m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00189)

Target Name	Autophagy protein 5 (ATG5)
Synonyms	APG5-like; Apoptosis-specific protein; APG5L; ASP Click to Show/Hide
Gene Name	ATG5
Chromosomal Location	6q21
Family	ATG5 family
Function	Involved in autophagic vesicle formation. Conjugation with ATG12, through a ubiquitin-like conjugating system involving ATG7 as an E1-like activating enzyme and ATG10 as an E2-like conjugating enzyme, is essential for its function. The ATG12-ATG5 conjugate acts as an E3-like enzyme which is required for lipidation of ATG8 family proteins and their association to the vesicle membranes. Involved in mitochondrial quality control after oxidative damage, and in subsequent cellular longevity. Plays a critical role in multiple aspects of lymphocyte development and is essential for both B and T lymphocyte survival and proliferation. Required for optimal processing and presentation of antigens for MHC II. Involved in the maintenance of axon morphology and membrane structures, as well as in normal adipocyte differentiation. Promotes primary ciliogenesis through removal of OFD1 from centriolar satellites and degradation of IFT20 via the autophagic pathway. May play an important role in the apoptotic process, possibly within the modified cytoskeleton. Its expression is a relatively late event in the apoptotic process, occurring downstream of caspase activity. Plays a crucial role in IFN-gamma-induced autophagic cell death by interacting with FADD. (Microbial infection) May act as a proviral factor. In association with ATG12, negatively regulates the innate antiviral immune response by impairing the type I IFN production pathway upon vesicular stomatitis virus (VSV) infection. Required for the translation of incoming hepatitis C virus (HCV) RNA and, thereby, for initiation of HCV replication, but not required once infection is established. Click to Show/Hide
Gene ID	9474
Uniprot ID	ATG5_HUMAN
HGNC ID	HGNC:589
KEGG ID	hsa:9474

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ATG5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	CT26 cell line	Mus musculus
Treatment: METTL3 knockout CT26 cells Control: CT26 cells		GSE142589
Regulation		logFC: -9.09E-01 p-value: 4.91E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ATG5 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 8.30E+00	GSE60213

In total 7 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Autophagy protein 5 (ATG5), Atg7 and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Target Regulation	Up regulation
Responsed Disease	Enterovirus		ICD-11: 1A2Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation and metastasis
	Cell apoptosis
	Cell autophagy
In-vitro Model	Schwann cells (A type of glial cell that surrounds neurons)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG12, and ATG16L1.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib		Approved	Drug Info
Pathway Response	FoxO signaling pathway			hsa04068
	Autophagy			hsa04140
Cell Process	Cell autophagy
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Target Regulation	Up regulation
Responsed Disease	Testicular cancer		ICD-11: 2C80	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Target Regulation	Up regulation
Responsed Disease	Testicular cancer		ICD-11: 2C80	Disease Info
Responsed Drug	3-Methyladenine		Investigative	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between ATG5 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.24E+00	GSE49339

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Autophagy protein 5 (ATG5) and Atg7 were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Target Regulation	Down regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with ATG101. CircRAB11FIP1 mediated mRNA expression levels of Autophagy protein 5 (ATG5) and ATG7 depending on m6A.
Target Regulation	Up regulation
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary		ICD-11: 2B5D.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Autophagy protein 5 (ATG5) and Atg7 were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG7, ATG12, and ATG16L1.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

Enterovirus [ICD-11: 1A2Y]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Autophagy protein 5 (ATG5), Atg7 and LC3 II. Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Responsed Disease	Enterovirus [ICD-11: 1A2Y]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy		hsa04140
Cell Process	Cell proliferation and metastasis
	Cell apoptosis
	Cell autophagy
In-vitro Model	Schwann cells (A type of glial cell that surrounds neurons)

Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with ATG101. CircRAB11FIP1 mediated mRNA expression levels of Autophagy protein 5 (ATG5) and ATG7 depending on m6A.
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG12, and ATG16L1.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy
Experiment 2 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG7, ATG12, and ATG16L1.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Sorafenib	Approved	Drug Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Beta-Elemen		Phase 3	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Testicular cancer [ICD-11: 2C80]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Responsed Disease	Testicular cancer [ICD-11: 2C80]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Responsed Disease	Testicular cancer [ICD-11: 2C80]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	3-Methyladenine		Investigative	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012

Obesity [ICD-11: 5B81]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	Autophagy protein 5 (ATG5) and Atg7 were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).
Experiment 2 Reporting the m6A-centered Disease Response				[5]
Response Summary	Autophagy protein 5 (ATG5) and Atg7 were the targets of YTHDF2 (YTH N6-methyladenosine RNA binding protein 2). Upon FTO silencing, Atg5 and Atg7 transcripts with higher m6A levels were captured by YTHDF2, which resulted in mRNA degradation and reduction of protein expression, thus alleviating autophagy and adipogenesis.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagy
	Adipogenesis regulation
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
	Pig primary preadipocytes (Isolated from cervical subcutaneous adipose tissue of piglets)
In-vivo Model	Mice were maintained at 22 ± 2 ℃ with a humidity of 35 ± 5% under a 12 h light and 12 h dark cycle, with free access to water and food. For the HFD experiment, female control (Fto^flox/flox) and adipose-selective fto knockout (Fabp4-Cre Fto^flox/flox, fto-AKO) mice were fed with high-fat diet (60% fat in calories; Research Diets, D12492) for the desired periods of time, and food intake and body weight were measured every week after weaning (at 3 weeks of age).

Chloroquine [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Testicular cancer		ICD-11: 2C80	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012

Gefitinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

Sorafenib [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG12, and ATG16L1.
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy
Experiment 2 Reporting the m6A-centered Drug Response			[2]
Response Summary	METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, Autophagy protein 5 (ATG5), ATG7, ATG12, and ATG16L1.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma	ICD-11: 2C12.02	Disease Info
Pathway Response	FoxO signaling pathway		hsa04068
	Autophagy		hsa04140
Cell Process	Cell autophagy

Beta-Elemen [Phase 3]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as Autophagy protein 5 (ATG5), ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and LC3B-II. beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Autophagic lysosome acidification
In-vitro Model	Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
	Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vivo Model	NSCLC gefitinib-resistant cells (5 × 10⁶ cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).

3-Methyladenine [Investigative]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting Autophagy protein 5 (ATG5) in seminoma. The use of autophagy inhibitors 3-MA could reverse the protective effect of METTL3 on TCam-2 cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Testicular cancer		ICD-11: 2C80	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cellular Processes
	Cellular Transport
	Cellular catabolism
	Cell autophagy
In-vitro Model	Tcam-2/DDP (Cisplatin-resistant TCam-2 cell line)
	TCam-2	Testicular seminoma	Homo sapiens	CVCL_T012

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05872		Crosstalk Info
Epigenetic Regulator	Circ_RAB11FIP1
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Ovarian cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00189)

Autophagy protein 5 (ATG5)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001596		Click to Show/Hide the Full List
mod site	chr6:106166233-106166234:-		[12]
Sequence	CTCACCATGTTAACCAGGCTAGTCTTGAACTTCTGACCTCA
Transcript ID List	ENST00000636335.1; ENST00000636437.1
External Link	RMBase: RNA-editing_site_118173
mod ID: A2ISITE001597		Click to Show/Hide the Full List
mod site	chr6:106212664-106212665:-		[13]
Sequence	ATTGCCAATAGGGTTTTTTGAGTTTTGTTTTGTTTTGTTTA
Transcript ID List	ENST00000476518.1; ENST00000646025.1; ENST00000636335.1; ENST00000343245.7; ENST00000613993.1; ENST00000636437.1; ENST00000360666.6; ENST00000369076.8; ENST00000369070.5; ENST00000635758.2
External Link	RMBase: RNA-editing_site_118174

N6-methyladenosine (m6A)

In total 56 m6A sequence/site(s) in this target gene
mod ID: M6ASITE076354		Click to Show/Hide the Full List
mod site	chr6:106184669-106184670:-		[14]
Sequence	TGAAAGTAAATTTTATGAAGACATTGCCCATTTTTACTTCC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636437.1; ENST00000360666.6; ENST00000635758.2; ENST00000636335.1; ENST00000369076.8; ENST00000369070.5; ENST00000343245.7; ENST00000475645.1
External Link	RMBase: m6A_site_728875
mod ID: M6ASITE076355		Click to Show/Hide the Full List
mod site	chr6:106184744-106184745:-		[14]
Sequence	GCCAGAGTAGTTTTATACAGACAAAACCAGTGTCAGGCCTT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000475645.1; ENST00000369076.8; ENST00000360666.6; ENST00000635758.2; ENST00000343245.7; ENST00000636437.1; ENST00000369070.5; ENST00000636335.1
External Link	RMBase: m6A_site_728876
mod ID: M6ASITE076356		Click to Show/Hide the Full List
mod site	chr6:106184798-106184799:-		[14]
Sequence	AAAGGATCAGAATGCAGGGAACACTAAGCTGTGATGAAGAA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000475645.1; ENST00000636437.1; ENST00000636335.1; ENST00000360666.6; ENST00000369076.8; ENST00000635758.2; ENST00000369070.5
External Link	RMBase: m6A_site_728877
mod ID: M6ASITE076357		Click to Show/Hide the Full List
mod site	chr6:106184902-106184903:-		[14]
Sequence	TGGTCTGAATATGATTGTTCACATTAAGAGTGTTTATTCGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636335.1; ENST00000475645.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6; ENST00000636437.1; ENST00000635758.2; ENST00000343245.7
External Link	RMBase: m6A_site_728878
mod ID: M6ASITE076358		Click to Show/Hide the Full List
mod site	chr6:106184931-106184932:-		[15]
Sequence	CCACTGACTTGTATTTTTGCACAAGAGGCTGGTCTGAATAT
Motif Score	2.830589286
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000369070.5; ENST00000636437.1; ENST00000369076.8; ENST00000636335.1; ENST00000360666.6; ENST00000343245.7; ENST00000475645.1; ENST00000635758.2
External Link	RMBase: m6A_site_728879
mod ID: M6ASITE076360		Click to Show/Hide the Full List
mod site	chr6:106184949-106184950:-		[15]
Sequence	TATGTAAGGATAAAAAATCCACTGACTTGTATTTTTGCACA
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000369076.8; ENST00000343245.7; ENST00000636335.1; ENST00000475645.1; ENST00000369070.5; ENST00000635758.2; ENST00000360666.6; ENST00000636437.1
External Link	RMBase: m6A_site_728880
mod ID: M6ASITE076361		Click to Show/Hide the Full List
mod site	chr6:106185055-106185056:-		[16]
Sequence	TACAGCATACAATCTCAGAAACTTAGAAGCAAGTAGAAAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000635758.2; ENST00000343245.7; ENST00000369076.8; ENST00000369070.5; ENST00000636437.1; ENST00000475645.1; ENST00000636335.1; ENST00000360666.6
External Link	RMBase: m6A_site_728881
mod ID: M6ASITE076362		Click to Show/Hide the Full List
mod site	chr6:106185153-106185154:-		[14]
Sequence	GATTAATAGCACATTTCTTCACAAAATTAGATAAAGTTGGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000635758.2; ENST00000636335.1; ENST00000369070.5; ENST00000475645.1; ENST00000360666.6; ENST00000636437.1; ENST00000369076.8
External Link	RMBase: m6A_site_728882
mod ID: M6ASITE076363		Click to Show/Hide the Full List
mod site	chr6:106185242-106185243:-		[14]
Sequence	TTTTTCTTATAAAAAATTATACAAATGCTGAAGTGAGATTC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000635758.2; ENST00000343245.7; ENST00000636437.1; ENST00000369076.8; ENST00000636335.1; ENST00000369070.5; ENST00000360666.6; ENST00000475645.1
External Link	RMBase: m6A_site_728883
mod ID: M6ASITE076364		Click to Show/Hide the Full List
mod site	chr6:106185301-106185302:-		[14]
Sequence	TAAAAGGCTTACAGTATCAGACACGATCATGGTTTTAGATC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000636437.1; ENST00000369076.8; ENST00000636335.1; ENST00000369070.5; ENST00000360666.6; ENST00000635758.2; ENST00000475645.1
External Link	RMBase: m6A_site_728884
mod ID: M6ASITE076365		Click to Show/Hide the Full List
mod site	chr6:106185337-106185338:-		[15]
Sequence	GCTGTCCATATTGAATGTTGACCCATTTGAGTACGCTAAAA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000369070.5; ENST00000636437.1; ENST00000360666.6; ENST00000635758.2; ENST00000636335.1; ENST00000369076.8; ENST00000475645.1; ENST00000343245.7
External Link	RMBase: m6A_site_728885
mod ID: M6ASITE076366		Click to Show/Hide the Full List
mod site	chr6:106185734-106185735:-		[15]
Sequence	AAAAAACCTGTGTTCTTTACACACTACACGTATAAATATTG
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000475645.1; ENST00000635758.2; ENST00000636437.1; ENST00000369076.8; ENST00000369070.5; ENST00000343245.7; ENST00000360666.6; ENST00000636335.1
External Link	RMBase: m6A_site_728886
mod ID: M6ASITE076367		Click to Show/Hide the Full List
mod site	chr6:106185749-106185750:-		[16]
Sequence	TTCTTGCTGCCAATTAAAAAACCTGTGTTCTTTACACACTA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369070.5; ENST00000636335.1; ENST00000635758.2; ENST00000636437.1; ENST00000475645.1; ENST00000369076.8; ENST00000360666.6; ENST00000343245.7
External Link	RMBase: m6A_site_728887
mod ID: M6ASITE076368		Click to Show/Hide the Full List
mod site	chr6:106185966-106185967:-		[15]
Sequence	TCTTGTAACTTTGATAATGAACAGTGAGAGATTTTTAAATA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq; DART-seq
Transcript ID List	ENST00000343245.7; ENST00000369076.8; ENST00000636335.1; ENST00000369070.5; ENST00000636437.1; ENST00000635758.2; ENST00000360666.6; ENST00000475645.1; ENST00000646025.1
External Link	RMBase: m6A_site_728888
mod ID: M6ASITE076369		Click to Show/Hide the Full List
mod site	chr6:106185979-106185980:-		[15]
Sequence	TATTGGTATGCAATCTTGTAACTTTGATAATGAACAGTGAG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000636437.1; ENST00000635758.2; ENST00000360666.6; ENST00000369070.5; ENST00000636335.1; ENST00000369076.8; ENST00000475645.1; ENST00000646025.1; ENST00000343245.7
External Link	RMBase: m6A_site_728889
mod ID: M6ASITE076371		Click to Show/Hide the Full List
mod site	chr6:106186009-106186010:-		[15]
Sequence	AACGAAAATTTCCTATGTTTACAGTCTGTCTATTGGTATGC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000646025.1; ENST00000369070.5; ENST00000636437.1; ENST00000369076.8; ENST00000636335.1; ENST00000360666.6; ENST00000635758.2; ENST00000475645.1; ENST00000343245.7
External Link	RMBase: m6A_site_728890
mod ID: M6ASITE076372		Click to Show/Hide the Full List
mod site	chr6:106186028-106186029:-		[15]
Sequence	AGTAAACCCATCTTTCCTTAACGAAAATTTCCTATGTTTAC
Motif Score	2.142029762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000369070.5; ENST00000343245.7; ENST00000360666.6; ENST00000646025.1; ENST00000635758.2; ENST00000475645.1; ENST00000369076.8; ENST00000636335.1; ENST00000636437.1
External Link	RMBase: m6A_site_728891
mod ID: M6ASITE076373		Click to Show/Hide the Full List
mod site	chr6:106186043-106186044:-		[17]
Sequence	AAAAGATTGAATTACAGTAAACCCATCTTTCCTTAACGAAA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; Huh7; peripheral-blood; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000635758.2; ENST00000636335.1; ENST00000475645.1; ENST00000343245.7; ENST00000646025.1; ENST00000369076.8; ENST00000636437.1; ENST00000369070.5; ENST00000360666.6
External Link	RMBase: m6A_site_728892
mod ID: M6ASITE076374		Click to Show/Hide the Full List
mod site	chr6:106186050-106186051:-		[15]
Sequence	TTTTTGTAAAAGATTGAATTACAGTAAACCCATCTTTCCTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000360666.6; ENST00000636437.1; ENST00000475645.1; ENST00000369070.5; ENST00000636335.1; ENST00000343245.7; ENST00000646025.1; ENST00000635758.2; ENST00000369076.8
External Link	RMBase: m6A_site_728893
mod ID: M6ASITE076375		Click to Show/Hide the Full List
mod site	chr6:106186083-106186084:-		[15]
Sequence	GAGAAATTCTGTTATCAATAACTTGCAAGTAATTTTTTGTA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000360666.6; ENST00000636437.1; ENST00000636335.1; ENST00000369070.5; ENST00000475645.1; ENST00000646025.1; ENST00000635758.2; ENST00000343245.7; ENST00000369076.8
External Link	RMBase: m6A_site_728894
mod ID: M6ASITE076376		Click to Show/Hide the Full List
mod site	chr6:106186141-106186142:-		[16]
Sequence	TTTAGCTCATGAAAGTGGAAACATTGGTTTAATTTTCAAGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000636437.1; ENST00000475645.1; ENST00000646025.1; ENST00000369076.8; ENST00000360666.6; ENST00000635758.2; ENST00000636335.1; ENST00000369070.5
External Link	RMBase: m6A_site_728895
mod ID: M6ASITE076377		Click to Show/Hide the Full List
mod site	chr6:106186163-106186164:-		[16]
Sequence	CCTAAGGTGACCATGGTTGAACTTTAGCTCATGAAAGTGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000369076.8; ENST00000635758.2; ENST00000646025.1; ENST00000636437.1; ENST00000360666.6; ENST00000475645.1; ENST00000636335.1; ENST00000343245.7; ENST00000369070.5
External Link	RMBase: m6A_site_728896
mod ID: M6ASITE076378		Click to Show/Hide the Full List
mod site	chr6:106186174-106186175:-		[18]
Sequence	CAGGGGTATTTCCTAAGGTGACCATGGTTGAACTTTAGCTC
Motif Score	2.839113095
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000369076.8; ENST00000646025.1; ENST00000475645.1; ENST00000636335.1; ENST00000369070.5; ENST00000360666.6; ENST00000636437.1; ENST00000635758.2; ENST00000343245.7
External Link	RMBase: m6A_site_728897
mod ID: M6ASITE076379		Click to Show/Hide the Full List
mod site	chr6:106186195-106186196:-		[16]
Sequence	TATTTCTGATTAACAAATAAACAGGGGTATTTCCTAAGGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000360666.6; ENST00000343245.7; ENST00000369070.5; ENST00000475645.1; ENST00000646025.1; ENST00000369076.8; ENST00000636335.1; ENST00000636437.1; ENST00000635758.2
External Link	RMBase: m6A_site_728898
mod ID: M6ASITE076380		Click to Show/Hide the Full List
mod site	chr6:106186203-106186204:-		[15]
Sequence	TCGATTTGTATTTCTGATTAACAAATAAACAGGGGTATTTC
Motif Score	2.168095238
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000475645.1; ENST00000636335.1; ENST00000636437.1; ENST00000646025.1; ENST00000635758.2; ENST00000369070.5; ENST00000360666.6; ENST00000369076.8
External Link	RMBase: m6A_site_728899
mod ID: M6ASITE076383		Click to Show/Hide the Full List
mod site	chr6:106186260-106186261:-		[16]
Sequence	TAAAATATAATGAAGCTGAAACCTTTGGCCTAAGAAGAAAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369070.5; ENST00000635758.2; ENST00000646025.1; ENST00000636437.1; ENST00000369076.8; ENST00000343245.7; ENST00000475645.1; ENST00000636335.1; ENST00000360666.6
External Link	RMBase: m6A_site_728900
mod ID: M6ASITE076384		Click to Show/Hide the Full List
mod site	chr6:106186298-106186299:-		[16]
Sequence	TGACATGAAAGACTTACCGGACCACTGAAGGTCTTCTGTAA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369070.5; ENST00000475645.1; ENST00000636437.1; ENST00000369076.8; ENST00000343245.7; ENST00000646025.1; ENST00000360666.6; ENST00000635758.2; ENST00000636335.1
External Link	RMBase: m6A_site_728901
mod ID: M6ASITE076385		Click to Show/Hide the Full List
mod site	chr6:106186303-106186304:-		[15]
Sequence	AGCTGTGACATGAAAGACTTACCGGACCACTGAAGGTCTTC
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000475645.1; ENST00000636335.1; ENST00000343245.7; ENST00000635758.2; ENST00000636437.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6; ENST00000646025.1
External Link	RMBase: m6A_site_728902
mod ID: M6ASITE076386		Click to Show/Hide the Full List
mod site	chr6:106186307-106186308:-		[16]
Sequence	CCTCAGCTGTGACATGAAAGACTTACCGGACCACTGAAGGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000343245.7; ENST00000475645.1; ENST00000369076.8; ENST00000635758.2; ENST00000636437.1; ENST00000360666.6; ENST00000636335.1; ENST00000646025.1; ENST00000369070.5
External Link	RMBase: m6A_site_728903
mod ID: M6ASITE076387		Click to Show/Hide the Full List
mod site	chr6:106186316-106186317:-		[15]
Sequence	ATCATTAAACCTCAGCTGTGACATGAAAGACTTACCGGACC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T; CD8T
Seq Type List	DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636437.1; ENST00000636335.1; ENST00000360666.6; ENST00000635758.2; ENST00000646025.1; ENST00000369076.8; ENST00000343245.7; ENST00000369070.5; ENST00000475645.1
External Link	RMBase: m6A_site_728904
mod ID: M6ASITE076388		Click to Show/Hide the Full List
mod site	chr6:106186328-106186329:-		[16]
Sequence	TCCTCCACTGCCATCATTAAACCTCAGCTGTGACATGAAAG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000635758.2; ENST00000646025.1; ENST00000475645.1; ENST00000636335.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6; ENST00000343245.7; ENST00000636437.1
External Link	RMBase: m6A_site_728905
mod ID: M6ASITE076389		Click to Show/Hide the Full List
mod site	chr6:106186368-106186369:-		[15]
Sequence	AAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343245.7; ENST00000646025.1; ENST00000635758.2; ENST00000369070.5; ENST00000360666.6; ENST00000475645.1; ENST00000636437.1; ENST00000636335.1; ENST00000369076.8
External Link	RMBase: m6A_site_728906
mod ID: M6ASITE076390		Click to Show/Hide the Full List
mod site	chr6:106186413-106186414:-		[16]
Sequence	ACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636335.1; ENST00000636437.1; ENST00000646025.1; ENST00000343245.7; ENST00000635758.2; ENST00000360666.6; ENST00000369070.5; ENST00000369076.8; ENST00000475645.1
External Link	RMBase: m6A_site_728907
mod ID: M6ASITE076391		Click to Show/Hide the Full List
mod site	chr6:106186435-106186436:-		[16]
Sequence	TGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000475645.1; ENST00000635758.2; ENST00000646025.1; ENST00000636335.1; ENST00000343245.7; ENST00000360666.6; ENST00000369076.8; ENST00000636437.1; ENST00000369070.5
External Link	RMBase: m6A_site_728908
mod ID: M6ASITE076392		Click to Show/Hide the Full List
mod site	chr6:106186518-106186519:-		[16]
Sequence	AGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; TIME; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000635758.2; ENST00000636437.1; ENST00000475645.1; ENST00000343245.7; ENST00000646025.1; ENST00000636335.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6
External Link	RMBase: m6A_site_728909
mod ID: M6ASITE076394		Click to Show/Hide the Full List
mod site	chr6:106186531-106186532:-		[18]
Sequence	GCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATC
Motif Score	2.595904762
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000635758.2; ENST00000369076.8; ENST00000343245.7; ENST00000360666.6; ENST00000369070.5; ENST00000475645.1; ENST00000636437.1; ENST00000646025.1; ENST00000636335.1
External Link	RMBase: m6A_site_728910
mod ID: M6ASITE076395		Click to Show/Hide the Full List
mod site	chr6:106186547-106186548:-		[15]
Sequence	TTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTAT
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000369070.5; ENST00000613993.1; ENST00000475645.1; ENST00000343245.7; ENST00000636437.1; ENST00000636335.1; ENST00000646025.1; ENST00000635758.2; ENST00000369076.8; ENST00000360666.6
External Link	RMBase: m6A_site_728911
mod ID: M6ASITE076396		Click to Show/Hide the Full List
mod site	chr6:106186554-106186555:-		[19]
Sequence	CTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGAT
Motif Score	2.053113095
Cell/Tissue List	brain; kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000475645.1; ENST00000343245.7; ENST00000360666.6; ENST00000635758.2; ENST00000636335.1; ENST00000636437.1; ENST00000646025.1; ENST00000613993.1; ENST00000369070.5; ENST00000369076.8
External Link	RMBase: m6A_site_728912
mod ID: M6ASITE076397		Click to Show/Hide the Full List
mod site	chr6:106186599-106186600:-		[16]
Sequence	CCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; U2OS; hNPCs; fibroblasts; A549; GM12878; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000635758.2; ENST00000369076.8; ENST00000646025.1; ENST00000475645.1; ENST00000613993.1; ENST00000360666.6; ENST00000369070.5; ENST00000636437.1; ENST00000636335.1; ENST00000343245.7
External Link	RMBase: m6A_site_728913
mod ID: M6ASITE076398		Click to Show/Hide the Full List
mod site	chr6:106186622-106186623:-		[16]
Sequence	GAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; U2OS; hNPCs; A549; GM12878
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000369076.8; ENST00000343245.7; ENST00000636437.1; ENST00000636335.1; ENST00000635758.2; ENST00000646025.1; ENST00000369070.5; ENST00000613993.1; ENST00000475645.1; ENST00000360666.6
External Link	RMBase: m6A_site_728914
mod ID: M6ASITE076399		Click to Show/Hide the Full List
mod site	chr6:106202020-106202021:-		[15]
Sequence	GCAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGA
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000369076.8; ENST00000476518.1; ENST00000360666.6; ENST00000635758.2; ENST00000613993.1; ENST00000636437.1; ENST00000369070.5; ENST00000646025.1; ENST00000636335.1; ENST00000343245.7; ENST00000475645.1
External Link	RMBase: m6A_site_728915
mod ID: M6ASITE076400		Click to Show/Hide the Full List
mod site	chr6:106202024-106202025:-		[14]
Sequence	GGCTGCAGATGGACAGTTGCACACACTAGGAGATCTCCTCA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000476518.1; ENST00000360666.6; ENST00000636335.1; ENST00000613993.1; ENST00000475645.1; ENST00000636437.1; ENST00000646025.1; ENST00000635758.2; ENST00000369070.5; ENST00000369076.8
External Link	RMBase: m6A_site_728916
mod ID: M6ASITE076401		Click to Show/Hide the Full List
mod site	chr6:106202088-106202089:-		[14]
Sequence	TTTTTTCCTTTTTCAAATAGACAACGACTGAAAGACCTTTC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000646025.1; ENST00000636437.1; ENST00000475645.1; ENST00000360666.6; ENST00000636335.1; ENST00000369076.8; ENST00000613993.1; ENST00000369070.5; ENST00000343245.7; ENST00000635758.2; ENST00000476518.1
External Link	RMBase: m6A_site_728917
mod ID: M6ASITE076402		Click to Show/Hide the Full List
mod site	chr6:106248209-106248210:-		[16]
Sequence	TTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000343245.7; ENST00000646025.1; ENST00000476518.1; ENST00000360666.6; ENST00000635758.2; ENST00000369076.8; ENST00000636335.1; ENST00000613993.1; ENST00000369070.5; ENST00000636437.1
External Link	RMBase: m6A_site_728919
mod ID: M6ASITE076404		Click to Show/Hide the Full List
mod site	chr6:106279689-106279690:-		[14]
Sequence	TGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369076.8; ENST00000369070.5; ENST00000636437.1; ENST00000360666.6; ENST00000635758.2; ENST00000476518.1; ENST00000646025.1; ENST00000613993.1; ENST00000343245.7; ENST00000636335.1
External Link	RMBase: m6A_site_728920
mod ID: M6ASITE076405		Click to Show/Hide the Full List
mod site	chr6:106279730-106279731:-		[16]
Sequence	AAAGAAGCTGATGCTTTAAAACATAAAAGTCAAGTAATCAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000646025.1; ENST00000369076.8; ENST00000613993.1; ENST00000360666.6; ENST00000476518.1; ENST00000636437.1; ENST00000635758.2; ENST00000369070.5; ENST00000636335.1
External Link	RMBase: m6A_site_728921
mod ID: M6ASITE076406		Click to Show/Hide the Full List
mod site	chr6:106279806-106279807:-		[16]
Sequence	ATAGAGTTTTCCAGAAAAAGACCTTCTGCACTGTCCATCTA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000613993.1; ENST00000635758.2; ENST00000369076.8; ENST00000360666.6; ENST00000646025.1; ENST00000343245.7; ENST00000636335.1; ENST00000369070.5; ENST00000636437.1; ENST00000476518.1
External Link	RMBase: m6A_site_728922
mod ID: M6ASITE076407		Click to Show/Hide the Full List
mod site	chr6:106293036-106293037:-		[15]
Sequence	CTTCCTTGGAACATCACAGTACATTTTAAGGTATAGTAAAT
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000360666.6; ENST00000613993.1; ENST00000636335.1; ENST00000369070.5; ENST00000343245.7; ENST00000646025.1; ENST00000636437.1; ENST00000635758.2; ENST00000369076.8
External Link	RMBase: m6A_site_728923
mod ID: M6ASITE076408		Click to Show/Hide the Full List
mod site	chr6:106293046-106293047:-		[16]
Sequence	AAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTAAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000343245.7; ENST00000636437.1; ENST00000613993.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6; ENST00000646025.1; ENST00000635758.2; ENST00000636335.1
External Link	RMBase: m6A_site_728924
mod ID: M6ASITE076409		Click to Show/Hide the Full List
mod site	chr6:106308371-106308372:-		[15]
Sequence	TTTGAATATGAAGGCACACCACTGAAATGGTGAGTGAATTT
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000636437.1; ENST00000636335.1; ENST00000635758.2; ENST00000369076.8; ENST00000343245.7; ENST00000613993.1; ENST00000369070.5; ENST00000360666.6; ENST00000646025.1
External Link	RMBase: m6A_site_728925
mod ID: M6ASITE076410		Click to Show/Hide the Full List
mod site	chr6:106308376-106308377:-		[14]
Sequence	TATGGTTTGAATATGAAGGCACACCACTGAAATGGTGAGTG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636335.1; ENST00000635758.2; ENST00000360666.6; ENST00000613993.1; ENST00000343245.7; ENST00000636437.1; ENST00000369076.8; ENST00000369070.5; ENST00000646025.1
External Link	RMBase: m6A_site_728926
mod ID: M6ASITE076411		Click to Show/Hide the Full List
mod site	chr6:106308450-106308451:-		[15]
Sequence	TTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000636335.1; ENST00000369070.5; ENST00000613993.1; ENST00000646025.1; ENST00000636437.1; ENST00000369076.8; ENST00000343245.7; ENST00000360666.6; ENST00000635758.2
External Link	RMBase: m6A_site_728927
mod ID: M6ASITE076412		Click to Show/Hide the Full List
mod site	chr6:106316197-106316198:-		[14]
Sequence	TCCTGGAAGAATGACAGATGACAAAGATGTGCTTCGAGATG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000646025.1; ENST00000613993.1; ENST00000635758.2; ENST00000636437.1; ENST00000369070.5; ENST00000369076.8; ENST00000360666.6; ENST00000636335.1; ENST00000343245.7
External Link	RMBase: m6A_site_728928
mod ID: M6ASITE076413		Click to Show/Hide the Full List
mod site	chr6:106316204-106316205:-		[15]
Sequence	CTTTAACTCCTGGAAGAATGACAGATGACAAAGATGTGCTT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000369070.5; ENST00000636437.1; ENST00000369076.8; ENST00000636335.1; ENST00000343245.7; ENST00000646025.1; ENST00000360666.6; ENST00000635758.2; ENST00000613993.1
External Link	RMBase: m6A_site_728929
mod ID: M6ASITE076415		Click to Show/Hide the Full List
mod site	chr6:106325631-106325632:-		[16]
Sequence	TGCTACCGCGTCCCCGCAGGACAGTGTGTCAGGCGGGCAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369076.8; ENST00000360666.6; ENST00000646025.1; ENST00000635758.2; ENST00000636335.1; ENST00000636437.1; ENST00000369070.5
External Link	RMBase: m6A_site_728930
mod ID: M6ASITE076416		Click to Show/Hide the Full List
mod site	chr6:106325786-106325787:-		[16]
Sequence	CGGGCGCCGAGGGTGACTGGACTTGTGGTGCGCTGCCAGGG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369070.5; ENST00000646025.1
External Link	RMBase: m6A_site_728931

Ref 1	Knockdown of METTL3 inhibits enterovirus 71-induced apoptosis of mouse Schwann cell through regulation of autophagy. Pathog Dis. 2021 Jul 28;79(6):ftab036. doi: 10.1093/femspd/ftab036.
Ref 2	RNA N6-methyladenosine: a new player in autophagy-mediated anti-cancer drug resistance. Br J Cancer. 2021 May;124(10):1621-1622. doi: 10.1038/s41416-021-01314-z. Epub 2021 Mar 15.
Ref 3	The mechanism of m(6)A methyltransferase METTL3-mediated autophagy in reversing gefitinib resistance in NSCLC cells by Beta-elemene. Cell Death Dis. 2020 Nov 11;11(11):969. doi: 10.1038/s41419-020-03148-8.
Ref 4	The m6A methyltransferase METTL3 regulates autophagy and sensitivity to cisplatin by targeting ATG5 in seminoma. Transl Androl Urol. 2021 Apr;10(4):1711-1722. doi: 10.21037/tau-20-1411.
Ref 5	m(6)A mRNA methylation controls autophagy and adipogenesis by targeting Atg5 and Atg7. Autophagy. 2020 Jul;16(7):1221-1235. doi: 10.1080/15548627.2019.1659617. Epub 2019 Aug 26.
Ref 6	Efflux transporters at the blood-brain barrier limit delivery and efficacy of cyclin-dependent kinase 4/6 inhibitor palbociclib (PD-0332991) in an orthotopic brain tumor model. J Pharmacol Exp Ther. 2015 Nov;355(2):264-71. doi: 10.1124/jpet.115.228213. Epub 2015 Sep 9.
Ref 7	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. Cell Death Dis. 2021 Feb 26;12(2):219. doi: 10.1038/s41419-021-03486-1.
Ref 8	FDA Label of Uptravi. The 2020 official website of the U.S. Food and Drug Administration.
Ref 9	Association of the ABCG2 C421A polymorphism with prostate cancer risk and survival. BJU Int. 2008 Dec;102(11):1694-9. doi: 10.1111/j.1464-410X.2008.07913.x. Epub 2008 Aug 14.
Ref 10	Raft nanodomains contribute to Akt/PKB plasma membrane recruitment and activation. Nat Chem Biol. 2008 Sep;4(9):538-47. doi: 10.1038/nchembio.103. Epub 2008 Jul 20.
Ref 11	A phase I dose escalation study with anti-CD44v6 bivatuzumab mertansine in patients with incurable squamous cell carcinoma of the head and neck or esophagus. Clin Cancer Res. 2006 Oct 15;12(20 Pt 1):6064-72. doi: 10.1158/1078-0432.CCR-06-0910.
Ref 12	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 13	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 16	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 17	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 18	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 19	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map