m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00258)

Target Name	Forkhead box protein M1 (FOXM1)
Synonyms	Forkhead-related protein FKHL16; Hepatocyte nuclear factor 3 forkhead homolog 11; HFH-11; HNF-3/fork-head homolog 11; M-phase phosphoprotein 2; MPM-2 reactive phosphoprotein 2; Transcription factor Trident; Winged-helix factor from INS-1 cells; FKHL16; HFH11; MPP2; WIN Click to Show/Hide
Gene Name	FOXM1
Chromosomal Location	12p13.33
Function	Transcription factor regulating the expression of cell cycle genes essential for DNA replication and mitosis. Plays a role in the control of cell proliferation. Also plays a role in DNA break repair, participating in the DNA damage checkpoint response. Promotes transcription of PHB2. Click to Show/Hide
Gene ID	2305
Uniprot ID	FOXM1_HUMAN
HGNC ID	HGNC:3818
KEGG ID	hsa:2305

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FOXM1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	HaCAT cell line	Homo sapiens
Treatment: siALKBH5 HaCAT cells Control: siControl HaCAT cells		GSE211076
Regulation		logFC: 1.11E+00 p-value: 1.78E-33
More Results	Click to View More RNA-seq Results

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	ALKBH5 and FOXM1-AS disrupted GSC tumorigenesis through the Forkhead box protein M1 (FOXM1) axis.
Target Regulation	Up regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Pathway Response	Glioma			hsa05214
Cell Process	Cells proliferation
	Signaling pathways regulating pluripotency of stem cells (hsa04550)
In-vitro Model	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	Hs 683	Oligodendroglioma	Homo sapiens	CVCL_0844
	SW1783	Anaplastic astrocytoma	Homo sapiens	CVCL_1722
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	For the animal survival analysis, mice were intracranially injected with 10,000 GSCs and maintained until moribund or 80 days after injection. For the rescue studies, GSCs with ALKBH5 or FOXM1-AS shRNAs were co-transfected with a FOXM1, ALKBH5 wild-type or mutant expression construct.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	m6A demethylase ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells under IH by downregulating m6A modification on Forkhead box protein M1 (FOXM1) mRNA and by promoting FOXM1 expression.high FOXM1 expression was associated with cisplatin-based chemotherapy resistance and poor prognosis.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell proliferation and invasion
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H522	Lung adenocarcinoma	Homo sapiens	CVCL_1567
In-vivo Model	1 × 10⁷ A549 cells were subcutaneously implanted into 4-week-old NOD/SCID mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	AKLBH5-induced m6A demethylation of Forkhead box protein M1 (FOXM1) mRNA promotes uveal melanoma progression.
Target Regulation	Up regulation
Responsed Disease	Melanoma of uvea		ICD-11: 2D0Y	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	ARPE-19	Normal	Homo sapiens	CVCL_0145
	C918	Uveal melanoma	Homo sapiens	CVCL_8471
	MuM-2B	Uveal melanoma	Homo sapiens	CVCL_3447
In-vivo Model	The in vivo experiment method for transplantation of tumors was subcutaneous injection of 1 × 10⁷ ALKBH5-stable knockdown C918 cells into BALB/c nude mice.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	ALKBH5 promotes silica-induced lung fibrosis via the miR-320a-3p/FOXM1 axis or targeting Forkhead box protein M1 (FOXM1) directly.
Target Regulation	Up regulation
Responsed Disease	Pulmonary Fibrosis		ICD-11: CB03.4	Disease Info
In-vitro Model	NIH 3T3	Normal	Mus musculus	CVCL_0594
	MRC-5	Normal	Homo sapiens	CVCL_0440
In-vivo Model	For the mouse model of miR-320a-3p overexpression, a total of 24 male C57BL/6 mice were divided randomly into four groups (n = 6 in each group): saline, silica, silica plus AAV9-miR-NC, and silica plus AAV9-miR-320a-3p. The mice in the silica plus AAV9-miR-NC/AAV9-miR-320a-3p groups were anesthetized using the same method, then administered intratracheally 50 uL AAV9-miR-NC/AAV9-miR-320a-3p per mouse at a titer of 8 × 10¹² v. g./ml. Three weeks later, these mice were treated in the same way using anesthesia, saline, and silica as mentioned above. Subsequently, after 4 weeks, the mice were sacrificed, and the lungs were isolated and frozen at -80 ℃ for further study.

Wilms tumor 1-associating protein (WTAP) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by WTAP*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: WTAP-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: -9.85E-01 p-value: 1.39E-67
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	A remarkable m6A-modified site was found on the 3'-UTR of FOXD2-AS1, and m6A methyltransferase WTAP promoted the methylation modification, thus enhancing the stability of FOXD2-AS1 transcripts. m6A-modified FOXD2-AS1 accelerates the osteosarcoma progression through m6A manner, which provides new concepts for osteosarcoma tumorigenesis. FOXD2-AS1 interacted with downstream target FOXM1 mRNA through m6A sites, forming a FOXD2-AS1/m6A/Forkhead box protein M1 (FOXM1) complex to heighten FOXM1 mRNA stability.
Target Regulation	Up regulation
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
In-vitro Model	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
In-vivo Model	In vivo animal assay, FOXD2-AS1 overexpression promoted the tumor growth in mice subcutaneous injection.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shNC AGS		GSE166972
Regulation		logFC: -8.94E-01 p-value: 2.29E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Forkhead box protein M1 (FOXM1) is a target of YTHDF1. Through recognizing and binding to the m6A-modified mRNA of FOXM1, YTHDF1 accelerated the translation process of FOXM1 and promoted breast cancer metastasis.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Epithelial-mesenchymal transformation
	Cell proliferation
	Cell invasion
In-vitro Model	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
In-vivo Model	NOD/SCID immune-deficient mice were purchased from Shanghai Experimental Animal Center. 2 * 10⁶ MCF-7 cells transduced with sh-NC or sh-YTHDF1-were subcutaneously injected into the mice (5/group). Tumor width and length were measured every 7 days. Tumor volume = (length * width2)/2. After 7 weeks, mice were sacrificed, and the weight of tumors was detected. Xenografts were collected for HE staining, immunohistochemistry staining and western blot analysis.For spontaneous lung metastasis assay, 4 * 10⁶ sh-NC or sh-YTHDF1#2 transduced MCF-7 cells were injected into the mammary fat pads of the NOD/SCID mice (5/group). The primary tumor was removed when its volume reached 150 mm3. The mice were sacrificed, and lung metastasis nodules were counted 12 weeks after the removal.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between FOXM1 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.19E+00	GSE86214

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[7]
Response Summary	m6A reader Ythdf3 protects hematopoietic stem cell integrity under stress by promoting the translation of Forkhead box protein M1 (FOXM1) and Asxl1 transcripts.
Target Regulation	Up regulation
Responsed Disease	Neoplasms of haematopoietic or lymphoid tissues	ICD-11: 2B3Z	Disease Info
Pathway Response	mRNA surveillance pathway		hsa03015), RNA degradation
Cell Process	RNA stability

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	ALKBH5 and FOXM1-AS disrupted GSC tumorigenesis through the Forkhead box protein M1 (FOXM1) axis.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Glioma			hsa05214
Cell Process	Cells proliferation
Cell Process	Signaling pathways regulating pluripotency of stem cells (hsa04550)
In-vitro Model	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	Hs 683	Oligodendroglioma	Homo sapiens	CVCL_0844
	SW1783	Anaplastic astrocytoma	Homo sapiens	CVCL_1722
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	For the animal survival analysis, mice were intracranially injected with 10,000 GSCs and maintained until moribund or 80 days after injection. For the rescue studies, GSCs with ALKBH5 or FOXM1-AS shRNAs were co-transfected with a FOXM1, ALKBH5 wild-type or mutant expression construct.

Neoplasms of haematopoietic or lymphoid tissues [ICD-11: 2B3Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[7]
Response Summary	m6A reader Ythdf3 protects hematopoietic stem cell integrity under stress by promoting the translation of Forkhead box protein M1 (FOXM1) and Asxl1 transcripts.
Responsed Disease	Neoplasms of haematopoietic or lymphoid tissues [ICD-11: 2B3Z]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)	READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mRNA surveillance pathway		hsa03015), RNA degradation
Cell Process	RNA stability

Osteosarcoma [ICD-11: 2B51]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	A remarkable m6A-modified site was found on the 3'-UTR of FOXD2-AS1, and m6A methyltransferase WTAP promoted the methylation modification, thus enhancing the stability of FOXD2-AS1 transcripts. m6A-modified FOXD2-AS1 accelerates the osteosarcoma progression through m6A manner, which provides new concepts for osteosarcoma tumorigenesis. FOXD2-AS1 interacted with downstream target FOXM1 mRNA through m6A sites, forming a FOXD2-AS1/m6A/Forkhead box protein M1 (FOXM1) complex to heighten FOXM1 mRNA stability.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
In-vivo Model	In vivo animal assay, FOXD2-AS1 overexpression promoted the tumor growth in mice subcutaneous injection.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	m6A demethylase ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells under IH by downregulating m6A modification on Forkhead box protein M1 (FOXM1) mRNA and by promoting FOXM1 expression.high FOXM1 expression was associated with cisplatin-based chemotherapy resistance and poor prognosis.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cellular senescence			hsa04218
Cell Process	Cell proliferation and invasion
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vitro Model	NCI-H522	Lung adenocarcinoma	Homo sapiens	CVCL_1567
In-vivo Model	1 × 10⁷ A549 cells were subcutaneously implanted into 4-week-old NOD/SCID mice.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	Forkhead box protein M1 (FOXM1) is a target of YTHDF1. Through recognizing and binding to the m6A-modified mRNA of FOXM1, YTHDF1 accelerated the translation process of FOXM1 and promoted breast cancer metastasis.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transformation
	Cell proliferation
	Cell invasion
In-vitro Model	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
In-vivo Model	NOD/SCID immune-deficient mice were purchased from Shanghai Experimental Animal Center. 2 * 10⁶ MCF-7 cells transduced with sh-NC or sh-YTHDF1-were subcutaneously injected into the mice (5/group). Tumor width and length were measured every 7 days. Tumor volume = (length * width2)/2. After 7 weeks, mice were sacrificed, and the weight of tumors was detected. Xenografts were collected for HE staining, immunohistochemistry staining and western blot analysis.For spontaneous lung metastasis assay, 4 * 10⁶ sh-NC or sh-YTHDF1#2 transduced MCF-7 cells were injected into the mammary fat pads of the NOD/SCID mice (5/group). The primary tumor was removed when its volume reached 150 mm3. The mice were sacrificed, and lung metastasis nodules were counted 12 weeks after the removal.

Melanoma of uvea [ICD-11: 2D0Y]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	AKLBH5-induced m6A demethylation of Forkhead box protein M1 (FOXM1) mRNA promotes uveal melanoma progression.
Responsed Disease	Melanoma of uvea [ICD-11: 2D0Y]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	ARPE-19	Normal	Homo sapiens	CVCL_0145
	C918	Uveal melanoma	Homo sapiens	CVCL_8471
	MuM-2B	Uveal melanoma	Homo sapiens	CVCL_3447
In-vivo Model	The in vivo experiment method for transplantation of tumors was subcutaneous injection of 1 × 10⁷ ALKBH5-stable knockdown C918 cells into BALB/c nude mice.

Idiopathic interstitial pneumonitis [ICD-11: CB03]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	ALKBH5 promotes silica-induced lung fibrosis via the miR-320a-3p/FOXM1 axis or targeting Forkhead box protein M1 (FOXM1) directly.
Responsed Disease	Pulmonary Fibrosis [ICD-11: CB03.4]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	NIH 3T3	Normal	Mus musculus	CVCL_0594
In-vitro Model	MRC-5	Normal	Homo sapiens	CVCL_0440
In-vivo Model	For the mouse model of miR-320a-3p overexpression, a total of 24 male C57BL/6 mice were divided randomly into four groups (n = 6 in each group): saline, silica, silica plus AAV9-miR-NC, and silica plus AAV9-miR-320a-3p. The mice in the silica plus AAV9-miR-NC/AAV9-miR-320a-3p groups were anesthetized using the same method, then administered intratracheally 50 uL AAV9-miR-NC/AAV9-miR-320a-3p per mouse at a titer of 8 × 10¹² v. g./ml. Three weeks later, these mice were treated in the same way using anesthesia, saline, and silica as mentioned above. Subsequently, after 4 weeks, the mice were sacrificed, and the lungs were isolated and frozen at -80 ℃ for further study.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00417		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00418		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 21 (MIR21)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00463		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00464		Crosstalk Info
Epigenetic Regulator	Methyltransferase-like protein 1 (METTL1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	m7G → m6A

DNA modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02134		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05027		Crosstalk Info
Epigenetic Regulator	LINC00035 (ABHD11-AS1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	ncRNA → m6A
Disease	Colorectal cancer	Disease Info

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05056		Crosstalk Info
Epigenetic Regulator	FOXM1 Antisense RNA (FOXM1-AS)
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	ncRNA → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00258)

Forkhead box protein M1 (FOXM1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000168		Click to Show/Hide the Full List
mod site	chr12:2872190-2872191:-
Sequence	GCCTATCCAACATCCAGTGGCTTCGAAAGATGAGTTCTGAT
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000359843.7; ENST00000627656.2; ENST00000342628.6; ENST00000538564.5; ENST00000537018.5; ENST00000545049.1; ENST00000361953.7
External Link	RMBase: ac4C_site_382

Adenosine-to-Inosine editing (A-to-I)

In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005341		Click to Show/Hide the Full List
mod site	chr12:2862760-2862761:-		[15]
Sequence	TCACTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAGCAAA
Transcript ID List	ENST00000535350.1; ENST00000342628.6; ENST00000359843.7; rmsk_3707066; ENST00000361953.7; ENST00000627656.2; ENST00000536066.1
External Link	RMBase: RNA-editing_site_26442
mod ID: A2ISITE005342		Click to Show/Hide the Full List
mod site	chr12:2862816-2862817:-		[15]
Sequence	ATGCACAGTGGCTCACACCTATAATCCTAGTATTTTGGGAG
Transcript ID List	ENST00000361953.7; rmsk_3707066; ENST00000627656.2; ENST00000536066.1; ENST00000342628.6; ENST00000359843.7; ENST00000535350.1
External Link	RMBase: RNA-editing_site_26443
mod ID: A2ISITE005343		Click to Show/Hide the Full List
mod site	chr12:2870168-2870169:-		[15]
Sequence	AGCCTGACCCCGCCTCTACTAGCAATACAAAATTAGCTGGG
Transcript ID List	rmsk_3707082; ENST00000342628.6; ENST00000361953.7; ENST00000627656.2; ENST00000537018.5; ENST00000545049.1; ENST00000538564.5; ENST00000359843.7
External Link	RMBase: RNA-editing_site_26444

5-methylcytidine (m5C)

In total 22 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005402		Click to Show/Hide the Full List
mod site	chr12:2858040-2858041:-		[16]
Sequence	GTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000359843.7; ENST00000627656.2; ENST00000536066.1; ENST00000342628.6
External Link	RMBase: m5C_site_9415
mod ID: M5CSITE005403		Click to Show/Hide the Full List
mod site	chr12:2863755-2863756:-
Sequence	CGAGATCACTGCACTCCAGCCTGGGTGACAGAGCGAGACTC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000342628.6; ENST00000366362.3; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7; rmsk_3707069; ENST00000535350.1; ENST00000536066.1
External Link	RMBase: m5C_site_9416
mod ID: M5CSITE005404		Click to Show/Hide the Full List
mod site	chr12:2863756-2863757:-
Sequence	CCGAGATCACTGCACTCCAGCCTGGGTGACAGAGCGAGACT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_3707069; ENST00000361953.7; ENST00000627656.2; ENST00000536066.1; ENST00000366362.3; ENST00000342628.6; ENST00000359843.7; ENST00000535350.1
External Link	RMBase: m5C_site_9417
mod ID: M5CSITE005405		Click to Show/Hide the Full List
mod site	chr12:2863759-2863760:-
Sequence	GAGCCGAGATCACTGCACTCCAGCCTGGGTGACAGAGCGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000627656.2; ENST00000536066.1; ENST00000359843.7; ENST00000366362.3; ENST00000361953.7; ENST00000535350.1; rmsk_3707069; ENST00000342628.6
External Link	RMBase: m5C_site_9418
mod ID: M5CSITE005406		Click to Show/Hide the Full List
mod site	chr12:2863760-2863761:-
Sequence	TGAGCCGAGATCACTGCACTCCAGCCTGGGTGACAGAGCGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000366362.3; ENST00000359843.7; ENST00000536066.1; ENST00000535350.1; ENST00000627656.2; ENST00000342628.6; rmsk_3707069
External Link	RMBase: m5C_site_9419
mod ID: M5CSITE005407		Click to Show/Hide the Full List
mod site	chr12:2863762-2863763:-
Sequence	AGTGAGCCGAGATCACTGCACTCCAGCCTGGGTGACAGAGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000342628.6; ENST00000361953.7; ENST00000535350.1; ENST00000627656.2; rmsk_3707069; ENST00000366362.3; ENST00000359843.7; ENST00000536066.1
External Link	RMBase: m5C_site_9420
mod ID: M5CSITE005408		Click to Show/Hide the Full List
mod site	chr12:2863764-2863765:-
Sequence	GCAGTGAGCCGAGATCACTGCACTCCAGCCTGGGTGACAGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000342628.6; ENST00000366362.3; ENST00000627656.2; ENST00000359843.7; ENST00000536066.1; rmsk_3707069; ENST00000361953.7; ENST00000535350.1
External Link	RMBase: m5C_site_9421
mod ID: M5CSITE005409		Click to Show/Hide the Full List
mod site	chr12:2863823-2863824:-
Sequence	AATCCCAGCTACTTGGGAGGCTGAGGCTGGAGAATCACATG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536066.1; ENST00000627656.2; ENST00000342628.6; ENST00000361953.7; ENST00000535350.1; rmsk_3707069; ENST00000359843.7; ENST00000366362.3
External Link	RMBase: m5C_site_9422
mod ID: M5CSITE005410		Click to Show/Hide the Full List
mod site	chr12:2863832-2863833:-
Sequence	CATGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCTGGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000627656.2; ENST00000361953.7; ENST00000342628.6; rmsk_3707069; ENST00000359843.7; ENST00000535350.1; ENST00000536066.1; ENST00000366362.3
External Link	RMBase: m5C_site_9423
mod ID: M5CSITE005411		Click to Show/Hide the Full List
mod site	chr12:2863835-2863836:-
Sequence	GCACATGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000536066.1; rmsk_3707069; ENST00000342628.6; ENST00000359843.7; ENST00000535350.1; ENST00000366362.3; ENST00000627656.2
External Link	RMBase: m5C_site_9424
mod ID: M5CSITE005412		Click to Show/Hide the Full List
mod site	chr12:2863838-2863839:-
Sequence	GTGGCACATGCCTGTAATCCCAGCTACTTGGGAGGCTGAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; rmsk_3707069; ENST00000627656.2; ENST00000366362.3; ENST00000359843.7; ENST00000536066.1; ENST00000535350.1; ENST00000342628.6
External Link	RMBase: m5C_site_9425
mod ID: M5CSITE005413		Click to Show/Hide the Full List
mod site	chr12:2863839-2863840:-
Sequence	GGTGGCACATGCCTGTAATCCCAGCTACTTGGGAGGCTGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_3707069; ENST00000627656.2; ENST00000361953.7; ENST00000535350.1; ENST00000359843.7; ENST00000342628.6; ENST00000366362.3; ENST00000536066.1
External Link	RMBase: m5C_site_9426
mod ID: M5CSITE005414		Click to Show/Hide the Full List
mod site	chr12:2863911-2863912:-
Sequence	GAGTTTGAGACCAGCCTGGCCAACGTGGCGAAACCCCGTCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000535350.1; ENST00000627656.2; ENST00000366362.3; rmsk_3707069; ENST00000342628.6; ENST00000536066.1; ENST00000359843.7
External Link	RMBase: m5C_site_9427
mod ID: M5CSITE005415		Click to Show/Hide the Full List
mod site	chr12:2863917-2863918:-
Sequence	GGTCAGGAGTTTGAGACCAGCCTGGCCAACGTGGCGAAACC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000359843.7; ENST00000535350.1; rmsk_3707069; ENST00000366362.3; ENST00000536066.1; ENST00000342628.6; ENST00000361953.7; ENST00000627656.2
External Link	RMBase: m5C_site_9428
mod ID: M5CSITE005416		Click to Show/Hide the Full List
mod site	chr12:2863920-2863921:-
Sequence	TGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACGTGGCGAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000536066.1; ENST00000366362.3; ENST00000361953.7; ENST00000535350.1; ENST00000342628.6; rmsk_3707069; ENST00000359843.7; ENST00000627656.2
External Link	RMBase: m5C_site_9429
mod ID: M5CSITE005417		Click to Show/Hide the Full List
mod site	chr12:2863934-2863935:-
Sequence	AGGCAGGTGGATCATGAGGTCAGGAGTTTGAGACCAGCCTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000627656.2; ENST00000366362.3; ENST00000536066.1; ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; rmsk_3707069; ENST00000535350.1
External Link	RMBase: m5C_site_9430
mod ID: M5CSITE005418		Click to Show/Hide the Full List
mod site	chr12:2863942-2863943:-
Sequence	GGAGGCCAAGGCAGGTGGATCATGAGGTCAGGAGTTTGAGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000536066.1; rmsk_3707069; ENST00000359843.7; ENST00000342628.6; ENST00000627656.2; ENST00000535350.1; ENST00000366362.3
External Link	RMBase: m5C_site_9431
mod ID: M5CSITE005419		Click to Show/Hide the Full List
mod site	chr12:2863951-2863952:-
Sequence	AGCACTTTGGGAGGCCAAGGCAGGTGGATCATGAGGTCAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; rmsk_3707069; ENST00000359843.7; ENST00000536066.1; ENST00000342628.6; ENST00000535350.1; ENST00000366362.3; ENST00000627656.2
External Link	RMBase: m5C_site_9432
mod ID: M5CSITE005420		Click to Show/Hide the Full List
mod site	chr12:2863956-2863957:-
Sequence	ATCCCAGCACTTTGGGAGGCCAAGGCAGGTGGATCATGAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000342628.6; ENST00000366362.3; ENST00000627656.2; ENST00000359843.7; ENST00000535350.1; ENST00000361953.7; rmsk_3707069; ENST00000536066.1
External Link	RMBase: m5C_site_9433
mod ID: M5CSITE005421		Click to Show/Hide the Full List
mod site	chr12:2863957-2863958:-
Sequence	AATCCCAGCACTTTGGGAGGCCAAGGCAGGTGGATCATGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	rmsk_3707069; ENST00000536066.1; ENST00000627656.2; ENST00000342628.6; ENST00000366362.3; ENST00000535350.1; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m5C_site_9434
mod ID: M5CSITE005422		Click to Show/Hide the Full List
mod site	chr12:2863967-2863968:-
Sequence	TTACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000361953.7; ENST00000359843.7; ENST00000366362.3; ENST00000342628.6; ENST00000627656.2; ENST00000536066.1; ENST00000535350.1; rmsk_3707069
External Link	RMBase: m5C_site_9435
mod ID: M5CSITE005423		Click to Show/Hide the Full List
mod site	chr12:2877068-2877069:-		[16]
Sequence	CCCTCCCCTCCCGGGATCCCCCGGGGTTCCCACCCCGCCCG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000627656.2
External Link	RMBase: m5C_site_9436

N6-methyladenosine (m6A)

In total 91 m6A sequence/site(s) in this target gene
mod ID: M6ASITE009993		Click to Show/Hide the Full List
mod site	chr12:2857684-2857685:-		[17]
Sequence	CTCAATAAAAGCGAAGGTGGACATGCTGGGCTCTGTGGTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; A549; H1299; MM6; peripheral-blood; GSC-11; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000359843.7; ENST00000536066.1; ENST00000627656.2; ENST00000342628.6; ENST00000361953.7
External Link	RMBase: m6A_site_172793
mod ID: M6ASITE009994		Click to Show/Hide the Full List
mod site	chr12:2857705-2857706:-		[18]
Sequence	CCAGCTTGAGAACACTAACTACTCAATAAAAGCGAAGGTGG
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000536066.1; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7; ENST00000342628.6
External Link	RMBase: m6A_site_172794
mod ID: M6ASITE009995		Click to Show/Hide the Full List
mod site	chr12:2857714-2857715:-		[17]
Sequence	GGGTGTGAGCCAGCTTGAGAACACTAACTACTCAATAAAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; hESC-HEK293T; H1A; H1B; LCLs; A549; H1299; MM6; peripheral-blood; GSC-11; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000536066.1; ENST00000342628.6; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m6A_site_172795
mod ID: M6ASITE009996		Click to Show/Hide the Full List
mod site	chr12:2857841-2857842:-		[17]
Sequence	GGAGACTGGCATTGACGAGAACTCAGGTGGAGGCTTGAGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; H1B; A549; H1299; MM6; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000536066.1; ENST00000361953.7; ENST00000627656.2; ENST00000359843.7; ENST00000342628.6
External Link	RMBase: m6A_site_172796
mod ID: M6ASITE009997		Click to Show/Hide the Full List
mod site	chr12:2857857-2857858:-		[17]
Sequence	TCCCCAATCATACCAGGGAGACTGGCATTGACGAGAACTCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; H1B; A549; H1299; MM6; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000536066.1; ENST00000361953.7; ENST00000627656.2; ENST00000359843.7
External Link	RMBase: m6A_site_172797
mod ID: M6ASITE009998		Click to Show/Hide the Full List
mod site	chr12:2858082-2858083:-		[17]
Sequence	TCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000536066.1; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m6A_site_172803
mod ID: M6ASITE009999		Click to Show/Hide the Full List
mod site	chr12:2858088-2858089:-		[17]
Sequence	TTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000361953.7; ENST00000359843.7; ENST00000342628.6; ENST00000627656.2; ENST00000536066.1
External Link	RMBase: m6A_site_172804
mod ID: M6ASITE010000		Click to Show/Hide the Full List
mod site	chr12:2858097-2858098:-		[18]
Sequence	ACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000361953.7; ENST00000359843.7; ENST00000627656.2; ENST00000342628.6; ENST00000536066.1
External Link	RMBase: m6A_site_172805
mod ID: M6ASITE010001		Click to Show/Hide the Full List
mod site	chr12:2858150-2858151:-		[19]
Sequence	TAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTT
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HepG2; HeLa; hESCs; fibroblasts; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000342628.6; ENST00000627656.2; ENST00000536066.1; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172808
mod ID: M6ASITE010002		Click to Show/Hide the Full List
mod site	chr12:2858188-2858189:-		[18]
Sequence	ATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000536066.1; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172811
mod ID: M6ASITE010003		Click to Show/Hide the Full List
mod site	chr12:2858228-2858229:-		[19]
Sequence	CCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGA
Motif Score	3.319380952
Cell/Tissue List	HEK293T; HepG2; HeLa; hESCs; fibroblasts; A549; iSLK; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000342628.6; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7; ENST00000536066.1
External Link	RMBase: m6A_site_172813
mod ID: M6ASITE010004		Click to Show/Hide the Full List
mod site	chr12:2858372-2858373:-		[17]
Sequence	ATGGTGAAAAGAGATTAGGAACCCCCCAGCCTGTTTCCATT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; U2OS; iSLK; MSC; TREX; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000627656.2; ENST00000342628.6; ENST00000359843.7; ENST00000536066.1
External Link	RMBase: m6A_site_172815
mod ID: M6ASITE010005		Click to Show/Hide the Full List
mod site	chr12:2858404-2858405:-		[17]
Sequence	CCAGGAGCTGAAGGGTGGGAACAACAAAGGCAATGGTGAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; A549; hESC-HEK293T; HepG2; U2OS; GM12878; LCLs; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000359843.7; ENST00000536066.1; ENST00000627656.2
External Link	RMBase: m6A_site_172816
mod ID: M6ASITE010006		Click to Show/Hide the Full List
mod site	chr12:2858467-2858468:-		[17]
Sequence	ACACCCTAGCCACTGCTGGGACCTTGTGTTCCCCAAGAGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; ENST00000627656.2; ENST00000536066.1
External Link	RMBase: m6A_site_172817
mod ID: M6ASITE010007		Click to Show/Hide the Full List
mod site	chr12:2858485-2858486:-		[18]
Sequence	TATGCAAAAGTAGCAGTCACACCCTAGCCACTGCTGGGACC
Motif Score	2.064285714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000536066.1; ENST00000359843.7; ENST00000361953.7; ENST00000627656.2; ENST00000342628.6
External Link	RMBase: m6A_site_172818
mod ID: M6ASITE010008		Click to Show/Hide the Full List
mod site	chr12:2858487-2858488:-		[20]
Sequence	ATTATGCAAAAGTAGCAGTCACACCCTAGCCACTGCTGGGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000359843.7; ENST00000536066.1; ENST00000361953.7
External Link	RMBase: m6A_site_172819
mod ID: M6ASITE010009		Click to Show/Hide the Full List
mod site	chr12:2858540-2858541:-		[17]
Sequence	AGTGAGGACAGCAGGCAGGGACTGTTCTGCTCCTCATAGCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000536066.1; ENST00000627656.2; ENST00000359843.7; ENST00000361953.7; ENST00000342628.6
External Link	RMBase: m6A_site_172820
mod ID: M6ASITE010010		Click to Show/Hide the Full List
mod site	chr12:2858553-2858554:-		[17]
Sequence	CCCCAAGCCTCTGAGTGAGGACAGCAGGCAGGGACTGTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536066.1; ENST00000627656.2; ENST00000342628.6; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172821
mod ID: M6ASITE010011		Click to Show/Hide the Full List
mod site	chr12:2858677-2858678:-		[20]
Sequence	CGAGGACCCACTGGGCCCTGACAACATCAACTGGTCCCAGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000342628.6; ENST00000627656.2; ENST00000359843.7; ENST00000536066.1; ENST00000361953.7
External Link	RMBase: m6A_site_172822
mod ID: M6ASITE010012		Click to Show/Hide the Full List
mod site	chr12:2858692-2858693:-		[17]
Sequence	CTTTCCTGGCCTGGACGAGGACCCACTGGGCCCTGACAACA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000536066.1; ENST00000361953.7; ENST00000627656.2; ENST00000359843.7
External Link	RMBase: m6A_site_172823
mod ID: M6ASITE010013		Click to Show/Hide the Full List
mod site	chr12:2858719-2858720:-		[17]
Sequence	CCTCAGCAAGATCCTGCTGGACATCAGCTTTCCTGGCCTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000342628.6; ENST00000627656.2; ENST00000536066.1; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m6A_site_172824
mod ID: M6ASITE010014		Click to Show/Hide the Full List
mod site	chr12:2858743-2858744:-		[20]
Sequence	GGTCCTGGACACAATGAATGACAGCCTCAGCAAGATCCTGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000536066.1; ENST00000359843.7; ENST00000342628.6; ENST00000627656.2; ENST00000361953.7
External Link	RMBase: m6A_site_172825
mod ID: M6ASITE010015		Click to Show/Hide the Full List
mod site	chr12:2858755-2858756:-		[17]
Sequence	GACAGAAGGCCTGGTCCTGGACACAATGAATGACAGCCTCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000627656.2; ENST00000359843.7; ENST00000342628.6; ENST00000536066.1; ENST00000361953.7
External Link	RMBase: m6A_site_172826
mod ID: M6ASITE010016		Click to Show/Hide the Full List
mod site	chr12:2858774-2858775:-		[20]
Sequence	TTGCAGCCAATCGTTCTCTGACAGAAGGCCTGGTCCTGGAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; ENST00000627656.2; ENST00000536066.1
External Link	RMBase: m6A_site_172827
mod ID: M6ASITE010017		Click to Show/Hide the Full List
mod site	chr12:2858836-2858837:-		[18]
Sequence	CTCTTCTCCCTCAGATATAGACGTCCCCAAGCCAGGCTCCC
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000342628.6; ENST00000627656.2; ENST00000536066.1; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172828
mod ID: M6ASITE010018		Click to Show/Hide the Full List
mod site	chr12:2858857-2858858:-		[18]
Sequence	CATCTCCGTCCCCTTTGGCAACTCTTCTCCCTCAGATATAG
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000627656.2; ENST00000536066.1; ENST00000342628.6; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172829
mod ID: M6ASITE010019		Click to Show/Hide the Full List
mod site	chr12:2858881-2858882:-		[17]
Sequence	CCTCAGTTCAGAACCCTTAGACCTCATCTCCGTCCCCTTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536066.1; ENST00000359843.7; ENST00000361953.7; ENST00000342628.6; ENST00000627656.2
External Link	RMBase: m6A_site_172830
mod ID: M6ASITE010020		Click to Show/Hide the Full List
mod site	chr12:2858889-2858890:-		[17]
Sequence	CAAAGGCTCCTCAGTTCAGAACCCTTAGACCTCATCTCCGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000536066.1; ENST00000361953.7; ENST00000342628.6; ENST00000359843.7
External Link	RMBase: m6A_site_172831
mod ID: M6ASITE010021		Click to Show/Hide the Full List
mod site	chr12:2859005-2859006:-		[17]
Sequence	TGGATTTCAGCCCAGTACAAACCTCCCAGGGTGCCTCTGAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000627656.2; ENST00000359843.7; ENST00000342628.6; ENST00000536066.1
External Link	RMBase: m6A_site_172832
mod ID: M6ASITE010022		Click to Show/Hide the Full List
mod site	chr12:2859009-2859010:-		[20]
Sequence	GGACTGGATTTCAGCCCAGTACAAACCTCCCAGGGTGCCTC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000536066.1; ENST00000359843.7; ENST00000342628.6; ENST00000361953.7
External Link	RMBase: m6A_site_172833
mod ID: M6ASITE010023		Click to Show/Hide the Full List
mod site	chr12:2859027-2859028:-		[17]
Sequence	CCCCCAGCCAAAGTAGGGGGACTGGATTTCAGCCCAGTACA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000359843.7; ENST00000361953.7; ENST00000342628.6; ENST00000536066.1
External Link	RMBase: m6A_site_172834
mod ID: M6ASITE010024		Click to Show/Hide the Full List
mod site	chr12:2859071-2859072:-		[17]
Sequence	GCAAATCTGTCCTCCCCAGAACCCCTGAATCCTGGAGGCTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; ENST00000536066.1; ENST00000627656.2
External Link	RMBase: m6A_site_172835
mod ID: M6ASITE010025		Click to Show/Hide the Full List
mod site	chr12:2859116-2859117:-		[18]
Sequence	TTAAGACACCCATTAAGGAAACGCTGCCCATCTCCTCCACC
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000536066.1; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7; ENST00000342628.6
External Link	RMBase: m6A_site_172836
mod ID: M6ASITE010026		Click to Show/Hide the Full List
mod site	chr12:2859131-2859132:-		[17]
Sequence	AAGTGGGAGGACCTTTTAAGACACCCATTAAGGAAACGCTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000627656.2; ENST00000536066.1; ENST00000342628.6; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m6A_site_172837
mod ID: M6ASITE010027		Click to Show/Hide the Full List
mod site	chr12:2859141-2859142:-		[17]
Sequence	TACTCCCAGGAAGTGGGAGGACCTTTTAAGACACCCATTAA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000536066.1; ENST00000342628.6; ENST00000627656.2; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172838
mod ID: M6ASITE010028		Click to Show/Hide the Full List
mod site	chr12:2859181-2859182:-		[21]
Sequence	GTTCCCAGCAGACTCCTCTGACCCTGCCTCCCAGCTCAGCT
Motif Score	2.839113095
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000627656.2; ENST00000359843.7; ENST00000536066.1; ENST00000342628.6; ENST00000361953.7
External Link	RMBase: m6A_site_172839
mod ID: M6ASITE010029		Click to Show/Hide the Full List
mod site	chr12:2859190-2859191:-		[17]
Sequence	AGAGCTCCCGTTCCCAGCAGACTCCTCTGACCCTGCCTCCC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000536066.1; ENST00000359843.7; ENST00000627656.2
External Link	RMBase: m6A_site_172840
mod ID: M6ASITE010030		Click to Show/Hide the Full List
mod site	chr12:2859288-2859289:-		[17]
Sequence	AGGAGCCGGTCTCGGAGAAAACAGCATCTACTGCCTCCCTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; GM12878; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; ENST00000536066.1
External Link	RMBase: m6A_site_172841
mod ID: M6ASITE010031		Click to Show/Hide the Full List
mod site	chr12:2859327-2859328:-		[20]
Sequence	TCGGAAATGCTTGTGATTCAACACAGGGAGAGGAGGGAGAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000359843.7; ENST00000342628.6; ENST00000627656.2; ENST00000536066.1; ENST00000361953.7
External Link	RMBase: m6A_site_172842
mod ID: M6ASITE010032		Click to Show/Hide the Full List
mod site	chr12:2859379-2859380:-		[18]
Sequence	CCCAAGACCCAAGAAGTCCTACAGTGGGCTTAGGTCCCCAA
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000342628.6; ENST00000361953.7; ENST00000627656.2; ENST00000536066.1; ENST00000359843.7
External Link	RMBase: m6A_site_172843
mod ID: M6ASITE010033		Click to Show/Hide the Full List
mod site	chr12:2859393-2859394:-		[17]
Sequence	TCCCAATCTCCCACCCCAAGACCCAAGAAGTCCTACAGTGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1299; MM6; Jurkat; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536066.1; ENST00000359843.7; ENST00000361953.7; ENST00000627656.2; ENST00000342628.6
External Link	RMBase: m6A_site_172844
mod ID: M6ASITE010034		Click to Show/Hide the Full List
mod site	chr12:2859504-2859505:-		[17]
Sequence	GAAATGCCACACTTAGCGAGACCCATCAAAGTGGAGAGCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; peripheral-blood; GSC-11; iSLK; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000627656.2; ENST00000536066.1; ENST00000359843.7; ENST00000535350.1; ENST00000342628.6
External Link	RMBase: m6A_site_172845
mod ID: M6ASITE010035		Click to Show/Hide the Full List
mod site	chr12:2859516-2859517:-		[20]
Sequence	CAGCCTGGGGAGGAAATGCCACACTTAGCGAGACCCATCAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361953.7; ENST00000627656.2; ENST00000359843.7; ENST00000342628.6; ENST00000535350.1; ENST00000536066.1
External Link	RMBase: m6A_site_172846
mod ID: M6ASITE010036		Click to Show/Hide the Full List
mod site	chr12:2859557-2859558:-		[17]
Sequence	CTCCTTTGCTTCCAGTTCAGACTATCAAGGAGGAAGAAATC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; peripheral-blood; GSC-11; iSLK; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000359843.7; ENST00000535350.1; ENST00000536066.1; ENST00000361953.7; ENST00000342628.6; ENST00000627656.2
External Link	RMBase: m6A_site_172847
mod ID: M6ASITE010037		Click to Show/Hide the Full List
mod site	chr12:2859600-2859601:-		[17]
Sequence	GGACCAGGGAAAGAGGAGAAACTCCTGTTTGGAGAAGGGTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; peripheral-blood; GSC-11; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000535350.1; ENST00000342628.6; ENST00000536066.1; ENST00000627656.2; ENST00000361953.7; ENST00000359843.7
External Link	RMBase: m6A_site_172851
mod ID: M6ASITE010038		Click to Show/Hide the Full List
mod site	chr12:2859618-2859619:-		[17]
Sequence	GCTCCTCTTTCTTCTGCAGGACCAGGGAAAGAGGAGAAACT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; peripheral-blood; GSC-11; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000359843.7; ENST00000536066.1; ENST00000627656.2; ENST00000535350.1; ENST00000361953.7; ENST00000342628.6
External Link	RMBase: m6A_site_172852
mod ID: M6ASITE010039		Click to Show/Hide the Full List
mod site	chr12:2864428-2864429:-		[17]
Sequence	ACCTATCCAGTTCCCGGTGAACCAGTCACTGGTGTTGCAGC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342628.6; ENST00000535350.1; ENST00000366362.3; ENST00000359843.7; ENST00000361953.7; ENST00000536066.1; ENST00000627656.2
External Link	RMBase: m6A_site_172855
mod ID: M6ASITE010040		Click to Show/Hide the Full List
mod site	chr12:2864698-2864699:-		[22]
Sequence	AACATGACCATCAAAACCGAACTCCCCCTGGGCGCACGTTA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000538564.5; ENST00000535350.1; ENST00000359843.7; ENST00000536066.1; ENST00000366362.3; ENST00000342628.6; ENST00000361953.7
External Link	RMBase: m6A_site_172856
mod ID: M6ASITE010041		Click to Show/Hide the Full List
mod site	chr12:2864703-2864704:-		[17]
Sequence	GCCGGAACATGACCATCAAAACCGAACTCCCCCTGGGCGCA
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000535350.1; ENST00000538564.5; ENST00000536066.1; ENST00000627656.2; ENST00000359843.7; ENST00000366362.3; ENST00000342628.6
External Link	RMBase: m6A_site_172857
mod ID: M6ASITE010042		Click to Show/Hide the Full List
mod site	chr12:2864717-2864718:-		[17]
Sequence	GAATCCAGAGCTCCGCCGGAACATGACCATCAAAACCGAAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000538564.5; ENST00000342628.6; ENST00000536066.1; ENST00000535350.1; ENST00000359843.7; ENST00000361953.7; ENST00000627656.2
External Link	RMBase: m6A_site_172858
mod ID: M6ASITE010043		Click to Show/Hide the Full List
mod site	chr12:2864910-2864911:-		[17]
Sequence	CACTCATCACAGTTTTGGAGACTGCTCGCCTACGTCCATCC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000538564.5; ENST00000359843.7; ENST00000537018.5; ENST00000535350.1; ENST00000627656.2
External Link	RMBase: m6A_site_172859
mod ID: M6ASITE010044		Click to Show/Hide the Full List
mod site	chr12:2865378-2865379:-		[20]
Sequence	CCACTGGACCCAGGGTCTCCACAATTGCCCGAGCACTTGGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537018.5; ENST00000342628.6; ENST00000359843.7; ENST00000361953.7; ENST00000627656.2; ENST00000538564.5; ENST00000535350.1
External Link	RMBase: m6A_site_172860
mod ID: M6ASITE010045		Click to Show/Hide the Full List
mod site	chr12:2865391-2865392:-		[17]
Sequence	TGGCCGCCACCAGCCACTGGACCCAGGGTCTCCACAATTGC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538564.5; ENST00000535350.1; ENST00000361953.7; ENST00000627656.2; ENST00000537018.5; ENST00000359843.7; ENST00000342628.6
External Link	RMBase: m6A_site_172861
mod ID: M6ASITE010046		Click to Show/Hide the Full List
mod site	chr12:2866405-2866406:-		[17]
Sequence	CAACCGCTACTTGACATTGGACCAGGTGTTTAAGGTGAATG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000627656.2; ENST00000535350.1; ENST00000361953.7; ENST00000342628.6; ENST00000359843.7; ENST00000538564.5; ENST00000537018.5
External Link	RMBase: m6A_site_172862
mod ID: M6ASITE010047		Click to Show/Hide the Full List
mod site	chr12:2866412-2866413:-		[20]
Sequence	CCAGTGCCAACCGCTACTTGACATTGGACCAGGTGTTTAAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000538564.5; ENST00000537018.5; ENST00000535350.1; ENST00000627656.2; ENST00000359843.7; ENST00000361953.7; ENST00000342628.6
External Link	RMBase: m6A_site_172863
mod ID: M6ASITE010048		Click to Show/Hide the Full List
mod site	chr12:2866442-2866443:-		[17]
Sequence	ATGGCAAGGTCTCCTTCTGGACCATTCACCCCAGTGCCAAC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000537018.5; ENST00000535350.1; ENST00000361953.7; ENST00000627656.2; ENST00000359843.7; ENST00000538564.5; ENST00000342628.6
External Link	RMBase: m6A_site_172864
mod ID: M6ASITE010049		Click to Show/Hide the Full List
mod site	chr12:2866489-2866490:-		[20]
Sequence	CCACAACCTTTCCCTGCACGACATGTTTGTCCGGGAGACGT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537018.5; ENST00000535350.1; ENST00000342628.6; ENST00000627656.2; ENST00000538564.5; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172865
mod ID: M6ASITE010050		Click to Show/Hide the Full List
mod site	chr12:2868444-2868445:-		[17]
Sequence	AAAGGACACTAGAATGATAAACAAATGTATCTTTTAGATTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; HepG2; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535350.1; ENST00000361953.7; ENST00000342628.6; ENST00000537018.5; ENST00000545049.1; ENST00000359843.7; ENST00000627656.2; ENST00000538564.5
External Link	RMBase: m6A_site_172866
mod ID: M6ASITE010051		Click to Show/Hide the Full List
mod site	chr12:2868459-2868460:-		[17]
Sequence	ACAGCAGTTAAGTGCAAAGGACACTAGAATGATAAACAAAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; HepG2; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535350.1; ENST00000627656.2; ENST00000342628.6; ENST00000361953.7; ENST00000359843.7; ENST00000538564.5; ENST00000537018.5; ENST00000545049.1
External Link	RMBase: m6A_site_172867
mod ID: M6ASITE010052		Click to Show/Hide the Full List
mod site	chr12:2868479-2868480:-		[17]
Sequence	TACTGCAACTTGTATCTGGGACAGCAGTTAAGTGCAAAGGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; HepG2; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000538564.5; ENST00000535350.1; ENST00000627656.2; ENST00000361953.7; ENST00000537018.5; ENST00000342628.6; ENST00000359843.7; ENST00000545049.1
External Link	RMBase: m6A_site_172868
mod ID: M6ASITE010053		Click to Show/Hide the Full List
mod site	chr12:2868584-2868585:-		[20]
Sequence	CCACTTTCCCTACTTTAAGCACATTGCCAAGCCAGGCTGGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000361953.7; ENST00000545049.1; ENST00000538564.5; ENST00000359843.7; ENST00000342628.6; ENST00000537018.5
External Link	RMBase: m6A_site_172869
mod ID: M6ASITE010054		Click to Show/Hide the Full List
mod site	chr12:2868605-2868606:-		[17]
Sequence	CATCTATACGTGGATTGAGGACCACTTTCCCTACTTTAAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000538564.5; ENST00000545049.1; ENST00000359843.7; ENST00000627656.2; ENST00000537018.5; ENST00000342628.6
External Link	RMBase: m6A_site_172870
mod ID: M6ASITE010055		Click to Show/Hide the Full List
mod site	chr12:2868626-2868627:-		[17]
Sequence	GAAGCGCATGACTTTGAAAGACATCTATACGTGGATTGAGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000627656.2; ENST00000359843.7; ENST00000545049.1; ENST00000537018.5; ENST00000538564.5
External Link	RMBase: m6A_site_172871
mod ID: M6ASITE010056		Click to Show/Hide the Full List
mod site	chr12:2868636-2868637:-		[18]
Sequence	GCACTGAGAGGAAGCGCATGACTTTGAAAGACATCTATACG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000537018.5; ENST00000627656.2; ENST00000545049.1; ENST00000342628.6; ENST00000359843.7; ENST00000538564.5; ENST00000361953.7
External Link	RMBase: m6A_site_172872
mod ID: M6ASITE010057		Click to Show/Hide the Full List
mod site	chr12:2868686-2868687:-		[20]
Sequence	TGAGCGGCCACCCTACTCTTACATGGCCATGATACAATTCG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000537018.5; ENST00000627656.2; ENST00000545049.1; ENST00000359843.7; ENST00000538564.5; ENST00000342628.6; ENST00000361953.7
External Link	RMBase: m6A_site_172873
mod ID: M6ASITE010058		Click to Show/Hide the Full List
mod site	chr12:2868716-2868717:-		[17]
Sequence	ACCATCAGCGTCCTGGCAGAACTCTGTGTCTGAGCGGCCAC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; H1299; MM6; Huh7; Jurkat; peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000537018.5; ENST00000538564.5; ENST00000545049.1; ENST00000361953.7; ENST00000627656.2; ENST00000359843.7
External Link	RMBase: m6A_site_172874
mod ID: M6ASITE010059		Click to Show/Hide the Full List
mod site	chr12:2868736-2868737:-		[17]
Sequence	CAGGTTGAGGAGCCTTCGAGACCATCAGCGTCCTGGCAGAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537018.5; ENST00000545049.1; ENST00000342628.6; ENST00000359843.7; ENST00000627656.2; ENST00000361953.7; ENST00000538564.5
External Link	RMBase: m6A_site_172875
mod ID: M6ASITE010060		Click to Show/Hide the Full List
mod site	chr12:2872167-2872168:-		[17]
Sequence	CGAAAGATGAGTTCTGATGGACTGGGCTCCCGCAGCATCAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000359843.7; ENST00000342628.6; ENST00000545049.1; ENST00000537018.5; ENST00000627656.2; ENST00000538564.5; ENST00000361953.7
External Link	RMBase: m6A_site_172876
mod ID: M6ASITE010061		Click to Show/Hide the Full List
mod site	chr12:2872201-2872202:-		[20]
Sequence	TATCAACAATAGCCTATCCAACATCCAGTGGCTTCGAAAGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000361953.7; ENST00000545049.1; ENST00000538564.5; ENST00000537018.5; ENST00000359843.7
External Link	RMBase: m6A_site_172877
mod ID: M6ASITE010062		Click to Show/Hide the Full List
mod site	chr12:2872216-2872217:-		[20]
Sequence	GGCAGCAGGCTGCACTATCAACAATAGCCTATCCAACATCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000359843.7; ENST00000342628.6; ENST00000538564.5; ENST00000537018.5; ENST00000545049.1; ENST00000361953.7
External Link	RMBase: m6A_site_172878
mod ID: M6ASITE010063		Click to Show/Hide the Full List
mod site	chr12:2873982-2873983:-		[17]
Sequence	TTTGCGAGCAGAAACGGGAGACCTGTGGTATGTGGTCTTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000545049.1; ENST00000342628.6; ENST00000359843.7; ENST00000537018.5; ENST00000627656.2; ENST00000538564.5; ENST00000361953.7
External Link	RMBase: m6A_site_172879
mod ID: M6ASITE010064		Click to Show/Hide the Full List
mod site	chr12:2874016-2874017:-		[17]
Sequence	AGGGATGTGAATCTTCCTAGACCACCTGGAGCCCTTTGCGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000545049.1; ENST00000627656.2; ENST00000538564.5; ENST00000359843.7; ENST00000537018.5; ENST00000361953.7
External Link	RMBase: m6A_site_172880
mod ID: M6ASITE010065		Click to Show/Hide the Full List
mod site	chr12:2874046-2874047:-		[17]
Sequence	CTGGAGACCTTGGGACCAAAACCTGCAGCTAGGGATGTGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000359843.7; ENST00000545049.1; ENST00000627656.2; ENST00000537018.5; ENST00000538564.5
External Link	RMBase: m6A_site_172881
mod ID: M6ASITE010066		Click to Show/Hide the Full List
mod site	chr12:2874052-2874053:-		[17]
Sequence	GTGACCCTGGAGACCTTGGGACCAAAACCTGCAGCTAGGGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000545049.1; ENST00000537018.5; ENST00000538564.5; ENST00000627656.2; ENST00000342628.6; ENST00000359843.7
External Link	RMBase: m6A_site_172882
mod ID: M6ASITE010067		Click to Show/Hide the Full List
mod site	chr12:2874060-2874061:-		[17]
Sequence	GGACAGAAGTGACCCTGGAGACCTTGGGACCAAAACCTGCA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000545049.1; ENST00000342628.6; ENST00000538564.5; ENST00000361953.7; ENST00000359843.7; ENST00000627656.2; ENST00000537018.5
External Link	RMBase: m6A_site_172883
mod ID: M6ASITE010068		Click to Show/Hide the Full List
mod site	chr12:2874078-2874079:-		[17]
Sequence	CCAGCTATGATGCCAAAAGGACAGAAGTGACCCTGGAGACC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000537018.5; ENST00000538564.5; ENST00000359843.7; ENST00000627656.2; ENST00000545049.1; ENST00000361953.7; ENST00000342628.6
External Link	RMBase: m6A_site_172884
mod ID: M6ASITE010069		Click to Show/Hide the Full List
mod site	chr12:2874099-2874100:-		[17]
Sequence	GACTCCGGCCTCAAACCCAAACCAGCTATGATGCCAAAAGG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000361953.7; ENST00000342628.6; ENST00000545049.1; ENST00000537018.5; ENST00000627656.2; ENST00000359843.7; ENST00000538564.5
External Link	RMBase: m6A_site_172885
mod ID: M6ASITE010070		Click to Show/Hide the Full List
mod site	chr12:2874105-2874106:-		[17]
Sequence	CTCCAGGACTCCGGCCTCAAACCCAAACCAGCTATGATGCC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000359843.7; ENST00000538564.5; ENST00000627656.2; ENST00000545049.1; ENST00000361953.7; ENST00000342628.6; ENST00000537018.5
External Link	RMBase: m6A_site_172886
mod ID: M6ASITE010071		Click to Show/Hide the Full List
mod site	chr12:2874118-2874119:-		[17]
Sequence	GCCCCAACTCAGCCTCCAGGACTCCGGCCTCAAACCCAAAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000627656.2; ENST00000538564.5; ENST00000537018.5; ENST00000342628.6; ENST00000359843.7; ENST00000545049.1; ENST00000361953.7
External Link	RMBase: m6A_site_172887
mod ID: M6ASITE010072		Click to Show/Hide the Full List
mod site	chr12:2874167-2874168:-		[20]
Sequence	GAGTGGCAGTAGTGGGCCCAACAAATTCATCCTCATCAGCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000342628.6; ENST00000538564.5; ENST00000361953.7; ENST00000545049.1; ENST00000359843.7; ENST00000627656.2
External Link	RMBase: m6A_site_172888
mod ID: M6ASITE010073		Click to Show/Hide the Full List
mod site	chr12:2874239-2874240:-		[20]
Sequence	GCAAGTAGTGGCCATCCCCAACAATGCTAATATTCACAGCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000359843.7; ENST00000342628.6; ENST00000361953.7; ENST00000627656.2
External Link	RMBase: m6A_site_172889
mod ID: M6ASITE010074		Click to Show/Hide the Full List
mod site	chr12:2874263-2874264:-		[20]
Sequence	TAACCACCCCACCATGCCCAACACGCAAGTAGTGGCCATCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000627656.2; ENST00000361953.7; ENST00000342628.6; ENST00000359843.7
External Link	RMBase: m6A_site_172890
mod ID: M6ASITE010075		Click to Show/Hide the Full List
mod site	chr12:2874385-2874386:-		[17]
Sequence	AGTGAAACATCAGAGGAGGAACCTAAGAGATCCCCTGCCCA
Motif Score	2.930744048
Cell/Tissue List	HeLa; U2OS; MT4; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000342628.6; ENST00000359843.7; ENST00000361953.7
External Link	RMBase: m6A_site_172891
mod ID: M6ASITE010076		Click to Show/Hide the Full List
mod site	chr12:2874399-2874400:-		[17]
Sequence	TTCAAAATGCCCCAAGTGAAACATCAGAGGAGGAACCTAAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; U2OS; MT4; H1299; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000361953.7; ENST00000342628.6; ENST00000359843.7
External Link	RMBase: m6A_site_172892
mod ID: M6ASITE010077		Click to Show/Hide the Full List
mod site	chr12:2874471-2874472:-		[17]
Sequence	AACGCAGATTCATAATGAAAACTAGCCCCCGTCGGCCACTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; U2OS
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342628.6; ENST00000359843.7; ENST00000361953.7; ENST00000627656.2
External Link	RMBase: m6A_site_172893
mod ID: M6ASITE010078		Click to Show/Hide the Full List
mod site	chr12:2874519-2874520:-		[20]
Sequence	ATTTGCATTTTCCAGGGTCCACACTTGTGATTCTCAATGGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000361953.7; ENST00000359843.7; ENST00000342628.6; ENST00000627656.2
External Link	RMBase: m6A_site_172894
mod ID: M6ASITE010079		Click to Show/Hide the Full List
mod site	chr12:2877036-2877037:-		[17]
Sequence	CCCCGCCCGCACCGCCGGGGACCCGGCCGGTCCGGCGCGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; U2OS; Jurkat; GSC-11; HEK293T; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2; ENST00000361953.7
External Link	RMBase: m6A_site_172897
mod ID: M6ASITE010080		Click to Show/Hide the Full List
mod site	chr12:2877091-2877092:-		[17]
Sequence	ACCCCCGGCCCCGGCCCGGGACCCCCTCCCCTCCCGGGATC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; H1B; Jurkat; HEK293T; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2
External Link	RMBase: m6A_site_172898
mod ID: M6ASITE010081		Click to Show/Hide the Full List
mod site	chr12:2877116-2877117:-		[17]
Sequence	ACTGAAAGCTCCGGTGCCAGACCCCACCCCCGGCCCCGGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; U2OS; H1B; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000627656.2
External Link	RMBase: m6A_site_172899
mod ID: M6ASITE010082		Click to Show/Hide the Full List
mod site	chr12:2877140-2877141:-		[23]
Sequence	CGCCAATTTCAAACAGCGGAACAAACTGAAAGCTCCGGTGC
Motif Score	2.951386905
Cell/Tissue List	U2OS; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000627656.2
External Link	RMBase: m6A_site_172900
mod ID: M6ASITE010083		Click to Show/Hide the Full List
mod site	chr12:2877148-2877149:-		[23]
Sequence	TCCGCCGGCGCCAATTTCAAACAGCGGAACAAACTGAAAGC
Motif Score	2.20572619
Cell/Tissue List	U2OS; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000627656.2
External Link	RMBase: m6A_site_172901

Ref 1	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 2	ALKBH5-m(6)A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia. Biochem Biophys Res Commun. 2020 Jan 8;521(2):499-506. doi: 10.1016/j.bbrc.2019.10.145. Epub 2019 Oct 31.
Ref 3	ALKBH5-mediated m(6)A demethylation of FOXM1 mRNA promotes progression of uveal melanoma. Aging (Albany NY). 2021 Jan 10;13(3):4045-4062. doi: 10.18632/aging.202371. Epub 2021 Jan 10.
Ref 4	ALKBH5 promotes lung fibroblast activation and silica-induced pulmonary fibrosis through miR-320a-3p and FOXM1. Cell Mol Biol Lett. 2022 Mar 12;27(1):26. doi: 10.1186/s11658-022-00329-5.
Ref 5	N(6)-methyladenosine methyltransferase WTAP-stabilized FOXD2-AS1 promotes the osteosarcoma progression through m(6)A/FOXM1 axis. Bioengineered. 2022 Apr;13(4):7963-7973. doi: 10.1080/21655979.2021.2008218.
Ref 6	YTHDF1 promotes breast cancer progression by facilitating FOXM1 translation in an m6A-dependent manner. Cell Biosci. 2022 Feb 23;12(1):19. doi: 10.1186/s13578-022-00759-w.
Ref 7	m(6)A reader Ythdf3 protects hematopoietic stem cell integrity under stress by promoting the translation of Foxm1 and Asxl1 transcripts. Haematologica. 2022 Aug 1;107(8):1922-1927. doi: 10.3324/haematol.2021.279300.
Ref 8	US patent application no. 7,425,545, Modulation of C-reactive protein expression.
Ref 9	A phase 1 dose escalation study of BI 831266, an inhibitor of Aurora kinase B, in patients with advanced solid tumors. Invest New Drugs. 2015 Apr;33(2):409-22. doi: 10.1007/s10637-014-0201-7. Epub 2014 Dec 23.
Ref 10	A polarized localization of amino acid/carnitine transporter B(0,+) (ATB(0,+)) in the blood-brain barrier. Biochem Biophys Res Commun. 2008 Nov 14;376(2):267-70. doi: 10.1016/j.bbrc.2008.08.122. Epub 2008 Sep 2.
Ref 11	Peroxisome proliferator-activated receptors, metabolic syndrome and cardiovascular disease. Future Cardiol. 2010 September; 6(5): 657-691.
Ref 12	Mechanisms limiting distribution of the threonine-protein kinase B-RaF(V600E) inhibitor dabrafenib to the brain: implications for the treatment of melanoma brain metastases. J Pharmacol Exp Ther. 2013 Mar;344(3):655-64. doi: 10.1124/jpet.112.201475. Epub 2012 Dec 17.
Ref 13	Mechanism of the pharmacokinetic interaction between methotrexate and benzimidazoles: potential role for breast cancer resistance protein in clinical drug-drug interactions. Cancer Res. 2004 Aug 15;64(16):5804-11. doi: 10.1158/0008-5472.CAN-03-4062.
Ref 14	The role of human CYP2C8 and CYP2C9 variants in pioglitazone metabolism in vitro. Basic Clin Pharmacol Toxicol. 2009 Dec;105(6):374-9. doi: 10.1111/j.1742-7843.2009.00457.x. Epub 2009 Jul 15.
Ref 15	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 16	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 17	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 18	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 19	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 20	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 21	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 22	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 23	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map