m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00210)

Target Name	Cyclin-dependent kinase 2 (CDK2)
Synonyms	Cell division protein kinase 2; p33 protein kinase; CDKN2 Click to Show/Hide
Gene Name	CDK2
Chromosomal Location	12q13.2
Family	protein kinase superfamily; CMGC Ser/Thr protein kinase family; CDC2/CDKX subfamily
Function	Serine/threonine-protein kinase involved in the control of the cell cycle; essential for meiosis, but dispensable for mitosis. Phosphorylates CTNNB1, USP37, p53/TP53, NPM1, CDK7, RB1, BRCA2, MYC, NPAT, EZH2. Triggers duplication of centrosomes and DNA. Acts at the G1-S transition to promote the E2F transcriptional program and the initiation of DNA synthesis, and modulates G2 progression; controls the timing of entry into mitosis/meiosis by controlling the subsequent activation of cyclin B/CDK1 by phosphorylation, and coordinates the activation of cyclin B/CDK1 at the centrosome and in the nucleus. Crucial role in orchestrating a fine balance between cellular proliferation, cell death, and DNA repair in human embryonic stem cells (hESCs). Activity of CDK2 is maximal during S phase and G2; activated by interaction with cyclin E during the early stages of DNA synthesis to permit G1-S transition, and subsequently activated by cyclin A2 (cyclin A1 in germ cells) during the late stages of DNA replication to drive the transition from S phase to mitosis, the G2 phase. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. Phosphorylates CABLES1 (By similarity). Cyclin E/CDK2 prevents oxidative stress-mediated Ras-induced senescence by phosphorylating MYC. Involved in G1-S phase DNA damage checkpoint that prevents cells with damaged DNA from initiating mitosis; regulates homologous recombination-dependent repair by phosphorylating BRCA2, this phosphorylation is low in S phase when recombination is active, but increases as cells progress towards mitosis. In response to DNA damage, double-strand break repair by homologous recombination a reduction of CDK2-mediated BRCA2 phosphorylation. Phosphorylation of RB1 disturbs its interaction with E2F1. NPM1 phosphorylation by cyclin E/CDK2 promotes its dissociates from unduplicated centrosomes, thus initiating centrosome duplication. Cyclin E/CDK2-mediated phosphorylation of NPAT at G1-S transition and until prophase stimulates the NPAT-mediated activation of histone gene transcription during S phase. Required for vitamin D-mediated growth inhibition by being itself inactivated. Involved in the nitric oxide- (NO) mediated signaling in a nitrosylation/activation-dependent manner. USP37 is activated by phosphorylation and thus triggers G1-S transition. CTNNB1 phosphorylation regulates insulin internalization. Phosphorylates FOXP3 and negatively regulates its transcriptional activity and protein stability (By similarity). Phosphorylates CDK2AP2. Phosphorylates ERCC6 which is essential for its chromatin remodeling activity at DNA double-strand breaks. Click to Show/Hide
Gene ID	1017
Uniprot ID	CDK2_HUMAN
HGNC ID	HGNC:1771
KEGG ID	hsa:1017

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CDK2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	B16-OVA cell line	Mus musculus
Treatment: shFTO B16-OVA cells Control: shNC B16-OVA cells		GSE154952
Regulation		logFC: 7.39E-01 p-value: 1.49E-28
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Responsed Drug	Epigallocatechin gallate		Phase 3	Drug Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	FTO knockdown markedly decreased the expression of CCNA2 and Cyclin-dependent kinase 2 (CDK2), crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity.
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
	Arrest cell cycle at S phase
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of Ccnd1 and Cyclin-dependent kinase 2 (CDK2)(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shControl AGS		GSE159425
Regulation		logFC: -8.20E-01 p-value: 7.96E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of Cyclin-dependent kinase 2 (CDK2), CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Responsed Drug	Epigallocatechin gallate		Phase 3	Drug Info
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	FTO knockdown markedly decreased the expression of CCNA2 and Cyclin-dependent kinase 2 (CDK2), crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity.
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
	Arrest cell cycle at S phase
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of Ccnd1 and Cyclin-dependent kinase 2 (CDK2)(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of Cyclin-dependent kinase 2 (CDK2), CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Obesity [ICD-11: 5B81]

Disease Info

In total 6 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Epigallocatechin gallate		Phase 3	Drug Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	FTO knockdown markedly decreased the expression of CCNA2 and Cyclin-dependent kinase 2 (CDK2), crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
	Arrest cell cycle at S phase
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 3 Reporting the m6A-centered Disease Response				[3]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of Ccnd1 and Cyclin-dependent kinase 2 (CDK2)(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Epigallocatechin gallate		Phase 3	Drug Info
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 5 Reporting the m6A-centered Disease Response				[2]
Response Summary	FTO knockdown markedly decreased the expression of CCNA2 and Cyclin-dependent kinase 2 (CDK2), crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
	Arrest cell cycle at S phase
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 6 Reporting the m6A-centered Disease Response				[3]
Response Summary	Metformin could inhibit adipogenesis and combat obesity, metformin could inhibit protein expression of FTO, leading to increased m6A methylation levels of Ccnd1 and Cyclin-dependent kinase 2 (CDK2)(two crucial regulators in cell cycle). Ccnd1 and Cdk2 with increased m6A levels were recognised by YTHDF2, causing an YTHDF2-dependent decay and decreased protein expressions.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell cycle

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of Cyclin-dependent kinase 2 (CDK2), CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Epigallocatechin gallate [Phase 3]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-dependent CCNA2 and Cyclin-dependent kinase 2 (CDK2) expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Cell Process	Adipogenesis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03086		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Diabetic retinopathy	Disease Info
Drug	FB23-2	Drug Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03087		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Diabetic retinopathy	Disease Info
Drug	FB23-2	Drug Info

Non-coding RNA

m6A Regulator: Wilms tumor 1-associating protein (WTAP)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05345		Crosstalk Info
Epigenetic Regulator	hsa-miR-501-3p
Regulated Target	Pre-mRNA-splicing regulator WTAP (WTAP)
Crosstalk relationship	ncRNA → m6A
Disease	Kidney cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00210)

Cyclin-dependent kinase 2 (CDK2)

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000048		Click to Show/Hide the Full List
mod site	chr12:55966918-55966919:+		[10]
Sequence	GTACTGGGCCCTGTTTCCCCCTCCTCGGCCCCCGAGAGCCA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000354056.4; ENST00000555357.1; ENST00000440311.6; ENST00000555408.5; ENST00000556464.5; ENST00000554619.5; ENST00000553376.5; ENST00000266970.9
External Link	RMBase: m5C_site_10322
mod ID: M5CSITE000049		Click to Show/Hide the Full List
mod site	chr12:55972417-55972418:+		[10]
Sequence	ATCCCATTTTCCTCTGACGTCCACCTCCTACCCCATAGGAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m5C_site_10323

N6-methyladenosine (m6A)

In total 40 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013254		Click to Show/Hide the Full List
mod site	chr12:55966809-55966810:+		[11]
Sequence	GCCTCTGGTGGCGGTCGGGAACTCGGTGGGAGGCGGCAACA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000555408.5; ENST00000556464.5
External Link	RMBase: m6A_site_192290
mod ID: M6ASITE013255		Click to Show/Hide the Full List
mod site	chr12:55966852-55966853:+		[12]
Sequence	GTTTCAAGTTGGCCAAATTGACAAGAGCGAGAGGTATACTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555357.1; ENST00000555408.5; ENST00000554619.5; ENST00000556464.5; ENST00000440311.6; ENST00000266970.9; ENST00000553376.5; ENST00000354056.4
External Link	RMBase: m6A_site_192291
mod ID: M6ASITE013256		Click to Show/Hide the Full List
mod site	chr12:55966900-55966901:+		[13]
Sequence	TCCCGACCCGGGGCCACGGTACTGGGCCCTGTTTCCCCCTC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000354056.4; ENST00000266970.9; ENST00000555408.5; ENST00000554619.5; ENST00000440311.6; ENST00000555357.1; ENST00000556464.5; ENST00000553376.5
External Link	RMBase: m6A_site_192292
mod ID: M6ASITE013257		Click to Show/Hide the Full List
mod site	chr12:55967015-55967016:+		[11]
Sequence	TCGCTGGCGCTTCATGGAGAACTTCCAAAAGGTGGAAAAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; BGC823; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; iSLK; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000266970.9; ENST00000440311.6; ENST00000554619.5; ENST00000555408.5; ENST00000555357.1; ENST00000556464.5; ENST00000553376.5; ENST00000354056.4
External Link	RMBase: m6A_site_192296
mod ID: M6ASITE013258		Click to Show/Hide the Full List
mod site	chr12:55967063-55967064:+		[12]
Sequence	GGGCACGTACGGAGTTGTGTACAAAGCCAGAAACAAGTTGA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555408.5; ENST00000554619.5; ENST00000266970.9; ENST00000553376.5; ENST00000354056.4; ENST00000555357.1; ENST00000440311.6; ENST00000556464.5
External Link	RMBase: m6A_site_192297
mod ID: M6ASITE013259		Click to Show/Hide the Full List
mod site	chr12:55967075-55967076:+		[11]
Sequence	AGTTGTGTACAAAGCCAGAAACAAGTTGACGGGAGAGGTGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; BGC823; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000555408.5; ENST00000555357.1; ENST00000266970.9; ENST00000354056.4; ENST00000556464.5; ENST00000440311.6; ENST00000553376.5; ENST00000554619.5
External Link	RMBase: m6A_site_192298
mod ID: M6ASITE013260		Click to Show/Hide the Full List
mod site	chr12:55967120-55967121:+		[14]
Sequence	GCTTAAGAAAATCCGCCTGGACACGTGAGTGGCCTCTGTAC
Motif Score	3.643047619
Cell/Tissue List	HepG2; hESC-HEK293T; peripheral-blood
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000554619.5; ENST00000553376.5; ENST00000555357.1; ENST00000440311.6; ENST00000555408.5; ENST00000266970.9; ENST00000354056.4; ENST00000556464.5
External Link	RMBase: m6A_site_192299
mod ID: M6ASITE013261		Click to Show/Hide the Full List
mod site	chr12:55967146-55967147:+		[15]
Sequence	GAGTGGCCTCTGTACCCGGGACTCCTAACTGGGGACCTCCT
Motif Score	4.065041667
Cell/Tissue List	HepG2; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000553376.5; ENST00000440311.6; ENST00000266970.9; ENST00000554619.5; ENST00000555408.5; ENST00000556464.5; ENST00000354056.4; ENST00000555357.1
External Link	RMBase: m6A_site_192300
mod ID: M6ASITE013262		Click to Show/Hide the Full List
mod site	chr12:55967160-55967161:+		[15]
Sequence	CCCGGGACTCCTAACTGGGGACCTCCTTGATTGTCCCCCCC
Motif Score	3.622404762
Cell/Tissue List	HepG2; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000556464.5; ENST00000555408.5; ENST00000555357.1; ENST00000440311.6; ENST00000354056.4; ENST00000553376.5; ENST00000266970.9; ENST00000554619.5
External Link	RMBase: m6A_site_192301
mod ID: M6ASITE013263		Click to Show/Hide the Full List
mod site	chr12:55967878-55967879:+		[13]
Sequence	AGACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000440311.6; ENST00000555357.1; ENST00000556276.5; ENST00000553376.5; ENST00000556656.5; ENST00000556146.1; ENST00000354056.4; ENST00000555408.5; ENST00000266970.9; ENST00000554619.5; ENST00000556464.5
External Link	RMBase: m6A_site_192302
mod ID: M6ASITE013264		Click to Show/Hide the Full List
mod site	chr12:55968065-55968066:+		[12]
Sequence	TAGGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000556656.5; ENST00000354056.4; ENST00000556464.5; ENST00000266970.9; ENST00000554619.5; ENST00000555408.5; ENST00000555357.1; ENST00000556276.5; ENST00000553376.5; ENST00000556146.1; ENST00000440311.6
External Link	RMBase: m6A_site_192303
mod ID: M6ASITE013265		Click to Show/Hide the Full List
mod site	chr12:55968868-55968869:+		[12]
Sequence	ACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000354056.4; ENST00000266970.9; ENST00000556276.5; ENST00000556656.5; ENST00000440311.6; ENST00000554619.5; ENST00000556146.1; ENST00000556464.5; ENST00000555408.5; ENST00000553376.5
External Link	RMBase: m6A_site_192304
mod ID: M6ASITE013266		Click to Show/Hide the Full List
mod site	chr12:55968895-55968896:+		[13]
Sequence	GGGGGCCATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTT
Motif Score	3.319380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000556656.5; ENST00000553376.5; ENST00000440311.6; ENST00000555408.5; ENST00000354056.4; ENST00000556276.5; ENST00000556464.5; ENST00000266970.9; ENST00000556146.1; ENST00000554619.5
External Link	RMBase: m6A_site_192305
mod ID: M6ASITE013267		Click to Show/Hide the Full List
mod site	chr12:55968933-55968934:+		[13]
Sequence	CTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTGAGT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000554619.5; ENST00000354056.4; ENST00000266970.9; ENST00000556656.5; ENST00000440311.6; ENST00000556276.5; ENST00000556146.1; ENST00000556464.5; ENST00000553376.5; ENST00000555408.5
External Link	RMBase: m6A_site_192306
mod ID: M6ASITE013268		Click to Show/Hide the Full List
mod site	chr12:55968937-55968938:+		[12]
Sequence	TGGAGTCCCTGTTCGTACTTACACCCATGAGGTGAGTCCCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000556146.1; ENST00000556464.5; ENST00000556276.5; ENST00000440311.6; ENST00000354056.4; ENST00000556656.5; ENST00000554619.5; ENST00000555408.5; ENST00000266970.9; ENST00000553376.5
External Link	RMBase: m6A_site_192307
mod ID: M6ASITE013269		Click to Show/Hide the Full List
mod site	chr12:55969541-55969542:+		[12]
Sequence	ATATTATTCCACAGCTGTGGACATCTGGAGCCTGGGCTGCA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000554619.5; ENST00000555408.5; ENST00000553376.5; ENST00000354056.4; ENST00000266970.9; ENST00000556656.5; ENST00000440311.6; ENST00000556276.5; ENST00000556146.1; ENST00000556464.5
External Link	RMBase: m6A_site_192308
mod ID: M6ASITE013270		Click to Show/Hide the Full List
mod site	chr12:55971161-55971162:+		[12]
Sequence	AGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000555408.5; ENST00000553376.5; ENST00000354056.4; ENST00000440311.6; ENST00000554545.1; ENST00000266970.9; ENST00000556656.5
External Link	RMBase: m6A_site_192310
mod ID: M6ASITE013271		Click to Show/Hide the Full List
mod site	chr12:55971210-55971211:+		[13]
Sequence	CAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGG
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555408.5; ENST00000440311.6; ENST00000554545.1; ENST00000354056.4; ENST00000266970.9; ENST00000556656.5; ENST00000553376.5
External Link	RMBase: m6A_site_192311
mod ID: M6ASITE013272		Click to Show/Hide the Full List
mod site	chr12:55971321-55971322:+		[11]
Sequence	CAGGATGAAGGAAGGATGAGACCCTGAAATCTGGGCCTCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000555408.5; ENST00000556656.5; ENST00000440311.6; ENST00000554545.1; ENST00000553376.5; ENST00000354056.4; ENST00000266970.9
External Link	RMBase: m6A_site_192312
mod ID: M6ASITE013273		Click to Show/Hide the Full List
mod site	chr12:55971457-55971458:+		[16]
Sequence	TGGTTTCCTGATTTCTGGGAACACCTGCTGCCCATTTAGTC
Motif Score	2.951386905
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000554545.1; ENST00000553376.5; ENST00000556656.5; ENST00000440311.6; ENST00000354056.4; ENST00000555408.5; ENST00000266970.9
External Link	RMBase: m6A_site_192313
mod ID: M6ASITE013274		Click to Show/Hide the Full List
mod site	chr12:55971542-55971543:+		[12]
Sequence	AATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000266970.9; ENST00000440311.6; ENST00000556656.5; ENST00000553376.5; ENST00000354056.4; ENST00000554545.1; ENST00000555408.5
External Link	RMBase: m6A_site_192314
mod ID: M6ASITE013275		Click to Show/Hide the Full List
mod site	chr12:55971706-55971707:+		[11]
Sequence	CTTGGCCTTGGGCTATTTGGACTCAGGTGGGCCCTCTGAAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000440311.6; ENST00000266970.9; ENST00000553376.5; ENST00000354056.4; ENST00000555408.5; ENST00000554545.1
External Link	RMBase: m6A_site_192315
mod ID: M6ASITE013276		Click to Show/Hide the Full List
mod site	chr12:55971725-55971726:+		[11]
Sequence	GACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000555408.5; ENST00000554545.1; ENST00000440311.6; ENST00000354056.4; ENST00000553376.5; ENST00000266970.9
External Link	RMBase: m6A_site_192316
mod ID: M6ASITE013277		Click to Show/Hide the Full List
mod site	chr12:55971736-55971737:+		[11]
Sequence	GCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTTGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000440311.6; ENST00000555408.5; ENST00000554545.1; ENST00000354056.4; ENST00000553376.5; ENST00000266970.9
External Link	RMBase: m6A_site_192317
mod ID: M6ASITE013278		Click to Show/Hide the Full List
mod site	chr12:55971794-55971795:+		[11]
Sequence	TACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAAGGAAG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1B; H1A; hESCs; GM12878; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000354056.4; ENST00000266970.9; ENST00000555408.5; ENST00000554545.1; ENST00000553376.5
External Link	RMBase: m6A_site_192319
mod ID: M6ASITE013279		Click to Show/Hide the Full List
mod site	chr12:55971831-55971832:+		[13]
Sequence	GAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCAC
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000553376.5; ENST00000266970.9; ENST00000555408.5; ENST00000354056.4; ENST00000554545.1
External Link	RMBase: m6A_site_192320
mod ID: M6ASITE013280		Click to Show/Hide the Full List
mod site	chr12:55971920-55971921:+		[13]
Sequence	AATTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACC
Motif Score	2.078666667
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000553376.5; ENST00000555408.5; ENST00000266970.9
External Link	RMBase: m6A_site_192321
mod ID: M6ASITE013281		Click to Show/Hide the Full List
mod site	chr12:55971922-55971923:+		[13]
Sequence	TTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACCAA
Motif Score	2.058863095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555408.5; ENST00000266970.9; ENST00000553376.5
External Link	RMBase: m6A_site_192322
mod ID: M6ASITE013282		Click to Show/Hide the Full List
mod site	chr12:55971985-55971986:+		[13]
Sequence	TATTTCCAGTGTTTGGGATGACCAGGATCCCAAGCCTCCTG
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000553376.5; ENST00000266970.9; ENST00000555408.5
External Link	RMBase: m6A_site_192323
mod ID: M6ASITE013283		Click to Show/Hide the Full List
mod site	chr12:55972011-55972012:+		[12]
Sequence	ATCCCAAGCCTCCTGCTGCCACAATGTTTATAAAGGCCAAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000266970.9; ENST00000553376.5; ENST00000555408.5
External Link	RMBase: m6A_site_192324
mod ID: M6ASITE013284		Click to Show/Hide the Full List
mod site	chr12:55972064-55972065:+		[11]
Sequence	CTAAGTTGGTGCTTTTGAGAACCAAGTAAAACAAAACCACT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000266970.9; ENST00000555408.5; ENST00000553376.5
External Link	RMBase: m6A_site_192325
mod ID: M6ASITE013285		Click to Show/Hide the Full List
mod site	chr12:55972074-55972075:+		[11]
Sequence	GCTTTTGAGAACCAAGTAAAACAAAACCACTGGGAGGAGTC
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000266970.9; ENST00000553376.5; ENST00000555408.5
External Link	RMBase: m6A_site_192326
mod ID: M6ASITE013286		Click to Show/Hide the Full List
mod site	chr12:55972079-55972080:+		[11]
Sequence	TGAGAACCAAGTAAAACAAAACCACTGGGAGGAGTCTATTT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000266970.9; ENST00000553376.5; ENST00000555408.5
External Link	RMBase: m6A_site_192327
mod ID: M6ASITE013287		Click to Show/Hide the Full List
mod site	chr12:55972178-55972179:+		[13]
Sequence	CTCACCTAATAGGCTGGGAGACTGAAGACTCAGCCCGGGTG
Motif Score	3.319380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555408.5; ENST00000266970.9
External Link	RMBase: m6A_site_192328
mod ID: M6ASITE013288		Click to Show/Hide the Full List
mod site	chr12:55972276-55972277:+		[17]
Sequence	GGAATCTGGGAGGCCCTGAGACAGGGATTGTGCTTCATTCC
Motif Score	2.897386905
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000555408.5; ENST00000266970.9
External Link	RMBase: m6A_site_192329
mod ID: M6ASITE013289		Click to Show/Hide the Full List
mod site	chr12:55972413-55972414:+		[13]
Sequence	CCTGATCCCATTTTCCTCTGACGTCCACCTCCTACCCCATA
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m6A_site_192330
mod ID: M6ASITE013290		Click to Show/Hide the Full List
mod site	chr12:55972476-55972477:+		[13]
Sequence	GCATCATTTTGAGAATGCTGACACTTTTTCAGGGCTGTGAT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m6A_site_192331
mod ID: M6ASITE013291		Click to Show/Hide the Full List
mod site	chr12:55972478-55972479:+		[13]
Sequence	ATCATTTTGAGAATGCTGACACTTTTTCAGGGCTGTGATTG
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m6A_site_192332
mod ID: M6ASITE013292		Click to Show/Hide the Full List
mod site	chr12:55972541-55972542:+		[13]
Sequence	TTTCTTTAAAAGAAGGATGAACAATTATATTTATATTTCAG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m6A_site_192333
mod ID: M6ASITE013293		Click to Show/Hide the Full List
mod site	chr12:55972653-55972654:+		[13]
Sequence	CACCTTGGGGTTTTGTAATGACAGTGCTAAAAAAAAAAAGC
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000266970.9
External Link	RMBase: m6A_site_192334

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000016		Click to Show/Hide the Full List
mod site	chr12:55971834-55971835:+		[18]
Sequence	GTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCT
Transcript ID List	ENST00000553376.5; ENST00000554545.1; ENST00000266970.9; ENST00000354056.4; ENST00000555408.5
External Link	RMBase: Pseudo_site_1146

Ref 1	Epigallocatechin gallate targets FTO and inhibits adipogenesis in an mRNA m(6)A-YTHDF2-dependent manner. Int J Obes (Lond). 2018 Jul;42(7):1378-1388. doi: 10.1038/s41366-018-0082-5. Epub 2018 May 24.
Ref 2	FTO regulates adipogenesis by controlling cell cycle progression via m(6)A-YTHDF2 dependent mechanism. Biochim Biophys Acta Mol Cell Biol Lipids. 2018 Oct;1863(10):1323-1330. doi: 10.1016/j.bbalip.2018.08.008. Epub 2018 Aug 13.
Ref 3	Metformin combats obesity by targeting FTO in an m(6)A-YTHDF2-dependent manner. J Drug Target. 2022 May 9:1-9. doi: 10.1080/1061186X.2022.2071906. Online ahead of print.
Ref 4	YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nat Commun. 2019 Oct 25;10(1):4892. doi: 10.1038/s41467-019-12801-6.
Ref 5	Potential interaction between ritonavir and carbamazepine. Pharmacotherapy. 2000 Jul;20(7):851-4. doi: 10.1592/phco.20.9.851.35206.
Ref 6	Interferon-beta gene therapy for cancer: basic research to clinical application. Cancer Sci. 2004 Nov;95(11):858-65. doi: 10.1111/j.1349-7006.2004.tb02194.x.
Ref 7	Evidence for two nonidentical drug-interaction sites in the human P-glycoprotein. Proc Natl Acad Sci U S A. 1997 Sep 30;94(20):10594-9. doi: 10.1073/pnas.94.20.10594.
Ref 8	Active Mediated Transport of Chloramphenicol and Thiamphenicol in a Calu-3 Lung Epithelial Cell Model. J Pharm Sci. 2018 Apr;107(4):1178-1184. doi: 10.1016/j.xphs.2017.11.021. Epub 2017 Dec 5.
Ref 9	Clinical pipeline report, company report or official report of Eli Lilly.
Ref 10	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 13	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 14	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 15	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 16	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 17	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 18	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map