m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00873)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Fat mass and obesity-associated protein (FTO)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05244 | ||
| Epigenetic Regulator | hsa-miR-607 | |
| Regulated Target | FTO alpha-ketoglutarate dependent dioxygenase (FTO) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Non-small cell lung cancer | |
| Drug | VS-6063 | |
| Crosstalk ID: M6ACROT05258 | ||
| Epigenetic Regulator | hsa_circ_0072309 (Circ_LIFR) | |
| Regulated Target | hsa-miR-607 | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Non-small cell lung cancer | |
| Drug | VS-6063 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00873)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE047813 | Click to Show/Hide the Full List | ||
| mod site | chr2:162243361-162243362:- | [2] | |
| Sequence | CAGTGACCCACGCTCTGAAGACAGAATTAGCTAACTTTCAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000493182.1; ENST00000443424.5; ENST00000480838.1; ENST00000188790.9 | ||
| External Link | RMBase: m6A_site_497486 | ||
| mod ID: M6ASITE047814 | Click to Show/Hide the Full List | ||
| mod site | chr2:162243416-162243417:- | [2] | |
| Sequence | TTCAGCTTCCAACTACAAAGACAGACTTGGTCCTTTTCAAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000443424.5; ENST00000188790.9; ENST00000493182.1 | ||
| External Link | RMBase: m6A_site_497487 | ||
| mod ID: M6ASITE047815 | Click to Show/Hide the Full List | ||
| mod site | chr2:162243449-162243450:- | [2] | |
| Sequence | AAGTCCGTGGAAAGAAAAAAACCTTGTCCTGGCTTCAGCTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000493182.1; ENST00000443424.5 | ||
| External Link | RMBase: m6A_site_497488 | ||
| mod ID: M6ASITE047816 | Click to Show/Hide the Full List | ||
| mod site | chr2:162243487-162243488:- | [2] | |
| Sequence | TTTTACAGAAATCTTTTGAAACTTGGCACGGTATTCAAAAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000493182.1 | ||
| External Link | RMBase: m6A_site_497489 | ||
References