ENST00000480614.1; ENST00000615393.5; ENST00000523125.5; ENST00000512683.1; ENST00000518824.5; ENST00000621747.5; ENST00000640482.1; ENST00000413642.7; ENST00000520948.5; ENST00000230480.10; ENST00000425836.6; ENST00000518689.5; ENST00000324450.10; ENST00000518538.5; ENST00000457104.6; ENST00000372055.8; ENST00000372067.7; ENST00000520265.1; ENST00000417285.6; ENST00000519767.5; ENST00000523950.5; ENST00000372064.8; ENST00000640499.1; ENST00000617771.5; ENST00000640653.1; ENST00000476772.5; ENST00000523873.5; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718893 | ||
| mod ID: M6ASITE075300 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777651-43777652:+ | [13] | |
| Sequence | TGTGCCCACTGAGGAGTCCAACATCACCATGCAGGTGGGCA | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000617771.5; ENST00000480614.1; ENST00000640499.1; ENST00000611736.5; ENST00000640482.1; ENST00000372055.8; ENST00000520265.1; ENST00000372077.8; ENST00000476772.5; ENST00000512683.1; ENST00000523125.5; ENST00000425836.6; ENST00000413642.7; ENST00000457104.6; ENST00000518824.5; ENST00000482630.6; ENST00000518538.5; ENST00000518689.5; ENST00000523873.5; ENST00000621747.5; ENST00000230480.10; ENST00000640653.1; ENST00000520948.5; ENST00000417285.6; ENST00000372064.8; ENST00000519767.5; ENST00000372067.7; ENST00000615393.5; ENST00000324450.10; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718894 | ||
| mod ID: M6ASITE075301 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777724-43777725:+ | [14] | |
| Sequence | AGGGGGGTAACACTTTGGGAACAGGTGGTCCCAGGTCGTTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | CD34; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000617771.5; ENST00000230480.10; ENST00000482630.6; ENST00000640499.1; ENST00000523873.5; ENST00000640482.1; ENST00000520948.5; ENST00000512683.1; ENST00000621747.5; ENST00000640653.1; ENST00000417285.6; ENST00000518689.5; ENST00000518538.5; ENST00000372077.8; ENST00000413642.7; ENST00000523125.5; ENST00000457104.6; ENST00000497139.5; ENST00000611736.5; ENST00000520265.1; ENST00000519767.5; ENST00000324450.10; ENST00000372064.8; ENST00000476772.5; ENST00000518824.5; ENST00000480614.1; ENST00000615393.5; ENST00000425836.6; ENST00000372055.8; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718895 | ||
| mod ID: M6ASITE075302 | Click to Show/Hide the Full List | ||
| mod site | chr6:43777908-43777909:+ | [12] | |
| Sequence | GCCCATGGGCTCAGGAGGGGACAGATGGATGCCTGTGTCAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000518689.5; ENST00000425836.6; ENST00000230480.10; ENST00000457104.6; ENST00000520948.5; ENST00000518538.5; ENST00000482630.6; ENST00000372077.8; ENST00000640653.1; ENST00000480614.1; ENST00000324450.10; ENST00000519767.5; ENST00000413642.7; ENST00000640499.1; ENST00000621747.5; ENST00000523873.5; ENST00000523950.5; ENST00000372055.8; ENST00000372067.7; ENST00000417285.6; ENST00000520265.1; ENST00000615393.5; ENST00000640482.1; ENST00000617771.5; ENST00000372064.8; ENST00000523125.5; ENST00000518824.5; ENST00000611736.5; ENST00000476772.5; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718896 | ||
| mod ID: M6ASITE075303 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778096-43778097:+ | [12] | |
| Sequence | GGGTGGGAGGGAGCTGTGAAACACAGGGAGGGGGTTGCTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482630.6; ENST00000518538.5; ENST00000523873.5; ENST00000372077.8; ENST00000324450.10; ENST00000230480.10; ENST00000615393.5; ENST00000417285.6; ENST00000640499.1; ENST00000413642.7; ENST00000476772.5; ENST00000523125.5; ENST00000497139.5; ENST00000425836.6; ENST00000372064.8; ENST00000640482.1; ENST00000611736.5; ENST00000640653.1; ENST00000372067.7; ENST00000518824.5; ENST00000520265.1; ENST00000621747.5; ENST00000480614.1; ENST00000520948.5; ENST00000518689.5; ENST00000519767.5; ENST00000372055.8; ENST00000457104.6; ENST00000617771.5; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718897 | ||
| mod ID: M6ASITE075304 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778189-43778190:+ | [12] | |
| Sequence | GGGGATGGGGAGTGGTAAGAACCTAGGATTTGAATTCCCAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000518824.5; ENST00000372055.8; ENST00000617771.5; ENST00000640653.1; ENST00000615393.5; ENST00000476772.5; ENST00000523950.5; ENST00000417285.6; ENST00000372077.8; ENST00000457104.6; ENST00000520265.1; ENST00000518689.5; ENST00000497139.5; ENST00000230480.10; ENST00000493786.2; ENST00000611736.5; ENST00000640499.1; ENST00000413642.7; ENST00000621747.5; ENST00000523873.5; ENST00000519767.5; ENST00000372064.8; ENST00000425836.6; ENST00000480614.1; ENST00000640482.1; ENST00000520948.5; ENST00000324450.10; ENST00000372067.7; ENST00000518538.5; ENST00000482630.6; ENST00000523125.5 | ||
| External Link | RMBase: m6A_site_718898 | ||
| mod ID: M6ASITE075305 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778362-43778363:+ | [15] | |
| Sequence | ACCCATCCCTGCTCTGCAGAACCCCTGGGTGCTGAGTGGCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000640653.1; ENST00000457104.6; ENST00000493786.2; ENST00000523873.5; ENST00000617771.5; ENST00000519767.5; ENST00000476772.5; ENST00000520948.5; ENST00000523125.5; ENST00000372055.8; ENST00000480614.1; ENST00000372067.7; ENST00000372064.8; ENST00000520265.1; ENST00000417285.6; ENST00000497139.5; ENST00000523950.5; ENST00000482630.6; ENST00000518689.5; ENST00000324450.10; ENST00000640482.1; ENST00000518824.5; ENST00000425836.6; ENST00000621747.5; ENST00000615393.5; ENST00000413642.7; ENST00000611736.5; ENST00000372077.8; ENST00000230480.10; ENST00000640499.1; ENST00000518538.5 | ||
| External Link | RMBase: m6A_site_718899 | ||
| mod ID: M6ASITE075307 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778473-43778474:+ | [12] | |
| Sequence | TTCCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; U2OS; MT4; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000497139.5; ENST00000520948.5; ENST00000372077.8; ENST00000518689.5; ENST00000519767.5; ENST00000372055.8; ENST00000518824.5; ENST00000324450.10; ENST00000230480.10; ENST00000520265.1; ENST00000615393.5; ENST00000493786.2; ENST00000372067.7; ENST00000518538.5; ENST00000476772.5; ENST00000640482.1; ENST00000640653.1; ENST00000621747.5; ENST00000523873.5; ENST00000617771.5; ENST00000480614.1; ENST00000457104.6; ENST00000413642.7; ENST00000482630.6; ENST00000417285.6; ENST00000640499.1; ENST00000611736.5; ENST00000523125.5; ENST00000523950.5; ENST00000425836.6 | ||
| External Link | RMBase: m6A_site_718900 | ||
| mod ID: M6ASITE075308 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778490-43778491:+ | [13] | |
| Sequence | CAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000640482.1; ENST00000520948.5; ENST00000518824.5; ENST00000523125.5; ENST00000372077.8; ENST00000611736.5; ENST00000476772.5; ENST00000640499.1; ENST00000372055.8; ENST00000640653.1; ENST00000523950.5; ENST00000497139.5; ENST00000417285.6; ENST00000413642.7; ENST00000615393.5; ENST00000519767.5; ENST00000230480.10; ENST00000372064.8; ENST00000493786.2; ENST00000518538.5; ENST00000518689.5; ENST00000523873.5; ENST00000617771.5; ENST00000425836.6; ENST00000324450.10; ENST00000457104.6; ENST00000480614.1; ENST00000621747.5; ENST00000520265.1; ENST00000372067.7; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718901 | ||
| mod ID: M6ASITE075309 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778740-43778741:+ | [12] | |
| Sequence | AGCATTGTTATAATGATTAAACAAGTTATATATGAAAAGAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000520948.5; ENST00000372077.8; ENST00000425836.6; ENST00000519767.5; ENST00000640653.1; ENST00000523125.5; ENST00000497139.5; ENST00000640482.1; ENST00000372067.7; ENST00000457104.6; ENST00000324450.10; ENST00000480614.1; ENST00000640499.1; ENST00000230480.10; ENST00000518824.5; ENST00000493786.2; ENST00000413642.7; rmsk_1934915; ENST00000476772.5; ENST00000523873.5; ENST00000520265.1; ENST00000372055.8; ENST00000615393.5; ENST00000611736.5; ENST00000617771.5; ENST00000518689.5; ENST00000417285.6; ENST00000523950.5; ENST00000372064.8; ENST00000621747.5; ENST00000482630.6; ENST00000518538.5 | ||
| External Link | RMBase: m6A_site_718902 | ||
| mod ID: M6ASITE075310 | Click to Show/Hide the Full List | ||
| mod site | chr6:43778909-43778910:+ | [12] | |
| Sequence | CCAAAGAAAGATAGAGCAAGACAAGAAAAGTAAGTGGCCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000617771.5; ENST00000482630.6; ENST00000520265.1; ENST00000372055.8; ENST00000457104.6; ENST00000417285.6; ENST00000372077.8; ENST00000640482.1; ENST00000497139.5; ENST00000518824.5; ENST00000493786.2; ENST00000523873.5; ENST00000523950.5; ENST00000640653.1; ENST00000611736.5; ENST00000640499.1; ENST00000480614.1; ENST00000425836.6; ENST00000615393.5; ENST00000372067.7; ENST00000520948.5; ENST00000519767.5; ENST00000372064.8; ENST00000523125.5; ENST00000413642.7; ENST00000518689.5; ENST00000621747.5; ENST00000518538.5; ENST00000230480.10; ENST00000324450.10 | ||
| External Link | RMBase: m6A_site_718903 | ||
| mod ID: M6ASITE075311 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779025-43779026:+ | [12] | |
| Sequence | ATAGCCTCCCTGGGTCAGGGACTTGGTCTTGTGGGGGACTT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000324450.10; ENST00000457104.6; ENST00000493786.2; ENST00000640653.1; ENST00000372067.7; ENST00000482630.6; ENST00000413642.7; ENST00000523125.5; ENST00000523873.5; ENST00000425836.6; ENST00000611736.5; ENST00000520265.1; ENST00000640482.1; ENST00000523950.5; ENST00000519767.5; ENST00000230480.10; ENST00000617771.5; ENST00000372077.8; ENST00000480614.1; ENST00000520948.5; ENST00000621747.5; ENST00000518689.5; ENST00000518824.5; ENST00000372055.8; ENST00000497139.5; ENST00000417285.6; ENST00000640499.1; ENST00000615393.5 | ||
| External Link | RMBase: m6A_site_718904 | ||
| mod ID: M6ASITE075312 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779042-43779043:+ | [12] | |
| Sequence | GGGACTTGGTCTTGTGGGGGACTTGTGGTGGCAGCAACAAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000520265.1; ENST00000425836.6; ENST00000520948.5; ENST00000372077.8; ENST00000640653.1; ENST00000518824.5; ENST00000230480.10; ENST00000640482.1; ENST00000640499.1; ENST00000457104.6; ENST00000413642.7; ENST00000615393.5; ENST00000372067.7; ENST00000497139.5; ENST00000372055.8; ENST00000617771.5; ENST00000611736.5; ENST00000417285.6; ENST00000324450.10; ENST00000480614.1; ENST00000523950.5; ENST00000518689.5; ENST00000621747.5; ENST00000523873.5; ENST00000372064.8; ENST00000519767.5; ENST00000523125.5; ENST00000482630.6; ENST00000493786.2 | ||
| External Link | RMBase: m6A_site_718905 | ||
| mod ID: M6ASITE075313 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779109-43779110:+ | [15] | |
| Sequence | GCTCTAGGGCTAGTGAGAAAACATAGCCAGGAGCCTGGCAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000425836.6; ENST00000497139.5; ENST00000523873.5; ENST00000518689.5; ENST00000615393.5; ENST00000413642.7; ENST00000457104.6; ENST00000518824.5; ENST00000621747.5; ENST00000520948.5; ENST00000372064.8; ENST00000519767.5; ENST00000611736.5; ENST00000640499.1; ENST00000324450.10; ENST00000372067.7; ENST00000372055.8; ENST00000523950.5; ENST00000640653.1; ENST00000493786.2; ENST00000480614.1; ENST00000523125.5; ENST00000520265.1; ENST00000617771.5; ENST00000482630.6; ENST00000230480.10; ENST00000417285.6; ENST00000640482.1; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718906 | ||
| mod ID: M6ASITE075314 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779144-43779145:+ | [15] | |
| Sequence | TGGCACTTCCTTTGGAAGGGACAATGCCTTCTGGGTCTCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000615393.5; ENST00000640482.1; ENST00000520265.1; ENST00000480614.1; ENST00000617771.5; ENST00000372055.8; ENST00000621747.5; ENST00000523125.5; ENST00000372077.8; ENST00000640653.1; ENST00000640499.1; ENST00000324450.10; ENST00000417285.6; ENST00000519767.5; ENST00000523950.5; ENST00000523873.5; ENST00000372064.8; ENST00000230480.10; ENST00000493786.2; ENST00000497139.5; ENST00000482630.6; ENST00000372067.7; ENST00000520948.5; ENST00000457104.6; ENST00000518689.5; ENST00000611736.5; ENST00000425836.6; ENST00000413642.7; ENST00000518824.5 | ||
| External Link | RMBase: m6A_site_718907 | ||
| mod ID: M6ASITE075315 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779182-43779183:+ | [15] | |
| Sequence | CCAGATCATTCCTGACCAGGACTTGCTGTTTCGGTGTGTCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000519767.5; ENST00000417285.6; ENST00000615393.5; ENST00000425836.6; ENST00000640653.1; ENST00000523873.5; ENST00000457104.6; ENST00000230480.10; ENST00000621747.5; ENST00000480614.1; ENST00000640482.1; ENST00000497139.5; ENST00000520948.5; ENST00000518689.5; ENST00000520265.1; ENST00000482630.6; ENST00000372064.8; ENST00000493786.2; ENST00000518824.5; ENST00000523125.5; ENST00000372067.7; ENST00000640499.1; ENST00000617771.5; ENST00000372077.8; ENST00000611736.5; ENST00000324450.10; ENST00000523950.5; ENST00000372055.8; ENST00000413642.7 | ||
| External Link | RMBase: m6A_site_718908 | ||
| mod ID: M6ASITE075316 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779216-43779217:+ | [15] | |
| Sequence | TGTGTCAGGGGGCACTGTGGACACTGGCTCACTGGCTTGCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000324450.10; ENST00000523873.5; ENST00000523125.5; ENST00000640499.1; ENST00000520948.5; ENST00000518689.5; ENST00000372077.8; ENST00000520265.1; ENST00000417285.6; ENST00000480614.1; ENST00000519767.5; ENST00000640482.1; ENST00000413642.7; ENST00000640653.1; ENST00000230480.10; ENST00000425836.6; ENST00000611736.5; ENST00000372055.8; ENST00000518824.5; ENST00000372064.8; ENST00000615393.5; ENST00000482630.6; ENST00000457104.6; ENST00000493786.2; ENST00000617771.5; ENST00000372067.7; ENST00000497139.5; ENST00000523950.5; ENST00000621747.5 | ||
| External Link | RMBase: m6A_site_718909 | ||
| mod ID: M6ASITE075317 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779242-43779243:+ | [15] | |
| Sequence | GCTCACTGGCTTGCTCTAGGACACCCACAGTGGGGAGAGGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000640482.1; ENST00000523873.5; ENST00000413642.7; ENST00000497139.5; ENST00000457104.6; ENST00000372064.8; ENST00000640653.1; ENST00000617771.5; ENST00000520948.5; ENST00000640499.1; ENST00000482630.6; ENST00000230480.10; ENST00000621747.5; ENST00000425836.6; ENST00000611736.5; ENST00000324450.10; ENST00000372067.7; ENST00000417285.6; ENST00000493786.2; ENST00000518824.5; ENST00000520265.1; ENST00000480614.1; ENST00000519767.5; ENST00000372055.8; ENST00000523950.5; ENST00000372077.8; ENST00000518689.5; ENST00000615393.5; ENST00000523125.5 | ||
| External Link | RMBase: m6A_site_718910 | ||
| mod ID: M6ASITE075318 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779503-43779504:+ | [12] | |
| Sequence | CAGGTAGGATGGGGTGGGGGACAAGGTCTGGCGGCAGTAAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000457104.6; ENST00000372067.7; ENST00000324450.10; ENST00000425836.6; ENST00000518689.5; ENST00000611736.5; ENST00000617771.5; ENST00000518824.5; ENST00000520948.5; ENST00000230480.10; ENST00000523873.5; ENST00000480614.1; ENST00000615393.5; ENST00000482630.6; ENST00000372064.8; ENST00000417285.6; ENST00000523950.5; ENST00000523125.5; ENST00000640482.1; ENST00000621747.5; ENST00000497139.5; ENST00000493786.2; ENST00000413642.7; ENST00000640499.1; ENST00000520265.1; ENST00000519767.5; ENST00000640653.1; ENST00000372077.8; ENST00000372055.8 | ||
| External Link | RMBase: m6A_site_718911 | ||
| mod ID: M6ASITE075319 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779532-43779533:+ | [12] | |
| Sequence | GGCGGCAGTAACCCTTCAAGACAGGGTGGGCGGCTGGCATC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000640482.1; ENST00000523950.5; ENST00000493786.2; ENST00000523125.5; ENST00000324450.10; ENST00000611736.5; ENST00000425836.6; ENST00000615393.5; ENST00000518689.5; ENST00000497139.5; ENST00000640653.1; ENST00000519767.5; ENST00000457104.6; ENST00000372067.7; ENST00000523873.5; ENST00000617771.5; ENST00000480614.1; ENST00000372055.8; ENST00000640499.1; ENST00000621747.5; ENST00000520265.1; ENST00000417285.6; ENST00000518824.5; ENST00000372064.8; ENST00000413642.7; ENST00000230480.10; ENST00000520948.5; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718912 | ||
| mod ID: M6ASITE075320 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779578-43779579:+ | [12] | |
| Sequence | GAGCTTGCAGGGAAAGAGAGACTGAGAGAGAGCACCTGTGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000324450.10; ENST00000520948.5; ENST00000640499.1; ENST00000372064.8; ENST00000611736.5; ENST00000523950.5; ENST00000617771.5; ENST00000372055.8; ENST00000518689.5; ENST00000497139.5; ENST00000621747.5; ENST00000640653.1; ENST00000480614.1; ENST00000457104.6; ENST00000417285.6; ENST00000413642.7; ENST00000482630.6; ENST00000518824.5; ENST00000372067.7; ENST00000523873.5; ENST00000523125.5; ENST00000493786.2; ENST00000640482.1; ENST00000230480.10; ENST00000425836.6; ENST00000372077.8; ENST00000615393.5; ENST00000519767.5; ENST00000520265.1 | ||
| External Link | RMBase: m6A_site_718913 | ||
| mod ID: M6ASITE075321 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779646-43779647:+ | [12] | |
| Sequence | CTGCCTCCAGTGCTGTGCGGACATTGAAGCCCCCACCAGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000417285.6; ENST00000480614.1; ENST00000518824.5; ENST00000520265.1; ENST00000372067.7; ENST00000640482.1; ENST00000413642.7; ENST00000372055.8; ENST00000230480.10; ENST00000640499.1; ENST00000324450.10; ENST00000372064.8; ENST00000457104.6; ENST00000523125.5; ENST00000621747.5; ENST00000617771.5; ENST00000611736.5; ENST00000518689.5; ENST00000520948.5; ENST00000372077.8; ENST00000615393.5; ENST00000640653.1; ENST00000497139.5; ENST00000523950.5; ENST00000523873.5; ENST00000519767.5; ENST00000425836.6; ENST00000482630.6; ENST00000493786.2 | ||
| External Link | RMBase: m6A_site_718914 | ||
| mod ID: M6ASITE075322 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779723-43779724:+ | [12] | |
| Sequence | CAGAGCGAGGGGATGCGGAAACCTTCCTTCCACCCTTTGGT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000523873.5; ENST00000493786.2; ENST00000519767.5; ENST00000518689.5; ENST00000523950.5; ENST00000640499.1; ENST00000520948.5; ENST00000324450.10; ENST00000417285.6; ENST00000615393.5; ENST00000372064.8; ENST00000621747.5; ENST00000413642.7; ENST00000372067.7; ENST00000372077.8; ENST00000480614.1; ENST00000518824.5; ENST00000611736.5; ENST00000372055.8; ENST00000523125.5; ENST00000457104.6; ENST00000482630.6; ENST00000497139.5; ENST00000425836.6; ENST00000230480.10; ENST00000640653.1; ENST00000617771.5; ENST00000520265.1; ENST00000640482.1 | ||
| External Link | RMBase: m6A_site_718915 | ||
| mod ID: M6ASITE075323 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779761-43779762:+ | [12] | |
| Sequence | GGTGCTTTCTCCTAAGGGGGACAGACTTGCCCTCTCTGGTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000482630.6; ENST00000640653.1; ENST00000457104.6; ENST00000230480.10; ENST00000617771.5; ENST00000611736.5; ENST00000372064.8; ENST00000417285.6; ENST00000520948.5; ENST00000518824.5; ENST00000372055.8; ENST00000518689.5; ENST00000425836.6; ENST00000523950.5; ENST00000324450.10; ENST00000621747.5; ENST00000615393.5; ENST00000372067.7; ENST00000640482.1; ENST00000523125.5; ENST00000493786.2; ENST00000519767.5; ENST00000640499.1; ENST00000497139.5; ENST00000413642.7; ENST00000372077.8; ENST00000523873.5; ENST00000520265.1 | ||
| External Link | RMBase: m6A_site_718916 | ||
| mod ID: M6ASITE075324 | Click to Show/Hide the Full List | ||
| mod site | chr6:43779813-43779814:+ | [12] | |
| Sequence | TCCTTTCTTCCCTGTGACAGACATCCTGAGGTGTGTTCTCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000611736.5; ENST00000480614.1; ENST00000518824.5; ENST00000640482.1; ENST00000417285.6; ENST00000372064.8; ENST00000520948.5; ENST00000324450.10; ENST00000425836.6; ENST00000621747.5; ENST00000523950.5; ENST00000497139.5; ENST00000640499.1; ENST00000617771.5; ENST00000230480.10; ENST00000640653.1; ENST00000372067.7; ENST00000523125.5; ENST00000413642.7; ENST00000457104.6; ENST00000523873.5; ENST00000615393.5; ENST00000482630.6; ENST00000518689.5; ENST00000372055.8; ENST00000519767.5; ENST00000372077.8; ENST00000493786.2; ENST00000520265.1 | ||
| External Link | RMBase: m6A_site_718917 | ||
| mod ID: M6ASITE075325 | Click to Show/Hide the Full List | ||
| mod site | chr6:43780093-43780094:+ | [15] | |
| Sequence | TGCCTGCCCAGGGCTCCAGGACACCCAGCCCTGCCTCCCAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000523950.5; ENST00000457104.6; ENST00000523873.5; ENST00000520948.5; ENST00000372055.8; ENST00000497139.5; ENST00000417285.6; ENST00000621747.5; ENST00000372077.8; ENST00000518689.5; ENST00000324450.10; ENST00000520265.1; ENST00000372067.7; ENST00000482630.6; ENST00000615393.5; ENST00000611736.5; ENST00000519767.5; ENST00000425836.6; ENST00000523125.5; ENST00000480614.1; ENST00000617771.5; ENST00000640499.1; ENST00000413642.7; ENST00000230480.10; ENST00000493786.2; ENST00000518824.5; ENST00000640653.1; ENST00000372064.8; ENST00000640482.1 | ||
| External Link | RMBase: m6A_site_718918 | ||
| mod ID: M6ASITE075326 | Click to Show/Hide the Full List | ||
| mod site | chr6:43780550-43780551:+ | [12] | |
| Sequence | ATCGAGTGCTTGCTGCCCAGACACGCCTGTGTGCGCCCGCG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000640653.1; ENST00000523950.5; ENST00000615393.5; ENST00000372064.8; ENST00000457104.6; ENST00000520265.1; ENST00000372077.8; ENST00000617771.5; ENST00000230480.10; ENST00000520948.5; ENST00000425836.6; ENST00000523873.5; ENST00000640499.1; ENST00000482630.6; ENST00000493786.2; ENST00000417285.6; ENST00000518824.5; ENST00000324450.10; ENST00000413642.7; ENST00000518689.5; ENST00000611736.5; ENST00000640482.1; ENST00000519767.5; ENST00000523125.5; ENST00000372067.7; ENST00000497139.5; ENST00000621747.5; ENST00000372055.8 | ||
| External Link | RMBase: m6A_site_718919 | ||
| mod ID: M6ASITE075327 | Click to Show/Hide the Full List | ||
| mod site | chr6:43780586-43780587:+ | [12] | |
| Sequence | CCGCGCATGCCTCCCCAGAGACCACCTGCCTCCTGACACTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482630.6; ENST00000372064.8; ENST00000640499.1; ENST00000518689.5; ENST00000615393.5; ENST00000621747.5; ENST00000497139.5; ENST00000640653.1; ENST00000523125.5; ENST00000520265.1; ENST00000480614.1; ENST00000640482.1; ENST00000230480.10; ENST00000457104.6; ENST00000372055.8; ENST00000417285.6; ENST00000617771.5; ENST00000519767.5; ENST00000523950.5; ENST00000372077.8; ENST00000518824.5; ENST00000425836.6; ENST00000324450.10; ENST00000520948.5; ENST00000493786.2; ENST00000523873.5; ENST00000413642.7; ENST00000611736.5; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718920 | ||
| mod ID: M6ASITE075328 | Click to Show/Hide the Full List | ||
| mod site | chr6:43781055-43781056:+ | [12] | |
| Sequence | CTGGAGGATTAAGGGAGGGGACCCTGGCTTGGCTGGGCACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482630.6; ENST00000425836.6; ENST00000640499.1; ENST00000480614.1; ENST00000611736.5; ENST00000493786.2; ENST00000520948.5; ENST00000523873.5; ENST00000457104.6; ENST00000640653.1; ENST00000372064.8; ENST00000523950.5; ENST00000230480.10; ENST00000372067.7; ENST00000372055.8; ENST00000324450.10; ENST00000520265.1; ENST00000519767.5; ENST00000640482.1; ENST00000372077.8; ENST00000518689.5; ENST00000518824.5; ENST00000497139.5; ENST00000413642.7; ENST00000615393.5; ENST00000621747.5; ENST00000617771.5; ENST00000417285.6; ENST00000523125.5 | ||
| External Link | RMBase: m6A_site_718921 | ||
| mod ID: M6ASITE075329 | Click to Show/Hide the Full List | ||
| mod site | chr6:43781867-43781868:+ | [12] | |
| Sequence | GGGTGGGGGTGCAGCTGCGGACATGTTAGGGGGTGTTGCAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000425836.6; ENST00000417285.6; ENST00000615393.5; ENST00000230480.10; ENST00000617771.5; ENST00000611736.5; ENST00000520265.1; ENST00000640499.1; ENST00000519767.5; ENST00000523873.5; ENST00000493786.2; ENST00000640482.1; ENST00000372055.8; ENST00000372064.8; ENST00000372077.8; ENST00000640653.1; ENST00000621747.5; ENST00000518689.5; ENST00000520948.5; ENST00000497139.5; ENST00000413642.7; ENST00000482630.6; ENST00000518824.5; ENST00000480614.1; ENST00000523125.5; ENST00000372067.7; ENST00000523950.5; ENST00000457104.6; ENST00000324450.10 | ||
| External Link | RMBase: m6A_site_718922 | ||
| mod ID: M6ASITE075330 | Click to Show/Hide the Full List | ||
| mod site | chr6:43781997-43781998:+ | [13] | |
| Sequence | CGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGTGTAA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000640482.1; ENST00000520265.1; ENST00000417285.6; ENST00000518689.5; ENST00000480614.1; ENST00000372067.7; ENST00000520948.5; ENST00000615393.5; ENST00000611736.5; ENST00000457104.6; ENST00000372055.8; ENST00000621747.5; ENST00000617771.5; ENST00000523125.5; ENST00000518824.5; ENST00000324450.10; ENST00000640653.1; ENST00000372064.8; ENST00000523873.5; ENST00000230480.10; ENST00000640499.1; ENST00000413642.7; ENST00000493786.2; ENST00000425836.6; ENST00000372077.8; ENST00000497139.5; ENST00000519767.5; ENST00000523950.5; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718923 | ||
| mod ID: M6ASITE075331 | Click to Show/Hide the Full List | ||
| mod site | chr6:43782032-43782033:+ | [12] | |
| Sequence | GTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519767.5; ENST00000640482.1; ENST00000324450.10; ENST00000493786.2; ENST00000457104.6; ENST00000640653.1; ENST00000480614.1; ENST00000523950.5; ENST00000621747.5; ENST00000372064.8; ENST00000372055.8; ENST00000497139.5; ENST00000482630.6; ENST00000520265.1; ENST00000372067.7; ENST00000230480.10; ENST00000615393.5; ENST00000640499.1; ENST00000617771.5; ENST00000611736.5; ENST00000523125.5; ENST00000518689.5; ENST00000425836.6; ENST00000372077.8; ENST00000523873.5; ENST00000520948.5; ENST00000413642.7; ENST00000518824.5; ENST00000417285.6 | ||
| External Link | RMBase: m6A_site_718924 | ||
| mod ID: M6ASITE075332 | Click to Show/Hide the Full List | ||
| mod site | chr6:43782038-43782039:+ | [12] | |
| Sequence | ATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000621747.5; ENST00000413642.7; ENST00000519767.5; ENST00000372067.7; ENST00000640482.1; ENST00000520265.1; ENST00000518689.5; ENST00000640499.1; ENST00000497139.5; ENST00000518824.5; ENST00000230480.10; ENST00000640653.1; ENST00000493786.2; ENST00000523125.5; ENST00000617771.5; ENST00000520948.5; ENST00000523873.5; ENST00000482630.6; ENST00000372055.8; ENST00000611736.5; ENST00000457104.6; ENST00000523950.5; ENST00000372077.8; ENST00000615393.5; ENST00000372064.8; ENST00000417285.6; ENST00000324450.10; ENST00000480614.1; ENST00000425836.6 | ||
| External Link | RMBase: m6A_site_718925 | ||
| mod ID: M6ASITE075333 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784121-43784122:+ | [12] | |
| Sequence | CCCCACACCAGCCCCTAGAGACTGAACTGAAAACCCTCCTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000520948.5; ENST00000372064.8; ENST00000493786.2; ENST00000372067.7; ENST00000523125.5; ENST00000457104.6; ENST00000425836.6; ENST00000640482.1; ENST00000518689.5; ENST00000324450.10; ENST00000230480.10; ENST00000372077.8; ENST00000372055.8; ENST00000480614.1; ENST00000497139.5; ENST00000519767.5; ENST00000615393.5; ENST00000417285.6; ENST00000617771.5; ENST00000640653.1; ENST00000518824.5; ENST00000523873.5; ENST00000413642.7; ENST00000520265.1; ENST00000621747.5; ENST00000523950.5; ENST00000611736.5; ENST00000640499.1; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718926 | ||
| mod ID: M6ASITE075334 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784126-43784127:+ | [12] | |
| Sequence | CACCAGCCCCTAGAGACTGAACTGAAAACCCTCCTCAGCAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000523125.5; ENST00000482630.6; ENST00000621747.5; ENST00000640653.1; ENST00000523950.5; ENST00000617771.5; ENST00000372067.7; ENST00000230480.10; ENST00000372055.8; ENST00000518689.5; ENST00000523873.5; ENST00000520948.5; ENST00000425836.6; ENST00000413642.7; ENST00000519767.5; ENST00000640482.1; ENST00000480614.1; ENST00000372077.8; ENST00000640499.1; ENST00000518824.5; ENST00000324450.10; ENST00000611736.5; ENST00000417285.6; ENST00000372064.8; ENST00000520265.1; ENST00000493786.2; ENST00000615393.5; ENST00000497139.5; ENST00000457104.6 | ||
| External Link | RMBase: m6A_site_718927 | ||
| mod ID: M6ASITE075335 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784133-43784134:+ | [12] | |
| Sequence | CCCTAGAGACTGAACTGAAAACCCTCCTCAGCAGGGAGCCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000324450.10; ENST00000482630.6; ENST00000230480.10; ENST00000640482.1; ENST00000523873.5; ENST00000372055.8; ENST00000518689.5; ENST00000417285.6; ENST00000519767.5; ENST00000640653.1; ENST00000372077.8; ENST00000372067.7; ENST00000372064.8; ENST00000413642.7; ENST00000493786.2; ENST00000617771.5; ENST00000457104.6; ENST00000611736.5; ENST00000520948.5; ENST00000621747.5; ENST00000523125.5; ENST00000518824.5; ENST00000615393.5; ENST00000497139.5; ENST00000640499.1; ENST00000480614.1; ENST00000425836.6; ENST00000520265.1; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718928 | ||
| mod ID: M6ASITE075336 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784545-43784546:+ | [13] | |
| Sequence | TTCCATTTCCCTCAGATGTGACAAGCCGAGGCGGTGAGCCG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000640653.1; ENST00000230480.10; ENST00000523950.5; ENST00000518689.5; ENST00000324450.10; ENST00000372055.8; ENST00000482630.6; ENST00000413642.7; ENST00000480614.1; ENST00000425836.6; ENST00000640499.1; ENST00000523125.5; ENST00000520265.1; ENST00000615393.5; ENST00000621747.5; ENST00000417285.6; ENST00000372064.8; ENST00000640482.1; ENST00000497139.5; ENST00000457104.6; ENST00000518824.5; ENST00000493786.2; ENST00000372077.8; ENST00000611736.5; ENST00000519767.5; ENST00000372067.7; ENST00000523873.5; ENST00000617771.5; ENST00000520948.5 | ||
| External Link | RMBase: m6A_site_718929 | ||
| mod ID: M6ASITE075337 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784601-43784602:+ | [12] | |
| Sequence | CCTCCCTCAGGGTTTCGGGAACCAGATCTCTCACCAGGAAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000523950.5; ENST00000372077.8; ENST00000372067.7; ENST00000520948.5; ENST00000617771.5; ENST00000480614.1; ENST00000518824.5; ENST00000482630.6; ENST00000372064.8; ENST00000523873.5; ENST00000372055.8; ENST00000497139.5; ENST00000230480.10; ENST00000425836.6 | ||
| External Link | RMBase: m6A_site_718930 | ||
| mod ID: M6ASITE075338 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784623-43784624:+ | [12] | |
| Sequence | CAGATCTCTCACCAGGAAAGACTGATACAGAACGATCGATA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000425836.6; ENST00000617771.5; ENST00000482630.6; ENST00000372077.8; ENST00000480614.1; ENST00000230480.10; ENST00000372067.7; ENST00000518824.5; ENST00000523950.5; ENST00000372064.8; ENST00000520948.5; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718931 | ||
| mod ID: M6ASITE075339 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784643-43784644:+ | [16] | |
| Sequence | ACTGATACAGAACGATCGATACAGAAACCACGCTGCCGCCA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000523950.5; ENST00000497139.5; ENST00000425836.6; ENST00000230480.10; ENST00000372064.8; ENST00000480614.1; ENST00000372067.7; ENST00000372077.8; ENST00000518824.5; ENST00000520948.5; ENST00000482630.6 | ||
| External Link | RMBase: m6A_site_718932 | ||
| mod ID: M6ASITE075340 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784649-43784650:+ | [12] | |
| Sequence | ACAGAACGATCGATACAGAAACCACGCTGCCGCCACCACAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000425836.6; ENST00000523950.5; ENST00000482630.6; ENST00000372077.8; ENST00000520948.5; ENST00000372064.8; ENST00000230480.10; ENST00000480614.1; ENST00000497139.5; ENST00000518824.5 | ||
| External Link | RMBase: m6A_site_718933 | ||
| mod ID: M6ASITE075341 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784681-43784682:+ | [13] | |
| Sequence | CCACCACACCATCACCATCGACAGAACAGTCCTTAATCCAG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T; CD8T | ||
| Seq Type List | MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000230480.10; ENST00000372064.8; ENST00000497139.5; ENST00000523950.5; ENST00000520948.5; ENST00000480614.1; ENST00000425836.6; ENST00000372067.7; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718934 | ||
| mod ID: M6ASITE075342 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784686-43784687:+ | [12] | |
| Sequence | ACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAACC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000230480.10; ENST00000372077.8; ENST00000497139.5; ENST00000372064.8; ENST00000480614.1; ENST00000520948.5; ENST00000372067.7; ENST00000425836.6; ENST00000523950.5 | ||
| External Link | RMBase: m6A_site_718935 | ||
| mod ID: M6ASITE075343 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784704-43784705:+ | [12] | |
| Sequence | GAACAGTCCTTAATCCAGAAACCTGAAATGAAGGAAGAGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000520948.5; ENST00000480614.1; ENST00000372067.7; ENST00000523950.5; ENST00000497139.5; ENST00000372064.8; ENST00000230480.10; ENST00000425836.6; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718936 | ||
| mod ID: M6ASITE075344 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784726-43784727:+ | [12] | |
| Sequence | CTGAAATGAAGGAAGAGGAGACTCTGCGCAGAGCACTTTGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000497139.5; ENST00000372064.8; ENST00000520948.5; ENST00000523950.5; ENST00000372067.7; ENST00000480614.1; ENST00000230480.10; ENST00000425836.6 | ||
| External Link | RMBase: m6A_site_718937 | ||
| mod ID: M6ASITE075345 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784761-43784762:+ | [12] | |
| Sequence | CTTTGGGTCCGGAGGGCGAGACTCCGGCGGAAGCATTCCCG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000372077.8; ENST00000523950.5; ENST00000425836.6; ENST00000480614.1; ENST00000520948.5; ENST00000497139.5; ENST00000372067.7; ENST00000230480.10 | ||
| External Link | RMBase: m6A_site_718938 | ||
| mod ID: M6ASITE075346 | Click to Show/Hide the Full List | ||
| mod site | chr6:43784895-43784896:+ | [12] | |
| Sequence | TATTTCTGGGATTCCTGTAGACACACCCACCCACATACATA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; fibroblasts; GM12878; LCLs; MT4; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000372067.7; ENST00000480614.1; ENST00000425836.6; ENST00000520948.5; ENST00000523950.5; ENST00000230480.10; ENST00000372077.8; ENST00000497139.5; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718939 | ||
| mod ID: M6ASITE075347 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785003-43785004:+ | [17] | |
| Sequence | TATATTCTTTTTTTAAATTAACAGTGCTAATGTTATTGGTG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000480614.1; ENST00000497139.5; ENST00000372067.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718940 | ||
| mod ID: M6ASITE075348 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785043-43785044:+ | [18] | |
| Sequence | GTCTTCACTGGATGTATTTGACTGCTGTGGACTTGAGTTGG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000497139.5; ENST00000372077.8; ENST00000372064.8; ENST00000480614.1; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718941 | ||
| mod ID: M6ASITE075349 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785053-43785054:+ | [12] | |
| Sequence | GATGTATTTGACTGCTGTGGACTTGAGTTGGGAGGGGAATG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000372067.7; ENST00000480614.1; ENST00000372077.8; ENST00000372064.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718942 | ||
| mod ID: M6ASITE075350 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785091-43785092:+ | [16] | |
| Sequence | ATGTTCCCACTCAGATCCTGACAGGGAAGAGGAGGAGATGA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain; liver; hESC-HEK293T; CD8T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000497139.5; ENST00000372067.7; ENST00000480614.1; ENST00000372064.8; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718943 | ||
| mod ID: M6ASITE075351 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785115-43785116:+ | [12] | |
| Sequence | GGAAGAGGAGGAGATGAGAGACTCTGGCATGATCTTTTTTT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000372077.8; ENST00000480614.1; ENST00000372067.7; ENST00000372064.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718944 | ||
| mod ID: M6ASITE075352 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785224-43785225:+ | [12] | |
| Sequence | AATATGACCCAGTTTTGGGAACACCGACAAACCCAGCCCTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000497139.5; ENST00000372067.7; ENST00000372077.8; ENST00000372064.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718945 | ||
| mod ID: M6ASITE075353 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785230-43785231:+ | [13] | |
| Sequence | ACCCAGTTTTGGGAACACCGACAAACCCAGCCCTGGCGCTG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000497139.5; ENST00000372067.7; ENST00000372077.8; ENST00000372064.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718946 | ||
| mod ID: M6ASITE075354 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785234-43785235:+ | [12] | |
| Sequence | AGTTTTGGGAACACCGACAAACCCAGCCCTGGCGCTGAGCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000497139.5; ENST00000372077.8; ENST00000372067.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718947 | ||
| mod ID: M6ASITE075355 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785272-43785273:+ | [18] | |
| Sequence | GCCTCTCTACCCCAGGTCAGACGGACAGAAAGACAGATCAC | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000497139.5; ENST00000372064.8; ENST00000372077.8; ENST00000480614.1; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718948 | ||
| mod ID: M6ASITE075356 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785276-43785277:+ | [12] | |
| Sequence | CTCTACCCCAGGTCAGACGGACAGAAAGACAGATCACAGGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000497139.5; ENST00000480614.1; ENST00000372077.8; ENST00000372067.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718949 | ||
| mod ID: M6ASITE075357 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785284-43785285:+ | [12] | |
| Sequence | CAGGTCAGACGGACAGAAAGACAGATCACAGGTACAGGGAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; brain; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000497139.5; ENST00000372064.8; ENST00000372077.8; ENST00000372067.7; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718950 | ||
| mod ID: M6ASITE075358 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785309-43785310:+ | [12] | |
| Sequence | TCACAGGTACAGGGATGAGGACACCGGCTCTGACCAGGAGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000372077.8; ENST00000372067.7; ENST00000480614.1; ENST00000372064.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718951 | ||
| mod ID: M6ASITE075359 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785345-43785346:+ | [12] | |
| Sequence | GGAGTTTGGGGAGCTTCAGGACATTGCTGTGCTTTGGGGAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; brain; kidney; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000372077.8; ENST00000372064.8; ENST00000480614.1; ENST00000372067.7; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718952 | ||
| mod ID: M6ASITE075360 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785373-43785374:+ | [13] | |
| Sequence | GTGCTTTGGGGATTCCCTCCACATGCTGCACGCGCATCTCG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000497139.5; ENST00000372077.8; ENST00000372067.7; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718953 | ||
| mod ID: M6ASITE075361 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785474-43785475:+ | [12] | |
| Sequence | GCTTCTGAGTTGCCCAGGAGACCACTGGCAGATGTCCCGGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000372077.8; ENST00000372064.8; ENST00000497139.5; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718954 | ||
| mod ID: M6ASITE075362 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785506-43785507:+ | [12] | |
| Sequence | TGTCCCGGCGAAGAGAAGAGACACATTGTTGGAAGAAGCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000372067.7; ENST00000372064.8; ENST00000497139.5; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718955 | ||
| mod ID: M6ASITE075363 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785533-43785534:+ | [16] | |
| Sequence | GTTGGAAGAAGCAGCCCATGACAGCTCCCCTTCCTGGGACT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000480614.1; ENST00000372064.8; ENST00000497139.5; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718956 | ||
| mod ID: M6ASITE075364 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785551-43785552:+ | [12] | |
| Sequence | TGACAGCTCCCCTTCCTGGGACTCGCCCTCATCCTCTTCCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000372067.7; ENST00000372064.8; rmsk_1934922; ENST00000480614.1; ENST00000372077.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718957 | ||
| mod ID: M6ASITE075365 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785602-43785603:+ | [12] | |
| Sequence | CTGGGGTGCAGCCTAAAAGGACCTATGTCCTCACACCATTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000372067.7; ENST00000497139.5; ENST00000372077.8; ENST00000480614.1; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718958 | ||
| mod ID: M6ASITE075366 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785614-43785615:+ | [13] | |
| Sequence | CTAAAAGGACCTATGTCCTCACACCATTGAAACCACTAGTT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000372067.7; ENST00000497139.5; ENST00000372077.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718959 | ||
| mod ID: M6ASITE075367 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785625-43785626:+ | [12] | |
| Sequence | TATGTCCTCACACCATTGAAACCACTAGTTCTGTCCCCCCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000372077.8; ENST00000480614.1; ENST00000497139.5; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718960 | ||
| mod ID: M6ASITE075368 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785650-43785651:+ | [12] | |
| Sequence | TAGTTCTGTCCCCCCAGGAGACCTGGTTGTGTGTGTGTGAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000497139.5; ENST00000480614.1; ENST00000372064.8; ENST00000372077.8 | ||
| External Link | RMBase: m6A_site_718961 | ||
| mod ID: M6ASITE075369 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785727-43785728:+ | [12] | |
| Sequence | CCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTGCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; kidney; liver; A549; U2OS; GM12878; LCLs; MM6; Huh7; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000497139.5; ENST00000372077.8; ENST00000480614.1; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718962 | ||
| mod ID: M6ASITE075370 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785825-43785826:+ | [12] | |
| Sequence | CTTTTTAATTAGAAATTAAAACAGTTAATTTAATTAAAGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; MM6; Huh7; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000497139.5; ENST00000372064.8; ENST00000372077.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718963 | ||
| mod ID: M6ASITE075371 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785934-43785935:+ | [17] | |
| Sequence | TCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAAT | ||
| Motif Score | 2.8355 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000497139.5; ENST00000372064.8; ENST00000372077.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718964 | ||
| mod ID: M6ASITE075372 | Click to Show/Hide the Full List | ||
| mod site | chr6:43785988-43785989:+ | [17] | |
| Sequence | CTCTCTCTCCCTGATCGGTGACAGTCACTAGCTTATCTTGA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000372067.7; ENST00000372077.8; ENST00000497139.5; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718965 | ||
| mod ID: M6ASITE075373 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786009-43786010:+ | [12] | |
| Sequence | CAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000372067.7; ENST00000480614.1; ENST00000372064.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718966 | ||
| mod ID: M6ASITE075374 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786029-43786030:+ | [17] | |
| Sequence | ACAGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000372067.7; ENST00000497139.5; ENST00000480614.1; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718967 | ||
| mod ID: M6ASITE075375 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786031-43786032:+ | [17] | |
| Sequence | AGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCCGA | ||
| Motif Score | 2.506922619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000480614.1; ENST00000372064.8; ENST00000497139.5; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718968 | ||
| mod ID: M6ASITE075376 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786069-43786070:+ | [13] | |
| Sequence | CGATCCCCTGGCTCCCCAGCACACATTCCTTTGAAATAAGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000372064.8; ENST00000372067.7; ENST00000372077.8; ENST00000497139.5; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718969 | ||
| mod ID: M6ASITE075377 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786105-43786106:+ | [17] | |
| Sequence | TAAGGTTTCAATATACATCTACATACTATATATATATTTGG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000372064.8; rmsk_1934924; ENST00000497139.5; ENST00000372077.8; ENST00000480614.1 | ||
| External Link | RMBase: m6A_site_718970 | ||
| mod ID: M6ASITE075378 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786192-43786193:+ | [17] | |
| Sequence | ATGTGATTCTGATAAAATAGACATTGCTATTCTGTTTTTTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000372077.8; ENST00000497139.5; ENST00000372067.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718971 | ||
| mod ID: M6ASITE075379 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786249-43786250:+ | [13] | |
| Sequence | AAGAAAAAATAGAGAATTCTACATACTAAATCTCTCTCCTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000497139.5; ENST00000480614.1; ENST00000372067.7; ENST00000372077.8; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718972 | ||
| mod ID: M6ASITE075380 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786310-43786311:+ | [17] | |
| Sequence | ATCATTTATTTATTGGTGCTACTGTTTATCCGTAATAATTG | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000372067.7; ENST00000372077.8; ENST00000480614.1; ENST00000497139.5; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718973 | ||
| mod ID: M6ASITE075381 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786347-43786348:+ | [16] | |
| Sequence | ATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | kidney; liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000480614.1; ENST00000372077.8; ENST00000497139.5; ENST00000372067.7; ENST00000372064.8 | ||
| External Link | RMBase: m6A_site_718974 | ||
| mod ID: M6ASITE075382 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786394-43786395:+ | [16] | |
| Sequence | TTTTCGAGATATTCCGTAGTACATATTTATTTTTAAACAAC | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000372077.8; ENST00000372064.8; ENST00000497139.5; ENST00000480614.1; ENST00000372067.7 | ||
| External Link | RMBase: m6A_site_718975 | ||
| mod ID: M6ASITE075383 | Click to Show/Hide the Full List | ||
| mod site | chr6:43786410-43786411:+ | [13] | |
| Sequence | TAGTACATATTTATTTTTAAACAACGACAAAGAAATACAGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; Huh7; AML | ||
| Seq Type List | MAZTER-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000480614.1; ENST00000372067.7; ENST00000372077.8; ENST00000372064.8; ENST00000497139.5 | ||
| External Link | RMBase: m6A_site_718976 | ||
References



