m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00337)
Target Name MARCKS-related protein (MARCKSL1)
Synonyms
MARCKS-like protein 1; Macrophage myristoylated alanine-rich C kinase substrate; Mac-MARCKS; MacMARCKS; MLP; MRP
    Click to Show/Hide
Gene Name MARCKSL1
Chromosomal Location 1p35.1
Family MARCKS family
Function
Controls cell movement by regulating actin cytoskeleton homeostasis and filopodium and lamellipodium formation. When unphosphorylated, induces cell migration (By similarity). When phosphorylated by MAPK8, induces actin bundles formation and stabilization, thereby reducing actin plasticity, hence restricting cell movement, including neuronal migration (By similarity). May be involved in coupling the protein kinase C and calmodulin signal transduction systems (By similarity).
    Click to Show/Hide
Gene ID 65108
Uniprot ID
MRP_HUMAN
HGNC ID
HGNC:7142
KEGG ID
hsa:65108
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MARCKSL1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1
Cell Line A549 cell line Homo sapiens
Treatment: IGF2BP1 knockout A549 cells
Control: Wild type A549 cells
 GSE146546
Regulation
logFC: -9.80E-01
p-value: 8.88E-07
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including MYC, FSCN1, TK1, and MARCKS-related protein (MARCKSL1), exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between MARCKSL1 and the regulator
Cell Line HEK293T Homo sapiens
Regulation logFC: 1.20E+00 GSE90639
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including MYC, FSCN1, TK1, and MARCKS-related protein (MARCKSL1), exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between MARCKSL1 and the regulator
Cell Line HEK293T Homo sapiens
Regulation logFC: 1.28E+00 GSE90639
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including MYC, FSCN1, TK1, and MARCKS-related protein (MARCKSL1), exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including MYC, FSCN1, TK1, and MARCKS-related protein (MARCKSL1), exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Cervical cancer [ICD-11: 2C77]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary In contrast to the mRNA-decay-promoting function of YTH domain-containing family protein 2, IGF2BPs promote the stability and storage of their target mRNAs (for example, MYC) in an m6A-dependent manner under normal and stress conditions and therefore affect gene expression output. Four representative high confidence targets, including MYC, FSCN1, TK1, and MARCKS-related protein (MARCKSL1), exhibit strong binding with IGF2BPs around their m6A motifs in control cells. Knocking down of each individual IGF2BPs in Hela (cervical cancer) and HepG2 (liver cancer) cells significantly repressed MYC expression.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
 Regulator Info 
Cell Process RNA decay
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
HEK293T Normal Homo sapiens CVCL_0063
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02196
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Protein tyrosine phosphatase non-receptor type 13 (PTPN13)
Crosstalk relationship DNA modification → m6A
Disease Liver cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05014
 Crosstalk Info 
Epigenetic Regulator DARS1 antisense RNA 1 (DARS1-AS1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00337)
MARCKS-related protein (MARCKSL1)
N4-acetylcytidine (ac4C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000183 Click to Show/Hide the Full List
mod site chr1:32334977-32334978:-
Sequence GATGCCATCGAGCCAGCACCCCCTAGCCAGGGTGCTGAGGC
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: ac4C_site_48
mod ID: AC4SITE000184 Click to Show/Hide the Full List
mod site chr1:32335028-32335029:- [2]
Sequence GGGGAGTCGCCCCCTGTGAACGGAACAGATGAGGCAGCCGG
Cell/Tissue List H1
Seq Type List ac4C-seq
Transcript ID List ENST00000329421.8
External Link RMBase: ac4C_site_49
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000044 Click to Show/Hide the Full List
mod site chr1:32335023-32335024:- [3]
Sequence GTCGCCCCCTGTGAACGGAACAGATGAGGCAGCCGGGGCCA
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000329421.8
External Link RMBase: Nm_site_132
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001275 Click to Show/Hide the Full List
mod site chr1:32336018-32336019:-
Sequence CCCATCATGGGCAGCCAGAGCTCCAAGGCTCCCCGGGGCGA
Cell/Tissue List HEK293T
Seq Type List Bisulfite-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m5C_site_1980
N6-methyladenosine (m6A)
In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE014134 Click to Show/Hide the Full List
mod site chr1:32333899-32333900:- [4]
Sequence TTTTTTTTCTAACTGCTAAAACCATTCTCTTCCACCTGGTT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19881
mod ID: M6ASITE014135 Click to Show/Hide the Full List
mod site chr1:32333908-32333909:- [5]
Sequence GTACTTTTTTTTTTTTTCTAACTGCTAAAACCATTCTCTTC
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19882
mod ID: M6ASITE014136 Click to Show/Hide the Full List
mod site chr1:32333939-32333940:- [4]
Sequence AAATAACTTTTAATGGCCAAACCCCAGATTTGTACTTTTTT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19883
mod ID: M6ASITE014137 Click to Show/Hide the Full List
mod site chr1:32333967-32333968:- [5]
Sequence TTCTTGTCTTTTTTTCTCCCACTGTTGTAAATAACTTTTAA
Motif Score 2.475107143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19884
mod ID: M6ASITE014138 Click to Show/Hide the Full List
mod site chr1:32333989-32333990:- [5]
Sequence GAGGTCTGTAATGTGAAACAACTTCTTGTCTTTTTTTCTCC
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19885
mod ID: M6ASITE014139 Click to Show/Hide the Full List
mod site chr1:32333992-32333993:- [4]
Sequence GGGGAGGTCTGTAATGTGAAACAACTTCTTGTCTTTTTTTC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19886
mod ID: M6ASITE014140 Click to Show/Hide the Full List
mod site chr1:32334044-32334045:- [5]
Sequence TCAACTGTGTCTCTTTTTTGACTTGGTAAGCAAGTATTAGG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19887
mod ID: M6ASITE014141 Click to Show/Hide the Full List
mod site chr1:32334080-32334081:- [4]
Sequence AATGTCTTACTCAAGTTCAAACCTCCAGCCTGTGAATCAAC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19888
mod ID: M6ASITE014142 Click to Show/Hide the Full List
mod site chr1:32334092-32334093:- [5]
Sequence TAGGTTTTTATAAATGTCTTACTCAAGTTCAAACCTCCAGC
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19889
mod ID: M6ASITE014143 Click to Show/Hide the Full List
mod site chr1:32334125-32334126:- [4]
Sequence TGGCACCTGGGCTGGGGAGGACACTGCCCCGTCTAGGTTTT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19890
mod ID: M6ASITE014144 Click to Show/Hide the Full List
mod site chr1:32334199-32334200:- [4]
Sequence TGGGGTGCTTATACTCCCAAACCTTGAGTGTCCAGCCTTCC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19891
mod ID: M6ASITE014145 Click to Show/Hide the Full List
mod site chr1:32334526-32334527:- [4]
Sequence CTTGTGAGGTCACTGCCTGGACCTGGTGCCCTGGCTGCCTT
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19892
mod ID: M6ASITE014146 Click to Show/Hide the Full List
mod site chr1:32334557-32334558:- [4]
Sequence GTGATCTCTAAGCTGCAAAAACTGTGCTGTCCTTGTGAGGT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19893
mod ID: M6ASITE014147 Click to Show/Hide the Full List
mod site chr1:32334725-32334726:- [4]
Sequence GCCACCCCTGAGAGCCAGGAACCCCAGGCCAAGGGGGCAGA
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; H1A; H1B; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19894
mod ID: M6ASITE014148 Click to Show/Hide the Full List
mod site chr1:32334820-32334821:- [6]
Sequence ATTCTTCTGCCTCCTCACCCACAGAGGAAGAGCAGGAGCAG
Motif Score 2.053113095
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19895
mod ID: M6ASITE014149 Click to Show/Hide the Full List
mod site chr1:32334931-32334932:- [4]
Sequence GGGAGGTCCCCCCCAAGGAGACCCCCAAGAAGAAGAAGAAA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; U2OS; LCLs; A549; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293T; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19896
mod ID: M6ASITE014150 Click to Show/Hide the Full List
mod site chr1:32335024-32335025:- [4]
Sequence AGTCGCCCCCTGTGAACGGAACAGATGAGGCAGCCGGGGCC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; U2OS; hNPCs; hESCs; fibroblasts; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293T; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19897
mod ID: M6ASITE014151 Click to Show/Hide the Full List
mod site chr1:32335068-32335069:- [4]
Sequence CCACGTGAAAAGCAATGGAGACTTATCCCCCAAGGGTGAAG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; U2OS; hNPCs; hESCs; fibroblasts; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293T; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19898
mod ID: M6ASITE014156 Click to Show/Hide the Full List
mod site chr1:32336041-32336042:- [4]
Sequence CTCCAAGCGCCCCCCAGCAGACCCCCATCATGGGCAGCCAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; U2OS; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000329421.8
External Link RMBase: m6A_site_19899