General Information of the m6A Target Gene (ID: M6ATAR01635)
Target Name Polycomb protein EED (EED)
Synonyms
hEED; Embryonic ectoderm development protein; WD protein associating with integrin cytoplasmic tails 1; WAIT-1
    Click to Show/Hide
Gene Name EED
Chromosomal Location 11q14.2
Family WD repeat ESC family
Function
Polycomb group (PcG) protein. Component of the PRC2/EED-EZH2 complex, which methylates 'Lys-9' and 'Lys-27' of histone H3, leading to transcriptional repression of the affected target gene. Also recognizes 'Lys-26' trimethylated histone H1 with the effect of inhibiting PRC2 complex methyltransferase activity on nucleosomal histone H3 'Lys-27', whereas H3 'Lys-27' recognition has the opposite effect, enabling the propagation of this repressive mark. The PRC2/EED-EZH2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems. Genes repressed by the PRC2/EED-EZH2 complex include HOXC8, HOXA9, MYT1 and CDKN2A.
    Click to Show/Hide
Gene ID 8726
Uniprot ID
EED_HUMAN
HGNC ID
HGNC:3188
KEGG ID
hsa:8726
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03165
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship m6A → Histone modification
m6A Regulator: YTH domain-containing protein 1 (YTHDC1)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03178
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship m6A → Histone modification
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01635)
Polycomb protein EED (EED)
Adenosine-to-Inosine editing (A-to-I)
In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005142 Click to Show/Hide the Full List
mod site chr11:86263734-86263735:+ [2]
Sequence CCTGTTTCTGGAGACTGGGAAGTCCAAGAACATGGTGCCGG
Transcript ID List ENST00000528180.5; ENST00000534595.1; ENST00000525244.5; ENST00000263360.11; ENST00000327320.8; ENST00000351625.10
External Link RMBase: RNA-editing_site_24566
mod ID: A2ISITE005143 Click to Show/Hide the Full List
mod site chr11:86263766-86263767:+ [2]
Sequence TGGTGCCGGCATCTGGTGAGAGCCTTCATGCTGAATCGTCT
Transcript ID List ENST00000528180.5; ENST00000263360.11; ENST00000534595.1; ENST00000525244.5; ENST00000327320.8; ENST00000351625.10
External Link RMBase: RNA-editing_site_24567
mod ID: A2ISITE005144 Click to Show/Hide the Full List
mod site chr11:86263792-86263793:+ [2]
Sequence CATGCTGAATCGTCTCAGCAAAAGGGCAGGAGAGGGTGTGA
Transcript ID List ENST00000534595.1; ENST00000525244.5; ENST00000351625.10; ENST00000263360.11; ENST00000327320.8; ENST00000528180.5
External Link RMBase: RNA-editing_site_24568
mod ID: A2ISITE005145 Click to Show/Hide the Full List
mod site chr11:86263793-86263794:+ [2]
Sequence ATGCTGAATCGTCTCAGCAAAAGGGCAGGAGAGGGTGTGAG
Transcript ID List ENST00000327320.8; ENST00000351625.10; ENST00000528180.5; ENST00000525244.5; ENST00000534595.1; ENST00000263360.11
External Link RMBase: RNA-editing_site_24569
mod ID: A2ISITE005146 Click to Show/Hide the Full List
mod site chr11:86263794-86263795:+ [2]
Sequence TGCTGAATCGTCTCAGCAAAAGGGCAGGAGAGGGTGTGAGG
Transcript ID List ENST00000327320.8; ENST00000528180.5; ENST00000263360.11; ENST00000534595.1; ENST00000525244.5; ENST00000351625.10
External Link RMBase: RNA-editing_site_24570
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005323 Click to Show/Hide the Full List
mod site chr11:86266150-86266151:+ [3]
Sequence TCTCTTAAACTTTGGAGGATCAATTCAAAGAGAATGATGAA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000525244.5; ENST00000351625.10; ENST00000533228.1; ENST00000263360.11; ENST00000534564.5; ENST00000528180.5; ENST00000327320.8; ENST00000534595.1
External Link RMBase: m5C_site_8820
N6-methyladenosine (m6A)
In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE007970 Click to Show/Hide the Full List
mod site chr11:86244761-86244762:+ [4]
Sequence TGGTGTAGCCCATTCCACAGACTTTCGCTCCCTAGCAGCGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; A549; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158462
mod ID: M6ASITE007971 Click to Show/Hide the Full List
mod site chr11:86244897-86244898:+ [4]
Sequence AGGCGGTGGTGGGAAGGGAGACATACTTAATACTGCCCTCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000528180.5; ENST00000263360.11
External Link RMBase: m6A_site_158463
mod ID: M6ASITE007972 Click to Show/Hide the Full List
mod site chr11:86244925-86244926:+ [5]
Sequence AATACTGCCCTCTTAATCCAACGGACCTTACATCGTGTAGA
Motif Score 2.147845238
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158464
mod ID: M6ASITE007973 Click to Show/Hide the Full List
mod site chr11:86244929-86244930:+ [4]
Sequence CTGCCCTCTTAATCCAACGGACCTTACATCGTGTAGACTGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158465
mod ID: M6ASITE007974 Click to Show/Hide the Full List
mod site chr11:86244934-86244935:+ [6]
Sequence CTCTTAATCCAACGGACCTTACATCGTGTAGACTGCCGGGA
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158466
mod ID: M6ASITE007975 Click to Show/Hide the Full List
mod site chr11:86244945-86244946:+ [4]
Sequence ACGGACCTTACATCGTGTAGACTGCCGGGAGGGCGGCGGGA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158467
mod ID: M6ASITE007976 Click to Show/Hide the Full List
mod site chr11:86245207-86245208:+ [4]
Sequence CCCCGCCCCAGGCGGCAGGAACCTGGAGGGAGGCGGAGGAA
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; U2OS; MT4; A549; MM6; Jurkat; CD4T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000263360.11; ENST00000528180.5; ENST00000327320.8
External Link RMBase: m6A_site_158468
mod ID: M6ASITE007977 Click to Show/Hide the Full List
mod site chr11:86245265-86245266:+ [4]
Sequence TGTCGACTGCGCCGGCGGGAACAGACATGCCTGCGGCCAAG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; U2OS; MT4; A549; MM6; Huh7; Jurkat; CD4T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534595.1; ENST00000327320.8; ENST00000528180.5; ENST00000351625.10; ENST00000263360.11
External Link RMBase: m6A_site_158469
mod ID: M6ASITE007978 Click to Show/Hide the Full List
mod site chr11:86245269-86245270:+ [7]
Sequence GACTGCGCCGGCGGGAACAGACATGCCTGCGGCCAAGAAGC
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000327320.8; ENST00000528180.5; ENST00000525244.5; ENST00000534595.1; ENST00000351625.10; ENST00000263360.11
External Link RMBase: m6A_site_158470
mod ID: M6ASITE007979 Click to Show/Hide the Full List
mod site chr11:86245311-86245312:+ [4]
Sequence GAAGCTGAGCAGTGACGAGAACAGCAATCCAGACCTCTCTG
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; U2OS; fibroblasts; MT4; A549; MM6; Huh7; Jurkat; CD4T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000525244.5; ENST00000351625.10; ENST00000534595.1; ENST00000327320.8; ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158471
mod ID: M6ASITE007980 Click to Show/Hide the Full List
mod site chr11:86245323-86245324:+ [4]
Sequence TGACGAGAACAGCAATCCAGACCTCTCTGGAGACGAGAATG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; U2OS; fibroblasts; A549; MM6; Huh7; Jurkat; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534595.1; ENST00000327320.8; ENST00000528180.5; ENST00000525244.5; ENST00000263360.11; ENST00000351625.10
External Link RMBase: m6A_site_158472
mod ID: M6ASITE007981 Click to Show/Hide the Full List
mod site chr11:86250322-86250323:+ [7]
Sequence CTGTCAGTATAGAAAGTGGTACAAACACTGAACGCCCTGAT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000327320.8; ENST00000525244.5; ENST00000263360.11; ENST00000351625.10; ENST00000534595.1; ENST00000528180.5
External Link RMBase: m6A_site_158473
mod ID: M6ASITE007982 Click to Show/Hide the Full List
mod site chr11:86250326-86250327:+ [4]
Sequence CAGTATAGAAAGTGGTACAAACACTGAACGCCCTGATACAC
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; U2OS; fibroblasts; LCLs; A549; MM6; Huh7; Jurkat
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534595.1; ENST00000528180.5; ENST00000351625.10; ENST00000263360.11; ENST00000327320.8; ENST00000525244.5
External Link RMBase: m6A_site_158474
mod ID: M6ASITE007983 Click to Show/Hide the Full List
mod site chr11:86250353-86250354:+ [4]
Sequence ACGCCCTGATACACCTACAAACACGCCAAATGCACCTGGAA
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T; U2OS; LCLs; Huh7
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000534595.1; ENST00000263360.11; ENST00000525244.5; ENST00000528180.5; ENST00000351625.10; ENST00000327320.8
External Link RMBase: m6A_site_158475
mod ID: M6ASITE007984 Click to Show/Hide the Full List
mod site chr11:86255244-86255245:+ [7]
Sequence ACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000327320.8; ENST00000534595.1; ENST00000528180.5; ENST00000263360.11; ENST00000525244.5; ENST00000351625.10
External Link RMBase: m6A_site_158476
mod ID: M6ASITE007985 Click to Show/Hide the Full List
mod site chr11:86256402-86256403:+ [7]
Sequence TTAGGCTGATGAAAACTTTTACACTTGTGCATGGACCTATG
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000528180.5; ENST00000263360.11; ENST00000534595.1; ENST00000327320.8; ENST00000525244.5; ENST00000351625.10
External Link RMBase: m6A_site_158477
mod ID: M6ASITE007986 Click to Show/Hide the Full List
mod site chr11:86256494-86256495:+ [7]
Sequence TTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGGTG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000263360.11; ENST00000351625.10; ENST00000525244.5; ENST00000528180.5; ENST00000534595.1; ENST00000327320.8
External Link RMBase: m6A_site_158478
mod ID: M6ASITE007987 Click to Show/Hide the Full List
mod site chr11:86263172-86263173:+ [8]
Sequence CTGAGACCTCACTGAATGAGACCAACCTCATTCTGTCTGAG
Motif Score 2.876744048
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000263360.11; ENST00000327320.8; ENST00000528180.5; ENST00000351625.10; ENST00000525244.5; ENST00000534595.1
External Link RMBase: m6A_site_158479
mod ID: M6ASITE007988 Click to Show/Hide the Full List
mod site chr11:86264204-86264205:+ [7]
Sequence ATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000327320.8; ENST00000534564.5; ENST00000351625.10; ENST00000525244.5; ENST00000534595.1; ENST00000533228.1; ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158480
mod ID: M6ASITE007989 Click to Show/Hide the Full List
mod site chr11:86268502-86268503:+ [7]
Sequence TCCTGATTTTTCTACCAGAGACATACATAGGAATTATGTTG
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000534595.1; ENST00000525244.5; ENST00000351625.10; ENST00000534564.5; ENST00000528180.5; ENST00000263360.11; ENST00000524673.2; ENST00000327320.8; ENST00000533228.1
External Link RMBase: m6A_site_158481
mod ID: M6ASITE007990 Click to Show/Hide the Full List
mod site chr11:86268506-86268507:+ [7]
Sequence GATTTTTCTACCAGAGACATACATAGGAATTATGTTGATTG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000351625.10; ENST00000327320.8; ENST00000533228.1; ENST00000263360.11; ENST00000534595.1; ENST00000525244.5; ENST00000528180.5; ENST00000534564.5; ENST00000524673.2
External Link RMBase: m6A_site_158482
mod ID: M6ASITE007991 Click to Show/Hide the Full List
mod site chr11:86277106-86277107:+ [7]
Sequence CAGCCAGTGTGACATTTGGTACATGAGGTTTTCTATGGATT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000534564.5; ENST00000263360.11; ENST00000524673.2; ENST00000327320.8; ENST00000528250.1; ENST00000534595.1; ENST00000525244.5; ENST00000528180.5; ENST00000527888.1; ENST00000351625.10
External Link RMBase: m6A_site_158483
mod ID: M6ASITE007992 Click to Show/Hide the Full List
mod site chr11:86278402-86278403:+ [7]
Sequence CATGTTTTTTCCCTAGATGTACAACACTGACTCATCATAAA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000527888.1; ENST00000524673.2; ENST00000534564.5; ENST00000351625.10; ENST00000263360.11; ENST00000528180.5; ENST00000528250.1; ENST00000327320.8
External Link RMBase: m6A_site_158484
mod ID: M6ASITE007993 Click to Show/Hide the Full List
mod site chr11:86278515-86278516:+ [6]
Sequence AGTATTTGGCGCTGGGATCGACTTCGATAAAATACTTTTGC
Motif Score 3.287565476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000327320.8; ENST00000351625.10; ENST00000527888.1; ENST00000263360.11; ENST00000528250.1; ENST00000534564.5; ENST00000524673.2; ENST00000528180.5
External Link RMBase: m6A_site_158485
mod ID: M6ASITE007994 Click to Show/Hide the Full List
mod site chr11:86278666-86278667:+ [7]
Sequence AGCTGAATGTAGTGATGTTTACATTGTTTACATTCTTTGTA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000527888.1; ENST00000327320.8; ENST00000528250.1; ENST00000351625.10; ENST00000263360.11; ENST00000528180.5
External Link RMBase: m6A_site_158486