m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00373)

Target Name	PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A)
Synonyms	PGC-1-alpha; PPAR-gamma coactivator 1-alpha; PPARGC-1-alpha; Ligand effect modulator 6; LEM6; PGC1; PGC1A; PPARGC1 Click to Show/Hide
Gene Name	PPARGC1A
Chromosomal Location	4p15.2
Function	Transcriptional coactivator for steroid receptors and nuclear receptors. Greatly increases the transcriptional activity of PPARG and thyroid hormone receptor on the uncoupling protein promoter. Can regulate key mitochondrial genes that contribute to the program of adaptive thermogenesis. Plays an essential role in metabolic reprogramming in response to dietary availability through coordination of the expression of a wide array of genes involved in glucose and fatty acid metabolism. Induces the expression of PERM1 in the skeletal muscle in an ESRRA-dependent manner. Also involved in the integration of the circadian rhythms and energy metabolism. Required for oscillatory expression of clock genes, such as ARNTL/BMAL1 and NR1D1, through the coactivation of RORA and RORC, and metabolic genes, such as PDK4 and PEPCK. Click to Show/Hide
Gene ID	10891
Uniprot ID	PRGC1_HUMAN
HGNC ID	HGNC:9237
KEGG ID	hsa:10891

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PPARGC1A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 4.58E+00 p-value: 7.10E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO plays a critical anti-tumorigenic role in Clear Cell Renal Cell Carcinoma.Restored expression of FTO, through reducing m6A levels in mRNA transcripts of its critical target gene PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A), increases mitochondrial content, ROS production and oxidative damage, with the most important effect of repressed tumour growth.
Target Regulation	Up regulation
Responsed Disease	clear cell renal cell carcinoma		ICD-11: 2C90.0	Disease Info
Cell Process	Oxidative stress
	ROS production
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	769-P	Renal cell carcinoma	Homo sapiens	CVCL_1050
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	Five- to 6-week-old male athymic nude mice purchased by Charles River were used for the xenograft model. 769-P cells stably expressing Ctrl, FTO and FTO-mut were trypsinized and washed twice to thrice with standardized PBS, and then, 5 × 10⁶ cells in 100 uL of PBS was subcutaneously injected into the flanks of the mice (five mice per group). Mice were monitored twice every week for tumour growth, and tumour diameters were measured using a caliper.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	FTO downregulation suppressed mitochondria biogenesis and energy production, showing as the decreased mitochondria mass and mitochondrial DNA (mtDNA) content, the downregulated expression of mtDNA-encoding genes and PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A) gene, together with declined ATP level. These findings provide the first evidence for the contribution of FTO for skeletal muscle differentiation.
Target Regulation	Up regulation
Responsed Disease	Muscular dystrophies		ICD-11: 8C70	Disease Info
Cell Process	Myogenic differentiation
	mTOR signaling pathway (hsa04150)
In-vitro Model	MPM (Mouse primary myoblasts from about 10-day-old C57BL/6J were isolated)
	C2C12	Normal	Mus musculus	CVCL_0188
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
In-vivo Model	To generate doxycycline-inducible skeletal muscle-specific FTO deletion mice, FTO^flox/flox mice were crossed with HSA-Cre mice to generate FTO^flox/+ HSA-Cre mice, which were then crossed to FTO^flox/flox mice to generate FTO^flox/flox and FTO^flox/flox HSA-Cre mice.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shMETTL3 MOLM13 cells Control: MOLM13 cells		GSE98623
Regulation		logFC: -3.59E+00 p-value: 8.55E-10
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Ehhadh, Fasn, Foxo, PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A) and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Target Regulation	Up regulation
Responsed Disease	Type 2 diabetes mellitus		ICD-11: 5A11	Disease Info
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO plays a critical anti-tumorigenic role in Clear Cell Renal Cell Carcinoma.Restored expression of FTO, through reducing m6A levels in mRNA transcripts of its critical target gene PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A), increases mitochondrial content, ROS production and oxidative damage, with the most important effect of repressed tumour growth.
Responsed Disease	clear cell renal cell carcinoma [ICD-11: 2C90.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Oxidative stress
	ROS production
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	769-P	Renal cell carcinoma	Homo sapiens	CVCL_1050
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	Five- to 6-week-old male athymic nude mice purchased by Charles River were used for the xenograft model. 769-P cells stably expressing Ctrl, FTO and FTO-mut were trypsinized and washed twice to thrice with standardized PBS, and then, 5 × 10⁶ cells in 100 uL of PBS was subcutaneously injected into the flanks of the mice (five mice per group). Mice were monitored twice every week for tumour growth, and tumour diameters were measured using a caliper.

Type 2 diabetes mellitus [ICD-11: 5A11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Ehhadh, Fasn, Foxo, PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A) and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Responsed Disease	Type 2 diabetes mellitus [ICD-11: 5A11]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

Muscular dystrophies [ICD-11: 8C70]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	FTO downregulation suppressed mitochondria biogenesis and energy production, showing as the decreased mitochondria mass and mitochondrial DNA (mtDNA) content, the downregulated expression of mtDNA-encoding genes and PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A) gene, together with declined ATP level. These findings provide the first evidence for the contribution of FTO for skeletal muscle differentiation.
Responsed Disease	Muscular dystrophies [ICD-11: 8C70]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Myogenic differentiation
	mTOR signaling pathway (hsa04150)
In-vitro Model	MPM (Mouse primary myoblasts from about 10-day-old C57BL/6J were isolated)
	C2C12	Normal	Mus musculus	CVCL_0188
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
In-vivo Model	To generate doxycycline-inducible skeletal muscle-specific FTO deletion mice, FTO^flox/flox mice were crossed with HSA-Cre mice to generate FTO^flox/+ HSA-Cre mice, which were then crossed to FTO^flox/flox mice to generate FTO^flox/flox and FTO^flox/flox HSA-Cre mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05346		Crosstalk Info
Epigenetic Regulator	MicroRNA 155 (MIR155)
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Clear cell renal cell carcinoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00373)

PPAR-gamma coactivator 1-alpha (PGC-1a/PPARGC1A)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000299		Click to Show/Hide the Full List
mod site	chr4:23812014-23812015:-		[6]
Sequence	TGAGGCAGGAGAATTGCTTGAACCAGGGAGGTGGAGGTTGC
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000264867.7; ENST00000506055.5; rmsk_1263028
External Link	RMBase: RNA-editing_site_103682

N6-methyladenosine (m6A)

In total 84 m6A sequence/site(s) in this target gene
mod ID: M6ASITE065458		Click to Show/Hide the Full List
mod site	chr4:23792203-23792204:-		[7]
Sequence	AGTGTAATACTGTTGGTTGAACTATGCTGAAGAGGGAAAGT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633320
mod ID: M6ASITE065459		Click to Show/Hide the Full List
mod site	chr4:23792763-23792764:-		[7]
Sequence	GGAGAGAATATTTCAAATGAACACGTGCACCCCATCATCAC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633321
mod ID: M6ASITE065460		Click to Show/Hide the Full List
mod site	chr4:23792846-23792847:-		[7]
Sequence	AGCTTTTGTATCTTCTGCAGACACTGTGGGTAGCCCATCAA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633322
mod ID: M6ASITE065461		Click to Show/Hide the Full List
mod site	chr4:23792893-23792894:-		[8]
Sequence	AAGATAGTTTTCCTCAATGGACTTCAAATTGCATCTAGAAT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633323
mod ID: M6ASITE065462		Click to Show/Hide the Full List
mod site	chr4:23793577-23793578:-		[7]
Sequence	TGACATGACTTTTCTGGAAGACATGATACACCTACTACTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633324
mod ID: M6ASITE065463		Click to Show/Hide the Full List
mod site	chr4:23793957-23793958:-		[9]
Sequence	TTCCTTTGTTTACTAAAGAGACATATTTATCAGTTGCAGAT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633325
mod ID: M6ASITE065464		Click to Show/Hide the Full List
mod site	chr4:23794103-23794104:-		[9]
Sequence	ATAATTATAGTATGATTTTTACAATAATTAATGTGTGTCTG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633326
mod ID: M6ASITE065465		Click to Show/Hide the Full List
mod site	chr4:23795091-23795092:-		[8]
Sequence	GAAACCACAGGTTCCATAGAACTAATATCCTGTCTCTCTCT
Motif Score	3.373380952
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633327
mod ID: M6ASITE065466		Click to Show/Hide the Full List
mod site	chr4:23795108-23795109:-		[7]
Sequence	TATATGACAATCCTGAAGAAACCACAGGTTCCATAGAACTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633328
mod ID: M6ASITE065467		Click to Show/Hide the Full List
mod site	chr4:23795238-23795239:-		[7]
Sequence	AACCAACCAACCAACCACAAACCACCCTAAAATGACAGCCG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633329
mod ID: M6ASITE065468		Click to Show/Hide the Full List
mod site	chr4:23795272-23795273:-		[7]
Sequence	TAAATTAAAAAGGAAAGAAAACTAACAACCAACCAACCAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633330
mod ID: M6ASITE065469		Click to Show/Hide the Full List
mod site	chr4:23795362-23795363:-		[7]
Sequence	AGACACGCTTAAAACCTAGAACTTCAAAATGTTCGTATTCT
Motif Score	3.373380952
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000613098.4; ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633331
mod ID: M6ASITE065470		Click to Show/Hide the Full List
mod site	chr4:23795369-23795370:-		[7]
Sequence	TCCATGAAGACACGCTTAAAACCTAGAACTTCAAAATGTTC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000264867.7
External Link	RMBase: m6A_site_633332
mod ID: M6ASITE065471		Click to Show/Hide the Full List
mod site	chr4:23795380-23795381:-		[7]
Sequence	ATGGCAGCAGTTCCATGAAGACACGCTTAAAACCTAGAACT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633333
mod ID: M6ASITE065472		Click to Show/Hide the Full List
mod site	chr4:23795410-23795411:-		[7]
Sequence	ACCAGAATGCGCAAGGGCAAACCATTTCAAATGGCAGCAGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633334
mod ID: M6ASITE065473		Click to Show/Hide the Full List
mod site	chr4:23795444-23795445:-		[7]
Sequence	ATGTGTGGGTACATGTGAGGACTGGGGGCACCTGACCAGAA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633335
mod ID: M6ASITE065474		Click to Show/Hide the Full List
mod site	chr4:23795609-23795610:-		[7]
Sequence	AGCTGCTGAAGAGGCAAGAGACAGAATGATATCCAGTAAGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000613098.4; ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633336
mod ID: M6ASITE065475		Click to Show/Hide the Full List
mod site	chr4:23795633-23795634:-		[7]
Sequence	AACAACAATGGTTTACATGAACACAGCTGCTGAAGAGGCAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633337
mod ID: M6ASITE065476		Click to Show/Hide the Full List
mod site	chr4:23795667-23795668:-		[7]
Sequence	ACAACAACAATACAACAAGAACAACAACAACAATAACAACA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000264867.7
External Link	RMBase: m6A_site_633338
mod ID: M6ASITE065477		Click to Show/Hide the Full List
mod site	chr4:23795687-23795688:-		[7]
Sequence	CTGTACAAAAACAAAACAAAACAACAACAATACAACAAGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633339
mod ID: M6ASITE065478		Click to Show/Hide the Full List
mod site	chr4:23795692-23795693:-		[7]
Sequence	ACTCTCTGTACAAAAACAAAACAAAACAACAACAATACAAC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000613098.4; ENST00000509702.5
External Link	RMBase: m6A_site_633340
mod ID: M6ASITE065479		Click to Show/Hide the Full List
mod site	chr4:23795697-23795698:-		[7]
Sequence	TTTACACTCTCTGTACAAAAACAAAACAAAACAACAACAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000506055.5; ENST00000613098.4; ENST00000264867.7
External Link	RMBase: m6A_site_633341
mod ID: M6ASITE065480		Click to Show/Hide the Full List
mod site	chr4:23795751-23795752:-		[7]
Sequence	CAGCGCGTCCTTCCCTAAAGACTATTGCAAGTCATACTTAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000506055.5; ENST00000509702.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633342
mod ID: M6ASITE065481		Click to Show/Hide the Full List
mod site	chr4:23795772-23795773:-		[7]
Sequence	GATGGCGAATACCTCATGGGACAGCGCGTCCTTCCCTAAAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000613098.4; ENST00000506055.5
External Link	RMBase: m6A_site_633343
mod ID: M6ASITE065482		Click to Show/Hide the Full List
mod site	chr4:23795918-23795919:-		[7]
Sequence	GTGTTTTTTTTCAGATTCAAACTCAGATGACTTTGACCCTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000264867.7; ENST00000506055.5; ENST00000509702.5
External Link	RMBase: m6A_site_633344
mod ID: M6ASITE065483		Click to Show/Hide the Full List
mod site	chr4:23801734-23801735:-		[7]
Sequence	TTTCAAGTCTAACTATGCAGACCTAGGTATGGATTTTATTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633345
mod ID: M6ASITE065484		Click to Show/Hide the Full List
mod site	chr4:23801878-23801879:-		[7]
Sequence	TTTCTTTGTCCGTTGCAGAGACAGCTATGGTTTCATTACCT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633346
mod ID: M6ASITE065485		Click to Show/Hide the Full List
mod site	chr4:23802280-23802281:-		[7]
Sequence	AACACGGACAGAACTGAGGGACCGTTTTGAAGTTTTTGGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000506055.5; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633347
mod ID: M6ASITE065486		Click to Show/Hide the Full List
mod site	chr4:23802288-23802289:-		[7]
Sequence	CCTGACACAACACGGACAGAACTGAGGGACCGTTTTGAAGT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000506055.5; ENST00000613098.4; ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633348
mod ID: M6ASITE065487		Click to Show/Hide the Full List
mod site	chr4:23802293-23802294:-		[7]
Sequence	TCAGACCTGACACAACACGGACAGAACTGAGGGACCGTTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000506055.5; ENST00000509702.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633349
mod ID: M6ASITE065488		Click to Show/Hide the Full List
mod site	chr4:23802309-23802310:-		[7]
Sequence	ATTTATGTCGGTAAAATCAGACCTGACACAACACGGACAGA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000506055.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633350
mod ID: M6ASITE065489		Click to Show/Hide the Full List
mod site	chr4:23813035-23813036:-		[10]
Sequence	ATCACGTTCAAGATCGCCCTACAGCCGTCGGCCCAGGTAAT
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000264867.7; ENST00000613098.4; ENST00000509702.5; ENST00000506055.5
External Link	RMBase: m6A_site_633351
mod ID: M6ASITE065490		Click to Show/Hide the Full List
mod site	chr4:23813091-23813092:-		[7]
Sequence	TATGAGTCAAGCCACTACAGACACCGCACGCACCGAAATTC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000506055.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633352
mod ID: M6ASITE065491		Click to Show/Hide the Full List
mod site	chr4:23813799-23813800:-		[7]
Sequence	AAATCCTTATTTTCTCAAAGACCCCAAAGGATGCGCTCTCG
Motif Score	2.876744048
Cell/Tissue List	HeLa; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7; ENST00000613098.4; ENST00000506055.5
External Link	RMBase: m6A_site_633353
mod ID: M6ASITE065492		Click to Show/Hide the Full List
mod site	chr4:23813922-23813923:-		[7]
Sequence	AGCGAAGATGAAAGTGATAAACTGAGCTACCCTTGGGATGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; GSC-11; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000506055.5; ENST00000509702.5; ENST00000264867.7; ENST00000613098.4
External Link	RMBase: m6A_site_633354
mod ID: M6ASITE065493		Click to Show/Hide the Full List
mod site	chr4:23813970-23813971:-		[7]
Sequence	CCTATGTTTATAAATTCAGGACTAGCCATGGATGGCCTGTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000506055.5; ENST00000613098.4
External Link	RMBase: m6A_site_633355
mod ID: M6ASITE065494		Click to Show/Hide the Full List
mod site	chr4:23813994-23813995:-		[7]
Sequence	AGTAATGAACAATTCTCCAAACTACCTATGTTTATAAATTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000506055.5; ENST00000613098.4; ENST00000509702.5
External Link	RMBase: m6A_site_633356
mod ID: M6ASITE065495		Click to Show/Hide the Full List
mod site	chr4:23814006-23814007:-		[7]
Sequence	GACAGTGATTTCAGTAATGAACAATTCTCCAAACTACCTAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; A549; hESC-HEK293T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633357
mod ID: M6ASITE065496		Click to Show/Hide the Full List
mod site	chr4:23814025-23814026:-		[7]
Sequence	CAAGACCGGTGAACTGAGGGACAGTGATTTCAGTAATGAAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000264867.7; ENST00000506055.5; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633358
mod ID: M6ASITE065497		Click to Show/Hide the Full List
mod site	chr4:23814033-23814034:-		[7]
Sequence	GAAGCAGACAAGACCGGTGAACTGAGGGACAGTGATTTCAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000506055.5; ENST00000264867.7; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633359
mod ID: M6ASITE065498		Click to Show/Hide the Full List
mod site	chr4:23814041-23814042:-		[7]
Sequence	TTGACGACGAAGCAGACAAGACCGGTGAACTGAGGGACAGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000506055.5; ENST00000613098.4
External Link	RMBase: m6A_site_633360
mod ID: M6ASITE065499		Click to Show/Hide the Full List
mod site	chr4:23814046-23814047:-		[7]
Sequence	TGTTTTTGACGACGAAGCAGACAAGACCGGTGAACTGAGGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000264867.7; ENST00000506055.5
External Link	RMBase: m6A_site_633361
mod ID: M6ASITE065500		Click to Show/Hide the Full List
mod site	chr4:23814055-23814056:-		[11]
Sequence	CAGTCAAGCTGTTTTTGACGACGAAGCAGACAAGACCGGTG
Motif Score	2.839505952
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633362
mod ID: M6ASITE065501		Click to Show/Hide the Full List
mod site	chr4:23814058-23814059:-		[11]
Sequence	TCCCAGTCAAGCTGTTTTTGACGACGAAGCAGACAAGACCG
Motif Score	2.833690476
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000264867.7; ENST00000506055.5; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633363
mod ID: M6ASITE065502		Click to Show/Hide the Full List
mod site	chr4:23814094-23814095:-		[7]
Sequence	GGAAATCCGAGCCGAGCTGAACAAGCACTTCGGTCATCCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000506055.5; ENST00000613098.4
External Link	RMBase: m6A_site_633364
mod ID: M6ASITE065503		Click to Show/Hide the Full List
mod site	chr4:23814118-23814119:-		[7]
Sequence	CACAAGAAAACAGCTCCAAGACCAGGAAATCCGAGCCGAGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000506055.5; ENST00000613098.4; ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633365
mod ID: M6ASITE065504		Click to Show/Hide the Full List
mod site	chr4:23814129-23814130:-		[7]
Sequence	TCTCCTTGCAGCACAAGAAAACAGCTCCAAGACCAGGAAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264867.7; ENST00000509702.5; ENST00000506055.5; ENST00000613098.4
External Link	RMBase: m6A_site_633366
mod ID: M6ASITE065505		Click to Show/Hide the Full List
mod site	chr4:23814173-23814174:-		[7]
Sequence	ACCAGTGCTACCTGAGAGAGACTTTGGAGGCAAGCAAGCAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; peripheral-blood; GSC-11; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633367
mod ID: M6ASITE065506		Click to Show/Hide the Full List
mod site	chr4:23814193-23814194:-		[7]
Sequence	TTGTTCTTCCACAGATTCAGACCAGTGCTACCTGAGAGAGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; GSC-11
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000506055.5; ENST00000264867.7; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633368
mod ID: M6ASITE065507		Click to Show/Hide the Full List
mod site	chr4:23814258-23814259:-		[7]
Sequence	CAGGAGCTCCAAGACTCTAGACAACTAGAAAATAAAGATGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000506055.5; ENST00000264867.7
External Link	RMBase: m6A_site_633369
mod ID: M6ASITE065508		Click to Show/Hide the Full List
mod site	chr4:23814265-23814266:-		[7]
Sequence	TATATCACAGGAGCTCCAAGACTCTAGACAACTAGAAAATA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000264867.7; ENST00000506055.5; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633370
mod ID: M6ASITE065509		Click to Show/Hide the Full List
mod site	chr4:23814302-23814303:-		[7]
Sequence	GCCAGTCAATTAATTCCAAAACAGAAATACTCATTAATATA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509702.5; ENST00000613098.4; ENST00000264867.7; ENST00000506055.5
External Link	RMBase: m6A_site_633371
mod ID: M6ASITE065510		Click to Show/Hide the Full List
mod site	chr4:23814365-23814366:-		[7]
Sequence	GTGGACACGAGGAAAGGAAGACCAAGCGGCCCAGTCTGCGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000513205.5; ENST00000509702.5; ENST00000506055.5; ENST00000613098.4; ENST00000264867.7
External Link	RMBase: m6A_site_633372
mod ID: M6ASITE065511		Click to Show/Hide the Full List
mod site	chr4:23814381-23814382:-		[7]
Sequence	TCCTCAGTCCTCACTGGTGGACACGAGGAAAGGAAGACCAA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000513205.5; ENST00000613098.4; ENST00000264867.7; ENST00000506055.5
External Link	RMBase: m6A_site_633373
mod ID: M6ASITE065512		Click to Show/Hide the Full List
mod site	chr4:23814518-23814519:-		[7]
Sequence	AGCTGAAGTCCTCTTGCAAGACTGTGGTGCCACCACCATCA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000613098.4; ENST00000513205.5; ENST00000509702.5; ENST00000509642.5; ENST00000506055.5
External Link	RMBase: m6A_site_633374
mod ID: M6ASITE065513		Click to Show/Hide the Full List
mod site	chr4:23820449-23820450:-		[7]
Sequence	GGTGACGGTTTAAACCACAGACACGAAGGAATTTGGGTAGG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000264867.7; ENST00000509642.5; ENST00000506055.5; ENST00000513205.5
External Link	RMBase: m6A_site_633375
mod ID: M6ASITE065514		Click to Show/Hide the Full List
mod site	chr4:23820456-23820457:-		[7]
Sequence	TCAACAAGGTGACGGTTTAAACCACAGACACGAAGGAATTT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000506055.5; ENST00000513205.5; ENST00000509702.5; ENST00000613098.4; ENST00000509642.5; ENST00000264867.7
External Link	RMBase: m6A_site_633376
mod ID: M6ASITE065515		Click to Show/Hide the Full List
mod site	chr4:23820629-23820630:-		[7]
Sequence	TCTCTTTTACAGGTGTAAAAACTAATTTGATTTCAAAATAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513205.5; ENST00000617484.4; ENST00000509642.5; ENST00000264867.7; ENST00000613098.4; ENST00000509702.5; ENST00000506055.5
External Link	RMBase: m6A_site_633377
mod ID: M6ASITE065516		Click to Show/Hide the Full List
mod site	chr4:23824285-23824286:-		[7]
Sequence	TAAGTGTGGAACTCTCTGGAACTGCAGGTAAGCCTTATATT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000506055.5; ENST00000513205.5; ENST00000509702.5; ENST00000264867.7; ENST00000613098.4; ENST00000617484.4; ENST00000509642.5
External Link	RMBase: m6A_site_633378
mod ID: M6ASITE065517		Click to Show/Hide the Full List
mod site	chr4:23824295-23824296:-		[7]
Sequence	GAACGCACCTTAAGTGTGGAACTCTCTGGAACTGCAGGTAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000509642.5; ENST00000613098.4; ENST00000509702.5; ENST00000617484.4; ENST00000513205.5; ENST00000506055.5
External Link	RMBase: m6A_site_633379
mod ID: M6ASITE065518		Click to Show/Hide the Full List
mod site	chr4:23824321-23824322:-		[7]
Sequence	GTTCCCCATTTGAGAACAAGACTATTGAACGCACCTTAAGT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000506055.5; ENST00000617484.4; ENST00000613098.4; ENST00000509642.5; ENST00000513205.5; ENST00000509702.5; ENST00000264867.7
External Link	RMBase: m6A_site_633380
mod ID: M6ASITE065519		Click to Show/Hide the Full List
mod site	chr4:23824326-23824327:-		[7]
Sequence	CAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCACCT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000513205.5; ENST00000506055.5; ENST00000509642.5; ENST00000617484.4; ENST00000264867.7; ENST00000509702.5
External Link	RMBase: m6A_site_633381
mod ID: M6ASITE065520		Click to Show/Hide the Full List
mod site	chr4:23824503-23824504:-		[7]
Sequence	TTTTTTTTTTCTTTAGCCAAACCAACAACTTTATCTCTTCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509642.5; ENST00000509702.5; ENST00000506055.5; ENST00000513205.5; ENST00000264867.7; ENST00000612355.1; ENST00000617484.4
External Link	RMBase: m6A_site_633382
mod ID: M6ASITE065521		Click to Show/Hide the Full List
mod site	chr4:23828455-23828456:-		[7]
Sequence	GAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509702.5; ENST00000617484.4; ENST00000264867.7; ENST00000506055.5; ENST00000509642.5; ENST00000513205.5; ENST00000612355.1
External Link	RMBase: m6A_site_633383
mod ID: M6ASITE065522		Click to Show/Hide the Full List
mod site	chr4:23828467-23828468:-		[7]
Sequence	CAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000612355.1; ENST00000617484.4; ENST00000509642.5; ENST00000509702.5; ENST00000264867.7; ENST00000506055.5; ENST00000513205.5; ENST00000613098.4
External Link	RMBase: m6A_site_633384
mod ID: M6ASITE065523		Click to Show/Hide the Full List
mod site	chr4:23828473-23828474:-		[7]
Sequence	TCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613098.4; ENST00000509642.5; ENST00000612355.1; ENST00000264867.7; ENST00000509702.5; ENST00000617484.4; ENST00000506055.5; ENST00000513205.5
External Link	RMBase: m6A_site_633385
mod ID: M6ASITE065524		Click to Show/Hide the Full List
mod site	chr4:23828484-23828485:-		[7]
Sequence	GATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509642.5; ENST00000513205.5; ENST00000612355.1; ENST00000506055.5; ENST00000613098.4; ENST00000509702.5; ENST00000264867.7; ENST00000617484.4
External Link	RMBase: m6A_site_633386
mod ID: M6ASITE065525		Click to Show/Hide the Full List
mod site	chr4:23828562-23828563:-		[10]
Sequence	AAAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACG
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000506055.5; ENST00000508380.1; ENST00000514479.1; ENST00000509642.5; ENST00000513205.5; ENST00000264867.7; ENST00000612355.1; ENST00000617484.4; ENST00000509702.5; ENST00000613098.4
External Link	RMBase: m6A_site_633387
mod ID: M6ASITE065526		Click to Show/Hide the Full List
mod site	chr4:23829482-23829483:-		[7]
Sequence	ATCACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000617484.4; ENST00000514479.1; ENST00000508380.1; ENST00000506055.5; ENST00000264867.7; ENST00000613098.4; ENST00000509702.5; ENST00000612355.1; ENST00000509642.5; ENST00000513205.5
External Link	RMBase: m6A_site_633388
mod ID: M6ASITE065527		Click to Show/Hide the Full List
mod site	chr4:23829511-23829512:-		[7]
Sequence	CAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000514479.1; ENST00000264867.7; ENST00000508380.1; ENST00000612355.1; ENST00000509702.5; ENST00000513205.5; ENST00000613098.4; ENST00000509642.5; ENST00000506055.5; ENST00000617484.4
External Link	RMBase: m6A_site_633389
mod ID: M6ASITE065528		Click to Show/Hide the Full List
mod site	chr4:23831549-23831550:-		[7]
Sequence	AAGAGCCGTCTCTAGTAAGAACCCTTCCTACTGTTTAGCAG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509642.5; ENST00000509702.5; ENST00000512169.1; ENST00000513205.5; ENST00000613098.4; ENST00000508380.1; ENST00000612355.1; ENST00000617484.4; ENST00000264867.7; ENST00000506055.5
External Link	RMBase: m6A_site_633390
mod ID: M6ASITE065529		Click to Show/Hide the Full List
mod site	chr4:23831695-23831696:-		[7]
Sequence	AGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513205.5; ENST00000264867.7; ENST00000617484.4; ENST00000506055.5; ENST00000612355.1; ENST00000613098.4; ENST00000512169.1; ENST00000509642.5; ENST00000508380.1; ENST00000509702.5
External Link	RMBase: m6A_site_633391
mod ID: M6ASITE065530		Click to Show/Hide the Full List
mod site	chr4:23831702-23831703:-		[7]
Sequence	TGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000512169.1; ENST00000509702.5; ENST00000617484.4; ENST00000613098.4; ENST00000612355.1; ENST00000513205.5; ENST00000509642.5; ENST00000264867.7; ENST00000506055.5; ENST00000508380.1
External Link	RMBase: m6A_site_633392
mod ID: M6ASITE065531		Click to Show/Hide the Full List
mod site	chr4:23831725-23831726:-		[7]
Sequence	AGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000508380.1; ENST00000613098.4; ENST00000513205.5; ENST00000509702.5; ENST00000612355.1; ENST00000264867.7; ENST00000512169.1; ENST00000506055.5; ENST00000507342.5; ENST00000617484.4; ENST00000509642.5
External Link	RMBase: m6A_site_633393
mod ID: M6ASITE065532		Click to Show/Hide the Full List
mod site	chr4:23866132-23866133:-		[7]
Sequence	AAAGAAAATGCAGTTTTAAAACACTAGGCTGGCTATTCCTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509702.5; ENST00000264867.7; ENST00000508380.1; ENST00000515534.5; ENST00000617484.4; ENST00000509642.5; ENST00000513205.5; ENST00000506055.5; ENST00000507342.5; ENST00000512169.1; ENST00000613098.4; ENST00000612355.1
External Link	RMBase: m6A_site_633394
mod ID: M6ASITE065533		Click to Show/Hide the Full List
mod site	chr4:23884823-23884824:-		[7]
Sequence	ACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264867.7; ENST00000515534.5; ENST00000612355.1; ENST00000507380.1; ENST00000506055.5; ENST00000513205.5; ENST00000514494.1; ENST00000507342.5; ENST00000617484.4; ENST00000503714.1
External Link	RMBase: m6A_site_633395
mod ID: M6ASITE065534		Click to Show/Hide the Full List
mod site	chr4:23884839-23884840:-		[7]
Sequence	TGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513205.5; ENST00000264867.7; ENST00000514494.1; ENST00000612355.1; ENST00000515534.5; ENST00000507342.5; ENST00000617484.4; ENST00000503714.1; ENST00000507380.1; ENST00000506055.5
External Link	RMBase: m6A_site_633396
mod ID: M6ASITE065535		Click to Show/Hide the Full List
mod site	chr4:23884865-23884866:-		[7]
Sequence	CCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000507342.5; ENST00000264867.7; ENST00000514494.1; ENST00000617484.4; ENST00000506055.5; ENST00000503714.1; ENST00000515534.5; ENST00000612355.1; ENST00000507380.1; ENST00000513205.5
External Link	RMBase: m6A_site_633397
mod ID: M6ASITE065536		Click to Show/Hide the Full List
mod site	chr4:23884880-23884881:-		[7]
Sequence	CTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000507342.5; ENST00000513205.5; ENST00000514494.1; ENST00000503714.1; ENST00000507380.1; ENST00000612355.1; ENST00000506055.5; ENST00000264867.7; ENST00000515534.5; ENST00000617484.4
External Link	RMBase: m6A_site_633398
mod ID: M6ASITE065537		Click to Show/Hide the Full List
mod site	chr4:23884908-23884909:-		[7]
Sequence	TGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000503714.1; ENST00000507342.5; ENST00000612355.1; ENST00000513205.5; ENST00000506055.5; ENST00000514494.1; ENST00000264867.7; ENST00000515534.5; ENST00000507380.1; ENST00000617484.4
External Link	RMBase: m6A_site_633399
mod ID: M6ASITE065538		Click to Show/Hide the Full List
mod site	chr4:23889910-23889911:-		[10]
Sequence	CTCTGAGTCTGTATGGAGTGACATCGAGGTGAGCTGGGGCA
Motif Score	2.859755952
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000515534.5; ENST00000617484.4; ENST00000507342.5; ENST00000514494.1; ENST00000506055.5; ENST00000507380.1; ENST00000264867.7; ENST00000513205.5; ENST00000612355.1
External Link	RMBase: m6A_site_633400
mod ID: M6ASITE065539		Click to Show/Hide the Full List
mod site	chr4:23889931-23889932:-		[7]
Sequence	GTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513205.5; ENST00000507380.1; ENST00000617484.4; ENST00000612355.1; ENST00000514494.1; ENST00000506055.5; ENST00000515534.5; ENST00000507342.5; ENST00000264867.7
External Link	RMBase: m6A_site_633401
mod ID: M6ASITE065540		Click to Show/Hide the Full List
mod site	chr4:23889946-23889947:-		[7]
Sequence	CAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513205.5; ENST00000507342.5; ENST00000617484.4; ENST00000514494.1; ENST00000264867.7; ENST00000506055.5; ENST00000507380.1; ENST00000515534.5; ENST00000612355.1
External Link	RMBase: m6A_site_633402
mod ID: M6ASITE065541		Click to Show/Hide the Full List
mod site	chr4:23890069-23890070:-		[7]
Sequence	TGACTGGGGACTGTAGTAAGACAGGTGCCTTCAGTTCACTC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000514494.1; ENST00000507342.5; ENST00000617484.4; ENST00000612355.1
External Link	RMBase: m6A_site_633403

Ref 1	N6-methyladenosine demethylase FTO suppresses clear cell renal cell carcinoma through a novel FTO-PGC-1Alpha signalling axis. J Cell Mol Med. 2019 Mar;23(3):2163-2173. doi: 10.1111/jcmm.14128. Epub 2019 Jan 16.
Ref 2	FTO is required for myogenesis by positively regulating mTOR-PGC-1Alpha pathway-mediated mitochondria biogenesis. Cell Death Dis. 2017 Mar 23;8(3):e2702. doi: 10.1038/cddis.2017.122.
Ref 3	METTL3 inhibits hepatic insulin sensitivity via N6-methyladenosine modification of Fasn mRNA and promoting fatty acid metabolism. Biochem Biophys Res Commun. 2019 Oct 8;518(1):120-126. doi: 10.1016/j.bbrc.2019.08.018. Epub 2019 Aug 10.
Ref 4	Pharmacokinetics of rosuvastatin when coadministered with rifampicin in healthy males: a randomized, single-blind, placebo-controlled, crossover study. Clin Ther. 2008 Jul;30(7):1283-9. doi: 10.1016/s0149-2918(08)80052-5.
Ref 5	KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res. 2017 Jan 4;45(D1):D353-D361. (dg:DG01913)
Ref 6	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 11	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map