m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00368)

Target Name	PI3-kinase subunit alpha (PI3k/PIK3CA)
Synonyms	PI3-kinase subunit alpha; PI3K-alpha; PI3Kalpha; PtdIns-3-kinase subunit alpha; Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit alpha; PtdIns-3-kinase subunit p110-alpha; p110alpha; Phosphoinositide 3-kinase alpha; Phosphoinositide-3-kinase catalytic alpha polypeptide; Serine/threonine protein kinase PIK3CA Click to Show/Hide
Gene Name	PIK3CA
Chromosomal Location	3q26.32
Family	PI3/PI4-kinase family
Function	Phosphoinositide-3-kinase (PI3K) phosphorylates phosphatidylinositol (PI) and its phosphorylated derivatives at position 3 of the inositol ring to produce 3-phosphoinositides. Uses ATP and PtdIns(4,5)P2 (phosphatidylinositol 4,5-bisphosphate) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 plays a key role by recruiting PH domain-containing proteins to the membrane, including AKT1 and PDPK1, activating signaling cascades involved in cell growth, survival, proliferation, motility and morphology. Participates in cellular signaling in response to various growth factors. Involved in the activation of AKT1 upon stimulation by receptor tyrosine kinases ligands such as EGF, insulin, IGF1, VEGFA and PDGF. Involved in signaling via insulin-receptor substrate (IRS) proteins. Essential in endothelial cell migration during vascular development through VEGFA signaling, possibly by regulating RhoA activity. Required for lymphatic vasculature development, possibly by binding to RAS and by activation by EGF and FGF2, but not by PDGF. Regulates invadopodia formation through the PDPK1-AKT1 pathway. Participates in cardiomyogenesis in embryonic stem cells through a AKT1 pathway. Participates in vasculogenesis in embryonic stem cells through PDK1 and protein kinase C pathway. In addition to its lipid kinase activity, it displays a serine-protein kinase activity that results in the autophosphorylation of the p85alpha regulatory subunit as well as phosphorylation of other proteins such as 4EBP1, H-Ras, the IL-3 beta c receptor and possibly others. Plays a role in the positive regulation of phagocytosis and pinocytosis (By similarity). Click to Show/Hide
Gene ID	5290
Uniprot ID	PK3CA_HUMAN
HGNC ID	HGNC:8975
KEGG ID	hsa:5290

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PIK3CA can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: -6.28E-01 p-value: 7.56E-03
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR pathway and the EMT pathway, respectively.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating EGFR/PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT signaling pathway in an m6A-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HULEC-5a cell line	Homo sapiens
Treatment: METTL3 knockdown HULEC-5a cells Control: HULEC-5a cells		GSE200649
Regulation		logFC: -2.36E+00 p-value: 7.04E-03
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	MiR-600 inhibited lung cancer via down-regulating METTL3 expression, and knockdown of METTL3 was used as a novel strategy for lung cancer therapy. The PI3-kinase subunit alpha (PI3k/PIK3CA)/Akt pathway is implicated in cell growth and survival and we also observed that knockdown of METTL3 changed the expression and phosphorylation of proteins of PI3K signaling pathway members.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR pathway.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Target Regulation	Down regulation
Responsed Disease	Renal cell carcinoma		ICD-11: 2C90	Disease Info
Cell Process	Epithelial-to-mesenchymal transition
	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shALKBH5 MOLM-13 cells Control: shNS MOLM-13 cells		GSE144968
Regulation		logFC: -2.12E+00 p-value: 2.82E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and BCL-2-Beclin1 complex. ALKBH5 activated EGFR-PI3-kinase subunit alpha (PI3k/PIK3CA)-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Target Regulation	Up regulation
Responsed Disease	Ovarian cancer		ICD-11: 2C73	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
In-vitro Model	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
	CoC1	Ovarian adenocarcinoma	Homo sapiens	CVCL_6891
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 10⁶ cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The m6A modification level was decreased in GC and METTL14 was a key regulator resulting in m6A disorder in GC. METTL14 overexpression suppressed GC cell proliferation and aggression by deactivating the PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR pathway and the EMT pathway, respectively.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	GES-1	Normal	Homo sapiens	CVCL_EQ22

Gastrointestinal cancer [ICD-11: 2C11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	m6A regulators were mostly upregulated in Gastrointestinal cancer and their differential expression significantly influenced the overall survival of patients with GI cancer. The PI3-kinase subunit alpha (PI3k/PIK3CA)/Akt and mammalian target of rapamycin (mTOR) signaling pathways were found to be potentially affected by m6A modification in most human cancers, including GI cancer, which was further verified by m6A-Seq and phospho-MAPK array.
Responsed Disease	Gastrointestinal cancer [ICD-11: 2C11]
Pathway Response	PI3K-Akt signaling pathway	hsa04151), mTOR signaling pathway
In-vitro Model	()
	()
	()
	()

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating EGFR/PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT signaling pathway in an m6A-dependent manner.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	MiR-600 inhibited lung cancer via down-regulating METTL3 expression, and knockdown of METTL3 was used as a novel strategy for lung cancer therapy. The PI3-kinase subunit alpha (PI3k/PIK3CA)/Akt pathway is implicated in cell growth and survival and we also observed that knockdown of METTL3 changed the expression and phosphorylation of proteins of PI3K signaling pathway members.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Apoptosis			hsa04210
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3-mediated m6 A methylation promotes lung cancer progression via activating PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR pathway.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	5 × 10⁶ A549 cells overexpressing METTL3 (Lv-METTL3) or control (Lv-Ctrl) were suspended in 100 uL phosphate-buffered saline (PBS), and were subcutaneously injected into mouse lower right flank. Drug treatment started in the Lv-METTL3 group when the tumour volume reached around 100 mm³. Mice were randomly divided into three groups to receive vehicle, GSK2536771 (30 mg/kg) or rapamycin (1 mg/kg). Drugs were administrated daily through intraperitoneal injection for 18 days. Treatment conditions were chosen as previously reported.

Ovarian cancer [ICD-11: 2C73]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and BCL-2-Beclin1 complex. ALKBH5 activated EGFR-PI3-kinase subunit alpha (PI3k/PIK3CA)-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Responsed Disease	Ovarian cancer [ICD-11: 2C73]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
	Autophagy			hsa04140
In-vitro Model	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
	CoC1	Ovarian adenocarcinoma	Homo sapiens	CVCL_6891
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 10⁶ cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	Knockdown of METTL3 could obviously promote cell proliferation, migration and invasion function, and induce G0/G1 arrest,METTL3 acts as a novel marker for tumorigenesis, development and survival of RCC. Knockdown of METTL3 promoted changes in PI3-kinase subunit alpha (PI3k/PIK3CA)/AKT/mTOR markers' expression with a gain in p-PI3k, p-AKT, p-mTOR and p-p70, and a loss of p-4EBP1.
Responsed Disease	Renal cell carcinoma [ICD-11: 2C90]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Epithelial-to-mesenchymal transition
Cell Process	Arrest cell cycle at G0/G1 phase
In-vitro Model	ACHN	Papillary renal cell carcinoma	Homo sapiens	CVCL_1067
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	HK2	Normal	Acipenser baerii	CVCL_YE28
In-vivo Model	Cells (5×10⁶ cells in 200 uL) were suspended with 100 uL PBS and 100 uL Matrigel Matrix, and injected subcutaneously into the left armpit of each mouse.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 8 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02141		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02149		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02154		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02162		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02167		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02175		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02180		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02188		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03377		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03385		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03390		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03398		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03498		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00368)

PI3-kinase subunit alpha (PI3k/PIK3CA)

Adenosine-to-Inosine editing (A-to-I)

In total 15 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000129		Click to Show/Hide the Full List
mod site	chr3:179160581-179160582:+		[7]
Sequence	TGGCCTGCAGATATGGCAACAAGAAACTGTCATGTATTCTC
Transcript ID List	ENST00000468036.1; ENST00000263967.4; ENST00000643187.1; ENST00000477735.1
External Link	RMBase: RNA-editing_site_101328
mod ID: A2ISITE000130		Click to Show/Hide the Full List
mod site	chr3:179160680-179160681:+		[7]
Sequence	ATATTTTATATATTGTGTATATAGTTCTATTGTTTTAGATT
Transcript ID List	ENST00000263967.4; ENST00000477735.1; ENST00000643187.1; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101329
mod ID: A2ISITE000131		Click to Show/Hide the Full List
mod site	chr3:179160754-179160755:+		[8]
Sequence	AATTTTGTACAGTGTGGTATACAAAAACCACATACATTATA
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000477735.1; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101330
mod ID: A2ISITE000132		Click to Show/Hide the Full List
mod site	chr3:179160756-179160757:+		[8]
Sequence	TTTTGTACAGTGTGGTATACAAAAACCACATACATTATACT
Transcript ID List	ENST00000477735.1; ENST00000643187.1; ENST00000263967.4; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101331
mod ID: A2ISITE000133		Click to Show/Hide the Full List
mod site	chr3:179160757-179160758:+		[8]
Sequence	TTTGTACAGTGTGGTATACAAAAACCACATACATTATACTT
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000477735.1; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101332
mod ID: A2ISITE000134		Click to Show/Hide the Full List
mod site	chr3:179160758-179160759:+		[8]
Sequence	TTGTACAGTGTGGTATACAAAAACCACATACATTATACTTT
Transcript ID List	ENST00000263967.4; ENST00000468036.1; ENST00000477735.1; ENST00000643187.1
External Link	RMBase: RNA-editing_site_101333
mod ID: A2ISITE000135		Click to Show/Hide the Full List
mod site	chr3:179160760-179160761:+		[8]
Sequence	GTACAGTGTGGTATACAAAAACCACATACATTATACTTTAT
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000468036.1; ENST00000477735.1
External Link	RMBase: RNA-editing_site_101334
mod ID: A2ISITE000136		Click to Show/Hide the Full List
mod site	chr3:179160772-179160773:+		[9]
Sequence	ATACAAAAACCACATACATTATACTTTATGGATGACTTGAG
Transcript ID List	ENST00000468036.1; ENST00000643187.1; ENST00000477735.1; ENST00000263967.4
External Link	RMBase: RNA-editing_site_101335
mod ID: A2ISITE000137		Click to Show/Hide the Full List
mod site	chr3:179160823-179160824:+		[8]
Sequence	AAAAATGTCGATTCTGTACAATCATAGACTCTGTTTGTTTG
Transcript ID List	ENST00000468036.1; ENST00000477735.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: RNA-editing_site_101336
mod ID: A2ISITE000138		Click to Show/Hide the Full List
mod site	chr3:179162011-179162012:+		[8]
Sequence	CAACACAAACATACTCTGTGATTGTACGGTCAACGTTTTCC
Transcript ID List	ENST00000477735.1; ENST00000468036.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: RNA-editing_site_101337
mod ID: A2ISITE000139		Click to Show/Hide the Full List
mod site	chr3:179162016-179162017:+		[8]
Sequence	CAAACATACTCTGTGATTGTACGGTCAACGTTTTCCTTGAA
Transcript ID List	ENST00000643187.1; ENST00000468036.1; ENST00000477735.1; ENST00000263967.4
External Link	RMBase: RNA-editing_site_101338
mod ID: A2ISITE000140		Click to Show/Hide the Full List
mod site	chr3:179162023-179162024:+		[8]
Sequence	ACTCTGTGATTGTACGGTCAACGTTTTCCTTGAAAAATCTC
Transcript ID List	ENST00000643187.1; ENST00000468036.1; ENST00000263967.4; ENST00000477735.1
External Link	RMBase: RNA-editing_site_101339
mod ID: A2ISITE000141		Click to Show/Hide the Full List
mod site	chr3:179162080-179162081:+		[8]
Sequence	GTACAATGTATATAGTTTTTATATATCACCTTGTACAGAAA
Transcript ID List	ENST00000263967.4; ENST00000643187.1; ENST00000477735.1; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101340
mod ID: A2ISITE000142		Click to Show/Hide the Full List
mod site	chr3:179173892-179173893:+		[8]
Sequence	CCTGCCACCACACCTGGCTAATTTTTTGTATTTTTAGTAGA
Transcript ID List	ENST00000263967.4; ENST00000643187.1; ENST00000477735.1; ENST00000468036.1
External Link	RMBase: RNA-editing_site_101341
mod ID: A2ISITE000143		Click to Show/Hide the Full List
mod site	chr3:179212106-179212107:+		[8]
Sequence	AACCTCTGCCTCCCGGGTTCAAGTGATCCTCCTGCCTCAGC
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: RNA-editing_site_101342

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003179		Click to Show/Hide the Full List
mod site	chr3:179199801-179199802:+		[10]
Sequence	GAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m5C_site_33118

N6-methyladenosine (m6A)

In total 79 m6A sequence/site(s) in this target gene
mod ID: M6ASITE063153		Click to Show/Hide the Full List
mod site	chr3:179148417-179148418:+		[11]
Sequence	CTGCTGCCGCGGCCGCTGGGACTGGGGCTGGGGCCGCCGGC
Motif Score	4.065041667
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	rmsk_1179011; ENST00000477735.1; ENST00000263967.4
External Link	RMBase: m6A_site_618980
mod ID: M6ASITE063154		Click to Show/Hide the Full List
mod site	chr3:179148560-179148561:+		[11]
Sequence	CCGCCGCCCGCGGGGCTGGGACCCGATGCGGTTAGAGCCGC
Motif Score	3.622404762
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000477735.1
External Link	RMBase: m6A_site_618981
mod ID: M6ASITE063155		Click to Show/Hide the Full List
mod site	chr3:179198763-179198764:+		[12]
Sequence	ATTTAGGTTTCTGCTTTGGGACAACCATACATCTAATTCCT
Motif Score	3.643047619
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000477735.1; ENST00000468036.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618982
mod ID: M6ASITE063156		Click to Show/Hide the Full List
mod site	chr3:179198805-179198806:+		[13]
Sequence	AAAGTAGTTTTATATGTAAAACTTGCAAAGAATCAGAACAA
Motif Score	2.627720238
Cell/Tissue List	CD34; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000477735.1; ENST00000643187.1; ENST00000468036.1; ENST00000263967.4
External Link	RMBase: m6A_site_618983
mod ID: M6ASITE063157		Click to Show/Hide the Full List
mod site	chr3:179198822-179198823:+		[13]
Sequence	AAAACTTGCAAAGAATCAGAACAATGCCTCCACGACCATCA
Motif Score	2.951386905
Cell/Tissue List	CD34; HEK293T; HeLa; Huh7; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000468036.1; ENST00000643187.1; ENST00000263967.4; ENST00000477735.1
External Link	RMBase: m6A_site_618984
mod ID: M6ASITE063158		Click to Show/Hide the Full List
mod site	chr3:179198851-179198852:+		[13]
Sequence	CCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGAT
Motif Score	3.373380952
Cell/Tissue List	CD34; HEK293T; HeLa; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000468036.1; ENST00000643187.1; ENST00000477735.1; ENST00000263967.4
External Link	RMBase: m6A_site_618985
mod ID: M6ASITE063159		Click to Show/Hide the Full List
mod site	chr3:179198921-179198922:+		[14]
Sequence	TACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAG
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000468036.1
External Link	RMBase: m6A_site_618986
mod ID: M6ASITE063160		Click to Show/Hide the Full List
mod site	chr3:179198968-179198969:+		[15]
Sequence	TTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hNPCs; fibroblasts; GM12878; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000468036.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618987
mod ID: M6ASITE063161		Click to Show/Hide the Full List
mod site	chr3:179199080-179199081:+		[15]
Sequence	GGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000643187.1; ENST00000468036.1; ENST00000263967.4
External Link	RMBase: m6A_site_618988
mod ID: M6ASITE063162		Click to Show/Hide the Full List
mod site	chr3:179199133-179199134:+		[15]
Sequence	CCCTTTTTAAAAGTAATTGAACCAGTAGGCAACCGTGAAGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1; ENST00000468036.1
External Link	RMBase: m6A_site_618989
mod ID: M6ASITE063163		Click to Show/Hide the Full List
mod site	chr3:179199749-179199750:+		[15]
Sequence	TAAAGATCCAGAAGTACAGGACTTCCGAAGAAATATTCTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_618990
mod ID: M6ASITE063164		Click to Show/Hide the Full List
mod site	chr3:179199800-179199801:+		[15]
Sequence	AGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618991
mod ID: M6ASITE063165		Click to Show/Hide the Full List
mod site	chr3:179201334-179201335:+		[16]
Sequence	AATAGTTTCTCCAAATAATGACAAGCAGAAGTATACTCTGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_618992
mod ID: M6ASITE063166		Click to Show/Hide the Full List
mod site	chr3:179201380-179201381:+		[15]
Sequence	AACCATGACTGTGTACCAGAACAAGTAATTGCTGAAGCAAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618993
mod ID: M6ASITE063167		Click to Show/Hide the Full List
mod site	chr3:179201411-179201412:+		[15]
Sequence	CTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_618994
mod ID: M6ASITE063168		Click to Show/Hide the Full List
mod site	chr3:179201437-179201438:+		[15]
Sequence	AGTATGTTGCTATCCTCTGAACAACTAAAACTCTGTGTTTT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618995
mod ID: M6ASITE063169		Click to Show/Hide the Full List
mod site	chr3:179201446-179201447:+		[15]
Sequence	CTATCCTCTGAACAACTAAAACTCTGTGTTTTAGAATATCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618996
mod ID: M6ASITE063170		Click to Show/Hide the Full List
mod site	chr3:179203628-179203629:+		[15]
Sequence	TTATTCTCAACTGCCAATGGACTGTTTTACAATGCCATCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618997
mod ID: M6ASITE063171		Click to Show/Hide the Full List
mod site	chr3:179203693-179203694:+		[15]
Sequence	CACCATATATGAATGGAGAAACATCTACAAAATCCCTTTGG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_618998
mod ID: M6ASITE063172		Click to Show/Hide the Full List
mod site	chr3:179203778-179203779:+		[15]
Sequence	CGTGAATGTAAATATTCGAGACATTGATAAGGTAAAGTCAA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_618999
mod ID: M6ASITE063173		Click to Show/Hide the Full List
mod site	chr3:179204514-179204515:+		[15]
Sequence	TCTTTTAGATCTATGTTCGAACAGGTATCTACCATGGAGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619000
mod ID: M6ASITE063174		Click to Show/Hide the Full List
mod site	chr3:179204537-179204538:+		[15]
Sequence	GGTATCTACCATGGAGGAGAACCCTTATGTGACAATGTGAA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619001
mod ID: M6ASITE063175		Click to Show/Hide the Full List
mod site	chr3:179204557-179204558:+		[15]
Sequence	ACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619002
mod ID: M6ASITE063176		Click to Show/Hide the Full List
mod site	chr3:179210303-179210304:+		[13]
Sequence	TGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGAT
Motif Score	2.930744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619003
mod ID: M6ASITE063177		Click to Show/Hide the Full List
mod site	chr3:179210433-179210434:+		[13]
Sequence	TTTCTTCCATCTCTTAGGAAACTCCATGCTTAGAGTTGGAG
Motif Score	2.627720238
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619004
mod ID: M6ASITE063178		Click to Show/Hide the Full List
mod site	chr3:179210561-179210562:+		[15]
Sequence	TTTAGCTATTCCCACGCAGGACTGGTAAGGCAAATCACTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619005
mod ID: M6ASITE063179		Click to Show/Hide the Full List
mod site	chr3:179218217-179218218:+		[15]
Sequence	TTTATTTTACAGAGTAACAGACTAGCTAGAGACAATGAATT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619006
mod ID: M6ASITE063180		Click to Show/Hide the Full List
mod site	chr3:179218228-179218229:+		[15]
Sequence	GAGTAACAGACTAGCTAGAGACAATGAATTAAGGGAAAATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619007
mod ID: M6ASITE063181		Click to Show/Hide the Full List
mod site	chr3:179218256-179218257:+		[15]
Sequence	TTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619008
mod ID: M6ASITE063182		Click to Show/Hide the Full List
mod site	chr3:179220996-179220997:+		[16]
Sequence	TTCTTTTAGATCTGAGATGCACAATAAAACAGTTAGCCAGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000643187.1; ENST00000462255.1; ENST00000263967.4
External Link	RMBase: m6A_site_619009
mod ID: M6ASITE063183		Click to Show/Hide the Full List
mod site	chr3:179221004-179221005:+		[13]
Sequence	GATCTGAGATGCACAATAAAACAGTTAGCCAGAGGTTTGGC
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000462255.1
External Link	RMBase: m6A_site_619010
mod ID: M6ASITE063184		Click to Show/Hide the Full List
mod site	chr3:179221129-179221130:+		[13]
Sequence	AACTTAACTGACATTCTCAAACAGGAGAAGAAGGATGAAAC
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000462255.1; ENST00000643187.1
External Link	RMBase: m6A_site_619011
mod ID: M6ASITE063185		Click to Show/Hide the Full List
mod site	chr3:179221148-179221149:+		[13]
Sequence	AACAGGAGAAGAAGGATGAAACACAAAAGGTGTGTGACTCT
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000462255.1; ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619012
mod ID: M6ASITE063186		Click to Show/Hide the Full List
mod site	chr3:179224159-179224160:+		[15]
Sequence	GGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAACTAGGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000462255.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619013
mod ID: M6ASITE063187		Click to Show/Hide the Full List
mod site	chr3:179224180-179224181:+		[15]
Sequence	CCCTGCTCATCAACTAGGAAACCTCAGGTACTTTCTTGGGG
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000462255.1; ENST00000643187.1
External Link	RMBase: m6A_site_619014
mod ID: M6ASITE063188		Click to Show/Hide the Full List
mod site	chr3:179224758-179224759:+		[15]
Sequence	ACTGTGGTTGAATTGGGAGAACCCAGACATCATGTCAGAGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1; ENST00000462255.1
External Link	RMBase: m6A_site_619015
mod ID: M6ASITE063189		Click to Show/Hide the Full List
mod site	chr3:179224764-179224765:+		[15]
Sequence	GTTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4; ENST00000462255.1
External Link	RMBase: m6A_site_619016
mod ID: M6ASITE063190		Click to Show/Hide the Full List
mod site	chr3:179224791-179224792:+		[15]
Sequence	GTCAGAGTTACTGTTTCAGAACAATGAGATCATCTTTAAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000462255.1; ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619017
mod ID: M6ASITE063191		Click to Show/Hide the Full List
mod site	chr3:179229313-179229314:+		[15]
Sequence	TCAATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619018
mod ID: M6ASITE063192		Click to Show/Hide the Full List
mod site	chr3:179229423-179229424:+		[15]
Sequence	ACTACATCAGTGGCTCAAAGACAAGAACAAAGGAGAAATGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619019
mod ID: M6ASITE063193		Click to Show/Hide the Full List
mod site	chr3:179229429-179229430:+		[15]
Sequence	TCAGTGGCTCAAAGACAAGAACAAAGGAGAAATGTGAGTTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619020
mod ID: M6ASITE063194		Click to Show/Hide the Full List
mod site	chr3:179230028-179230029:+		[16]
Sequence	ATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATAC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619021
mod ID: M6ASITE063195		Click to Show/Hide the Full List
mod site	chr3:179230086-179230087:+		[16]
Sequence	TTTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619022
mod ID: M6ASITE063196		Click to Show/Hide the Full List
mod site	chr3:179230117-179230118:+		[15]
Sequence	ATCATGGTGAAAGACGATGGACAAGTAATGGTTTTCTCTGT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619023
mod ID: M6ASITE063197		Click to Show/Hide the Full List
mod site	chr3:179230244-179230245:+		[15]
Sequence	CTGTTTCATATAGATTTTGGACACTTTTTGGATCACAAGAA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619024
mod ID: M6ASITE063198		Click to Show/Hide the Full List
mod site	chr3:179234192-179234193:+		[15]
Sequence	CTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACAT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; H1A; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619025
mod ID: M6ASITE063199		Click to Show/Hide the Full List
mod site	chr3:179234195-179234196:+		[16]
Sequence	GGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619026
mod ID: M6ASITE063200		Click to Show/Hide the Full List
mod site	chr3:179234209-179234210:+		[16]
Sequence	AGAACTACAATCTTTTGATGACATTGCATACATTCGAAAGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619027
mod ID: M6ASITE063201		Click to Show/Hide the Full List
mod site	chr3:179234229-179234230:+		[15]
Sequence	ACATTGCATACATTCGAAAGACCCTAGCCTTAGATAAAACT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; H1A; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619028
mod ID: M6ASITE063202		Click to Show/Hide the Full List
mod site	chr3:179234247-179234248:+		[15]
Sequence	AGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619029
mod ID: M6ASITE063203		Click to Show/Hide the Full List
mod site	chr3:179234279-179234280:+		[15]
Sequence	GCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619030
mod ID: M6ASITE063204		Click to Show/Hide the Full List
mod site	chr3:179234310-179234311:+		[15]
Sequence	ATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATC
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619031
mod ID: M6ASITE063205		Click to Show/Hide the Full List
mod site	chr3:179234345-179234346:+		[15]
Sequence	TGGATCTTCCACACAATTAAACAGCATGCATTGAACTGAAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619032
mod ID: M6ASITE063206		Click to Show/Hide the Full List
mod site	chr3:179234359-179234360:+		[15]
Sequence	AATTAAACAGCATGCATTGAACTGAAAAGATAACTGAGAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619033
mod ID: M6ASITE063207		Click to Show/Hide the Full List
mod site	chr3:179234402-179234403:+		[16]
Sequence	GAAAGCTCACTCTGGATTCCACACTGCACTGTTAATAACTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619034
mod ID: M6ASITE063208		Click to Show/Hide the Full List
mod site	chr3:179234419-179234420:+		[17]
Sequence	TCCACACTGCACTGTTAATAACTCTCAGCAGGCAAAGACCG
Motif Score	2.590089286
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619035
mod ID: M6ASITE063209		Click to Show/Hide the Full List
mod site	chr3:179234436-179234437:+		[15]
Sequence	ATAACTCTCAGCAGGCAAAGACCGATTGCATAGGAATTGCA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619036
mod ID: M6ASITE063210		Click to Show/Hide the Full List
mod site	chr3:179234456-179234457:+		[16]
Sequence	ACCGATTGCATAGGAATTGCACAATCCATGAACAGCATTAG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619037
mod ID: M6ASITE063211		Click to Show/Hide the Full List
mod site	chr3:179234467-179234468:+		[15]
Sequence	AGGAATTGCACAATCCATGAACAGCATTAGAATTTACAGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619038
mod ID: M6ASITE063212		Click to Show/Hide the Full List
mod site	chr3:179234491-179234492:+		[15]
Sequence	CATTAGAATTTACAGCAAGAACAGAAATAAAATACTATATA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619039
mod ID: M6ASITE063213		Click to Show/Hide the Full List
mod site	chr3:179234533-179234534:+		[15]
Sequence	TTTAAATAATGTAAACGCAAACAGGGTTTGATAGCACTTAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619040
mod ID: M6ASITE063214		Click to Show/Hide the Full List
mod site	chr3:179234554-179234555:+		[18]
Sequence	CAGGGTTTGATAGCACTTAAACTAGTTCATTTCAAAATTAA
Motif Score	2.627720238
Cell/Tissue List	HepG2; HEK293T; HeLa; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619041
mod ID: M6ASITE063215		Click to Show/Hide the Full List
mod site	chr3:179234626-179234627:+		[19]
Sequence	CCTTAAGTCCAAAAAGGTAAACTTTGAAGATTGTTTGTATC
Motif Score	2.627720238
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619042
mod ID: M6ASITE063216		Click to Show/Hide the Full List
mod site	chr3:179234659-179234660:+		[19]
Sequence	TTTGTATCTTTTTTTAAAAAACAAAACAAAACAAAAATCCC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619043
mod ID: M6ASITE063217		Click to Show/Hide the Full List
mod site	chr3:179234664-179234665:+		[19]
Sequence	ATCTTTTTTTAAAAAACAAAACAAAACAAAAATCCCCAAAA
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619044
mod ID: M6ASITE063218		Click to Show/Hide the Full List
mod site	chr3:179234669-179234670:+		[19]
Sequence	TTTTTAAAAAACAAAACAAAACAAAAATCCCCAAAATATAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619045
mod ID: M6ASITE063219		Click to Show/Hide the Full List
mod site	chr3:179234759-179234760:+		[19]
Sequence	TTCTATGTTTTGAAATGTGGACACAACAAAGGCTGTTATTG
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619046
mod ID: M6ASITE063220		Click to Show/Hide the Full List
mod site	chr3:179234796-179234797:+		[19]
Sequence	ATTGCATTAGGTGTAAGTAAACTGGAGTTTATGTTAAATTA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619047
mod ID: M6ASITE063221		Click to Show/Hide the Full List
mod site	chr3:179234951-179234952:+		[19]
Sequence	CTCTTGAGATTTCACCAGAGACTTTTTCTTTTTAATAAATC
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619048
mod ID: M6ASITE063222		Click to Show/Hide the Full List
mod site	chr3:179234974-179234975:+		[19]
Sequence	TTTTCTTTTTAATAAATCAAACCTTTTGATGATTTGAGGTT
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4; ENST00000643187.1
External Link	RMBase: m6A_site_619049
mod ID: M6ASITE063223		Click to Show/Hide the Full List
mod site	chr3:179235028-179235029:+		[19]
Sequence	TGGAAGCAGTCACAAATGAGACCTGTTATAAGGTGGTATTT
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619050
mod ID: M6ASITE063224		Click to Show/Hide the Full List
mod site	chr3:179235064-179235065:+		[19]
Sequence	TATTTTTTTTTTTCTTCTGGACAGTATTTAAAGGATCTTAT
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000643187.1; ENST00000263967.4
External Link	RMBase: m6A_site_619051
mod ID: M6ASITE063225		Click to Show/Hide the Full List
mod site	chr3:179235324-179235325:+		[19]
Sequence	AGGCTATTTATATTATAGAAACTATCATTAATATATATTCT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619052
mod ID: M6ASITE063226		Click to Show/Hide the Full List
mod site	chr3:179235500-179235501:+		[19]
Sequence	TGTATAACTACTTAAGGAAAACATAAAAACTTCATCTTCTT
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619053
mod ID: M6ASITE063227		Click to Show/Hide the Full List
mod site	chr3:179236542-179236543:+		[15]
Sequence	AACTGAAGATTTAACAGAGAACTGTGTTTTACCCGAGTGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619054
mod ID: M6ASITE063228		Click to Show/Hide the Full List
mod site	chr3:179236655-179236656:+		[19]
Sequence	TCTCCCCTCCTTCTCCCAGGACCTCTCCACCATTAAAATGC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619055
mod ID: M6ASITE063229		Click to Show/Hide the Full List
mod site	chr3:179236680-179236681:+		[19]
Sequence	TCCACCATTAAAATGCACAAACCACATGGCCGATTTCACCA
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619056
mod ID: M6ASITE063230		Click to Show/Hide the Full List
mod site	chr3:179236759-179236760:+		[15]
Sequence	TTCTATTAGAAGAAATGTAGACAAATTCTATAAAGACTATA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619057
mod ID: M6ASITE063231		Click to Show/Hide the Full List
mod site	chr3:179236774-179236775:+		[15]
Sequence	TGTAGACAAATTCTATAAAGACTATAGATTGTGACCTAAGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000263967.4
External Link	RMBase: m6A_site_619058

Ref 1	The m6A methyltransferase METTL14 inhibits the proliferation, migration, and invasion of gastric cancer by regulating the PI3K/AKT/mTOR signaling pathway. J Clin Lab Anal. 2021 Mar;35(3):e23655. doi: 10.1002/jcla.23655. Epub 2020 Dec 12.
Ref 2	METTL14 Inhibits Hepatocellular Carcinoma Metastasis Through Regulating EGFR/PI3K/AKT Signaling Pathway in an m6A-Dependent Manner. Cancer Manag Res. 2020 Dec 23;12:13173-13184. doi: 10.2147/CMAR.S286275. eCollection 2020.
Ref 3	miR-600 inhibits lung cancer via downregulating the expression of METTL3. Cancer Manag Res. 2019 Feb 1;11:1177-1187. doi: 10.2147/CMAR.S181058. eCollection 2019.
Ref 4	Methyltransferase-like 3 promotes the progression of lung cancer via activating PI3K/AKT/mTOR pathway. Clin Exp Pharmacol Physiol. 2022 Jul;49(7):748-758. doi: 10.1111/1440-1681.13647. Epub 2022 May 23.
Ref 5	The M6A methyltransferase METTL3: acting as a tumor suppressor in renal cell carcinoma. Oncotarget. 2017 Oct 10;8(56):96103-96116. doi: 10.18632/oncotarget.21726. eCollection 2017 Nov 10.
Ref 6	ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2. J Exp Clin Cancer Res. 2019 Apr 15;38(1):163. doi: 10.1186/s13046-019-1159-2.
Ref 7	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 8	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 9	Genome-wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science. 2009 May 29;324(5931):1210-3. doi: 10.1126/science.1170995.
Ref 10	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 11	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 12	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 13	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 14	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 15	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 16	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 17	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 18	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 19	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map