m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00112)

Target Name	ZNFX1 antisense RNA 1 (ZFAS1)
Synonyms	ZFAS1; C20orf199NCRNA00275ZNFX1-AS1; chromosome 20 open reading frame 199; non-protein coding RNA 275; ZNFX1 antisense RNA 1 (non-protein coding); HSUP1; HSUP2 Click to Show/Hide
Gene Name	ZFAS1
Chromosomal Location	20q13.13
Family	Small nucleolar RNA non-coding host genes; Long non-coding RNAs with non-systematic symbols
Gene ID	441951
HGNC ID	HGNC:33101

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ZFAS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RIP-seq result supporting the interaction between ZFAS1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 3.61E+00	GSE60213

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockout of METTL3 can reduce the total expression of ZNFX1 antisense RNA 1 (ZFAS1). ZFAS1 is used as an oncogenic lncRNA, which can promote NPCcell proliferation, migration and tumor growth.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell autophagy
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
	S26	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0UB
	S18	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0U9
	NP69 (A human immortalized nasopharyngeal epithelial)
	N2Tert (The human immortalized nasopharyngeal epithelial cell lines)
	HONE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_8706
	HNE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_0308
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
	CNE-1	Normal	Homo sapiens	CVCL_6888
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	6-10B	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C529
In-vivo Model	Female BALB/c nude mice (ages 4-5 weeks, 18-20 g) were purchased from the Charles River Laboratories. For the tumor growth model, 1 × 10⁶ HONE-1 sh-NC or sh-ZFAS1 cells were injected into the axilla of the mice, and the tumor size was measured every 3 days. On day 30, the mice were killed, and the tumors were dissected and weighed.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	ZNFX1 antisense RNA 1 (ZFAS1) sequestered miR-647, and this RNA-RNA interaction is regulated by METLL3-mediated m6A modification in cervical cancer.
Responsed Disease	Cervical cancer		ICD-11: 2C77	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	C-33 A	Cervical squamous cell carcinoma	Homo sapiens	CVCL_1094
	Ca Ski	Cervical squamous cell carcinoma	Homo sapiens	CVCL_1100
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
In-vivo Model	Nude mice were subjected to a subcutaneous injection of 5× 10⁶ control and ZFAS1 silencing CaSki cells suspended in 0.2 mL DMEM medium.

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	The critical modulation network underlying m6A readers stabilizes lncRNAs, and they jointly promote mitochondrial energy metabolism in the pathogenesis of colorectal cancer. N6-methyladenosine reader stabilizes the ZFAS1/OLA1 axis. Thus, direct interaction between the KH3-4 domain of IMP2 and ZFAS1 where IMP2 serves as a reader for m6A-modified ZFAS1 and promotes the RNA stability of ZFAS1 is critical for CRC development.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Cell Process	Warburg effect
Cell Process	Mitochondrial energy metabolism
In-vitro Model	Caco-2	Colon adenocarcinoma	Homo sapiens	CVCL_0025
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HIEC (Normal intestinal epithelial cells)
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockout of METTL3 can reduce the total expression of ZNFX1 antisense RNA 1 (ZFAS1). ZFAS1 is used as an oncogenic lncRNA, which can promote NPCcell proliferation, migration and tumor growth.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell autophagy
In-vitro Model	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
	S26	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0UB
	S18	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0U9
	NP69 (A human immortalized nasopharyngeal epithelial)
	N2Tert (The human immortalized nasopharyngeal epithelial cell lines)
	HONE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_8706
	HNE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_0308
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
	CNE-1	Normal	Homo sapiens	CVCL_6888
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	6-10B	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C529
In-vivo Model	Female BALB/c nude mice (ages 4-5 weeks, 18-20 g) were purchased from the Charles River Laboratories. For the tumor growth model, 1 × 10⁶ HONE-1 sh-NC or sh-ZFAS1 cells were injected into the axilla of the mice, and the tumor size was measured every 3 days. On day 30, the mice were killed, and the tumors were dissected and weighed.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	The critical modulation network underlying m6A readers stabilizes lncRNAs, and they jointly promote mitochondrial energy metabolism in the pathogenesis of colorectal cancer. N6-methyladenosine reader stabilizes the ZFAS1/OLA1 axis. Thus, direct interaction between the KH3-4 domain of IMP2 and ZFAS1 where IMP2 serves as a reader for m6A-modified ZFAS1 and promotes the RNA stability of ZFAS1 is critical for CRC development.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Warburg effect
Cell Process	Mitochondrial energy metabolism
In-vitro Model	Caco-2	Colon adenocarcinoma	Homo sapiens	CVCL_0025
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HIEC (Normal intestinal epithelial cells)
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Cervical cancer [ICD-11: 2C77]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	ZNFX1 antisense RNA 1 (ZFAS1) sequestered miR-647, and this RNA-RNA interaction is regulated by METLL3-mediated m6A modification in cervical cancer.
Responsed Disease	Cervical cancer [ICD-11: 2C77]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	C-33 A	Cervical squamous cell carcinoma	Homo sapiens	CVCL_1094
	Ca Ski	Cervical squamous cell carcinoma	Homo sapiens	CVCL_1100
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
In-vivo Model	Nude mice were subjected to a subcutaneous injection of 5× 10⁶ control and ZFAS1 silencing CaSki cells suspended in 0.2 mL DMEM medium.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03504		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Cervical cancer	Disease Info
Crosstalk ID: M6ACROT03517		Crosstalk Info
Epigenetic Regulator	WD repeat-containing protein 5 (WDR5)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Cervical cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05452		Crosstalk Info
Epigenetic Regulator	ZNFX1 antisense RNA 1 (ZFAS1)
Regulated Target	MicroRNA 647 (MIR647)
Crosstalk relationship	m6A → ncRNA
Disease	Cervical cancer	Disease Info
Crosstalk ID: M6ACROT05627		Crosstalk Info
Epigenetic Regulator	ZNFX1 antisense RNA 1 (ZFAS1)
Regulated Target	hsa-miR-100-3p
Crosstalk relationship	m6A → ncRNA
Disease	Nasopharyngeal carcinoma	Disease Info

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05455		Crosstalk Info
Epigenetic Regulator	ZNFX1 antisense RNA 1 (ZFAS1)
Regulated Target	Ras-related protein Rab-22A (RAB22A)
Crosstalk relationship	m6A → ncRNA
Disease	Atherosclerosis	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05537		Crosstalk Info
Epigenetic Regulator	ZNFX1 antisense RNA 1 (ZFAS1)
Regulated Target	Obg-like ATPase 1 (OLA1)
Crosstalk relationship	m6A → ncRNA
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00112)

ZNFX1 antisense RNA 1 (ZFAS1)

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002725		Click to Show/Hide the Full List
mod site	chr20:49278672-49278673:+		[5]
Sequence	GCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000428008.5; ENST00000450535.5; ENST00000326677.9; ENST00000620594.1; ENST00000458653.5; ENST00000417721.5; ENST00000371743.7; ENST00000441722.5
External Link	RMBase: m5C_site_29227
mod ID: M5CSITE002726		Click to Show/Hide the Full List
mod site	chr20:49289179-49289180:+		[5]
Sequence	TGAGTTTAAAAGGCTGTGCCCACTTCAAGAATGTCATTGTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000417721.5; ENST00000326677.9; ENST00000441722.5; ENST00000458653.5; ENST00000620594.1; ENST00000450535.5; ENST00000428008.5; ENST00000371743.7
External Link	RMBase: m5C_site_29228

N6-methyladenosine (m6A)

In total 21 m6A sequence/site(s) in this target gene
mod ID: M6ASITE053460		Click to Show/Hide the Full List
mod site	chr20:49278311-49278312:+		[6]
Sequence	GGCGCGGCTGAGGGGAGCGGACCGCGGGGGGCGGGAGATGA
Motif Score	3.622404762
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000441722.5; ENST00000450535.5; ENST00000458653.5; ENST00000417721.5; ENST00000371743.7
External Link	RMBase: m6A_site_535754
mod ID: M6ASITE053461		Click to Show/Hide the Full List
mod site	chr20:49278380-49278381:+		[7]
Sequence	CCGGCCCCAGAGGAAGGGGAACCCGTCGAGCGGTTTGGTGC
Motif Score	2.930744048
Cell/Tissue List	MT4; GSC-11
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000450535.5; ENST00000417721.5; ENST00000441722.5; ENST00000371743.7; ENST00000458653.5
External Link	RMBase: m6A_site_535755
mod ID: M6ASITE053462		Click to Show/Hide the Full List
mod site	chr20:49278430-49278431:+		[7]
Sequence	GCGACATGGCGAGGAAGCGGACAAGCCCGGGTGGCCCGGCG
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000615787.1; ENST00000417721.5; ENST00000371743.7; ENST00000441722.5; ENST00000450535.5; ENST00000458653.5
External Link	RMBase: m6A_site_535757
mod ID: M6ASITE053463		Click to Show/Hide the Full List
mod site	chr20:49278487-49278488:+		[7]
Sequence	CGGGGCTAGACGCGGCCTGGACAACTACTAGAGCGCCTCGG
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000417721.5; ENST00000441722.5; ENST00000615787.1; ENST00000458653.5; ENST00000450535.5; ENST00000371743.7
External Link	RMBase: m6A_site_535758
mod ID: M6ASITE053464		Click to Show/Hide the Full List
mod site	chr20:49278523-49278524:+		[7]
Sequence	CTCGGGCTGTGCTGCTCGAGACTACATTTCCCAGAGCGACG
Motif Score	3.319380952
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000371743.7; ENST00000441722.5; ENST00000458653.5; ENST00000615787.1; ENST00000417721.5; ENST00000450535.5
External Link	RMBase: m6A_site_535759
mod ID: M6ASITE053465		Click to Show/Hide the Full List
mod site	chr20:49279180-49279181:+		[8]
Sequence	TCCAAGGAAGCCACGTGCAGACATCTACAACCTTCGATCTC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; HepG2
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000326677.9; ENST00000441722.5; ENST00000610973.1; ENST00000620594.1; ENST00000450535.5; ENST00000417721.5; ENST00000458653.5; ENST00000428008.5; ENST00000371743.7; ENST00000623640.1
External Link	RMBase: m6A_site_535760
mod ID: M6ASITE053466		Click to Show/Hide the Full List
mod site	chr20:49279186-49279187:+		[9]
Sequence	GAAGCCACGTGCAGACATCTACAACCTTCGATCTCCTGACG
Motif Score	2.078666667
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000450535.5; ENST00000371743.7; ENST00000326677.9; ENST00000620594.1; ENST00000610973.1; ENST00000458653.5; ENST00000428008.5; ENST00000441722.5; ENST00000417721.5; ENST00000623640.1
External Link	RMBase: m6A_site_535761
mod ID: M6ASITE053467		Click to Show/Hide the Full List
mod site	chr20:49280501-49280502:+		[9]
Sequence	CAGGTTTATTGTTGGCCAAAACCAGGCTTTGATTGAACCAG
Motif Score	2.185083333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000623640.1; ENST00000371743.7; ENST00000417721.5; ENST00000326677.9; ENST00000615977.1; ENST00000458653.5; ENST00000428008.5; ENST00000620594.1; ENST00000450535.5; ENST00000441722.5
External Link	RMBase: m6A_site_535762
mod ID: M6ASITE053468		Click to Show/Hide the Full List
mod site	chr20:49280517-49280518:+		[9]
Sequence	CAAAACCAGGCTTTGATTGAACCAGGATGAATGCGGGTGTT
Motif Score	2.930744048
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000615977.1; ENST00000428008.5; ENST00000417721.5; ENST00000450535.5; ENST00000326677.9; ENST00000371743.7; ENST00000620594.1; ENST00000623640.1; ENST00000441722.5; ENST00000458653.5
External Link	RMBase: m6A_site_535763
mod ID: M6ASITE053469		Click to Show/Hide the Full List
mod site	chr20:49280557-49280558:+		[8]
Sequence	TGGAAGTAGAATATATATATACATATAAAATTGGTAAGTGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620594.1; ENST00000615977.1; ENST00000417721.5; ENST00000623640.1; ENST00000458653.5; ENST00000450535.5; ENST00000441722.5; ENST00000428008.5; ENST00000326677.9; ENST00000371743.7
External Link	RMBase: m6A_site_535764
mod ID: M6ASITE053470		Click to Show/Hide the Full List
mod site	chr20:49280818-49280819:+		[10]
Sequence	TCTGCTTATCTTTATCAGAGACTATTGCTTGTTCATGGGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000428008.5; ENST00000620594.1; ENST00000371743.7; ENST00000326677.9; ENST00000441722.5; ENST00000417721.5; ENST00000450535.5; ENST00000458653.5; ENST00000623640.1
External Link	RMBase: m6A_site_535765
mod ID: M6ASITE053471		Click to Show/Hide the Full List
mod site	chr20:49280838-49280839:+		[10]
Sequence	ACTATTGCTTGTTCATGGGAACTGGGCTTTCTCTATTTTTT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000428008.5; ENST00000458653.5; ENST00000623640.1; ENST00000326677.9; ENST00000417721.5; ENST00000441722.5; ENST00000450535.5; ENST00000620594.1; ENST00000371743.7
External Link	RMBase: m6A_site_535766
mod ID: M6ASITE053472		Click to Show/Hide the Full List
mod site	chr20:49280991-49280992:+		[10]
Sequence	TTCTGCTTTCTATCTGCCAAACCCCACCGCAAAATTTGTCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000417721.5; ENST00000441722.5; ENST00000623640.1; ENST00000450535.5; ENST00000326677.9; ENST00000428008.5; ENST00000620594.1; ENST00000458653.5; ENST00000371743.7
External Link	RMBase: m6A_site_535767
mod ID: M6ASITE053473		Click to Show/Hide the Full List
mod site	chr20:49281031-49281032:+		[10]
Sequence	CAACTGGGCCTAACCTCAGGACCCATTTCCAAGTTGGGTAT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000371743.7; ENST00000428008.5; ENST00000441722.5; ENST00000326677.9; ENST00000458653.5; ENST00000417721.5; ENST00000450535.5; ENST00000623640.1; ENST00000620594.1
External Link	RMBase: m6A_site_535768
mod ID: M6ASITE053474		Click to Show/Hide the Full List
mod site	chr20:49281055-49281056:+		[10]
Sequence	ATTTCCAAGTTGGGTATAAAACTGGGAGAATAAGTCATTAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000441722.5; ENST00000620594.1; ENST00000450535.5; ENST00000623640.1; ENST00000371743.7; ENST00000458653.5; ENST00000326677.9; ENST00000417721.5; ENST00000428008.5
External Link	RMBase: m6A_site_535769
mod ID: M6ASITE053475		Click to Show/Hide the Full List
mod site	chr20:49281155-49281156:+		[10]
Sequence	CAAAGAAAACGAGCACTTGAACAAAAGATTTCTCAGCAAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458653.5; ENST00000428008.5; ENST00000450535.5; ENST00000417721.5; ENST00000371743.7; ENST00000620594.1; ENST00000441722.5; ENST00000623640.1; ENST00000326677.9
External Link	RMBase: m6A_site_535770
mod ID: M6ASITE053476		Click to Show/Hide the Full List
mod site	chr20:49289088-49289089:+		[11]
Sequence	AGCCCTCTGGAAAGAAAAGGACAGACCCTGTGCTTTCATGA
Motif Score	3.643047619
Cell/Tissue List	brain; liver; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000450535.5; ENST00000620594.1; ENST00000371743.7; ENST00000458653.5; ENST00000428008.5; ENST00000326677.9; ENST00000441722.5; ENST00000417721.5
External Link	RMBase: m6A_site_535771
mod ID: M6ASITE053477		Click to Show/Hide the Full List
mod site	chr20:49289127-49289128:+		[10]
Sequence	GAAAGTGAAGATCTGGCTGAACCAGTTCCACAAGGTTACTG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000417721.5; ENST00000620594.1; ENST00000441722.5; ENST00000458653.5; ENST00000371743.7; ENST00000326677.9; ENST00000450535.5; ENST00000428008.5
External Link	RMBase: m6A_site_535772
mod ID: M6ASITE053478		Click to Show/Hide the Full List
mod site	chr20:49289136-49289137:+		[8]
Sequence	GATCTGGCTGAACCAGTTCCACAAGGTTACTGTATACATAG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000428008.5; ENST00000326677.9; ENST00000450535.5; ENST00000441722.5; ENST00000417721.5; ENST00000371743.7; ENST00000458653.5; ENST00000620594.1
External Link	RMBase: m6A_site_535773
mod ID: M6ASITE053479		Click to Show/Hide the Full List
mod site	chr20:49289151-49289152:+		[8]
Sequence	GTTCCACAAGGTTACTGTATACATAGCCTGAGTTTAAAAGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000450535.5; ENST00000417721.5; ENST00000620594.1; ENST00000428008.5; ENST00000458653.5; ENST00000441722.5; ENST00000371743.7; ENST00000326677.9
External Link	RMBase: m6A_site_535774
mod ID: M6ASITE053480		Click to Show/Hide the Full List
mod site	chr20:49289202-49289203:+		[10]
Sequence	TTCAAGAATGTCATTGTTAGACTTTGAAATTTCTAACTGCC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000458653.5; ENST00000620594.1; ENST00000428008.5; ENST00000417721.5; ENST00000450535.5; ENST00000326677.9; ENST00000371743.7; ENST00000441722.5
External Link	RMBase: m6A_site_535775

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000261		Click to Show/Hide the Full List
mod site	chr20:49289102-49289103:+		[12]
Sequence	AAAAGGACAGACCCTGTGCTTTCATGAAAGTGAAGATCTGG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000417721.5; ENST00000441722.5; ENST00000620594.1; ENST00000326677.9; ENST00000371743.7; ENST00000428008.5; ENST00000458653.5; ENST00000450535.5
External Link	RMBase: Nm_site_3537

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000160		Click to Show/Hide the Full List
mod site	chr20:49279132-49279133:+		[13]
Sequence	GCCAGCGGGTACAGAATGGATTTTGGAAGAGGGAGTCACCA
Transcript ID List	ENST00000450535.5; ENST00000428008.5; ENST00000458653.5; ENST00000610973.1; ENST00000326677.9; ENST00000371743.7; ENST00000417721.5; ENST00000441722.5; ENST00000620594.1
External Link	RMBase: Pseudo_site_2934

Ref 1	The m6A methyltransferase METTL3 affects autophagy and progression of nasopharyngeal carcinoma by regulating the stability of lncRNA ZFAS1. Infect Agent Cancer. 2022 Jan 3;17(1):1. doi: 10.1186/s13027-021-00411-1.
Ref 2	ZFAS1 Exerts an Oncogenic Role via Suppressing miR-647 in an m(6)A-Dependent Manner in Cervical Cancer. Onco Targets Ther. 2020 Nov 17;13:11795-11806. doi: 10.2147/OTT.S274492. eCollection 2020.
Ref 3	N6-methyladenosine reader IMP2 stabilizes the ZFAS1/OLA1 axis and activates the Warburg effect: implication in colorectal cancer. J Hematol Oncol. 2021 Nov 7;14(1):188. doi: 10.1186/s13045-021-01204-0.
Ref 4	METTL14 mediated m6A modification to LncRNA ZFAS1/ RAB22A: A novel therapeutic target for atherosclerosis. Int J Cardiol. 2021 Apr 1;328:177. doi: 10.1016/j.ijcard.2020.12.002. Epub 2020 Dec 8.
Ref 5	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 6	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 7	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 12	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 13	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map