m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00673)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SVIL-AS1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RIP-seq result supporting the interaction between SVIL-AS1 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 9.54E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The reduction in cell proliferation induced by SVIL antisense RNA 1 (SVIL-AS1) overexpression could be rescued by E2F1 overexpression or METTL3 knockdown. In conclusion, METTL3-induced SVIL-AS1 in LUAD, which connects m6A and lncRNA in lung cancer carcinogenesis. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Lung cancer | ICD-11: 2C25 | ||
| In-vitro Model | NCI-H1650 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1483 |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| In-vivo Model | A549 cells (1 × 106 cells) were intraperitoneally injected into the abdomen of nude mice. Tumor length and width were measured and recorded every 4 days after inoculation. Tumor volume was calculated as 1/2 × length × width2. The tumor weight was weighed and recorded 20 days after inoculation. | |||
Lung cancer [ICD-11: 2C25]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The reduction in cell proliferation induced by SVIL antisense RNA 1 (SVIL-AS1) overexpression could be rescued by E2F1 overexpression or METTL3 knockdown. In conclusion, METTL3-induced SVIL-AS1 in LUAD, which connects m6A and lncRNA in lung cancer carcinogenesis. | |||
| Responsed Disease | Lung cancer [ICD-11: 2C25] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| In-vitro Model | NCI-H1650 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1483 |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| In-vivo Model | A549 cells (1 × 106 cells) were intraperitoneally injected into the abdomen of nude mice. Tumor length and width were measured and recorded every 4 days after inoculation. Tumor volume was calculated as 1/2 × length × width2. The tumor weight was weighed and recorded 20 days after inoculation. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 4 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT02152 | ||
| Epigenetic Regulator | Cysteine methyltransferase DNMT3A (DNMT3A) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Lung cancer | |
| Drug | Metformin | |
| Crosstalk ID: M6ACROT02165 | ||
| Epigenetic Regulator | DNA (cytosine-5)-methyltransferase 3B (DNMT3B) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Lung cancer | |
| Drug | Metformin | |
| Crosstalk ID: M6ACROT02178 | ||
| Epigenetic Regulator | Cysteine methyltransferase DNMT3A (DNMT3A) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Lung cancer | |
| Drug | Osimertinib | |
| Crosstalk ID: M6ACROT02191 | ||
| Epigenetic Regulator | DNA (cytosine-5)-methyltransferase 3B (DNMT3B) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Lung cancer | |
| Drug | Osimertinib | |
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03388 | ||
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Lung cancer | |
| Drug | Gefitinib | |
| Crosstalk ID: M6ACROT03401 | ||
| Regulated Target | Histone H3 lysine 4 monomethylation (H3K4me1) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Lung cancer | |
| Drug | Gefitinib | |
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05617 | ||
| Epigenetic Regulator | SVIL antisense RNA 1 (SVIL-AS1) | |
| Regulated Target | Transcription factor E2F1 (E2F1) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Lung cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00673)
| In total 6 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE004049 | Click to Show/Hide the Full List | ||
| mod site | chr10:29459194-29459195:+ | [2] | |
| Sequence | TCATAGCTCTCTGCAGCCTTAAACTCCTGGACTCAAGCAGT | ||
| Transcript ID List | ENST00000446807.5; ENST00000414457.5; ENST00000455774.1; ENST00000423223.5; ENST00000445521.5; ENST00000413405.5 | ||
| External Link | RMBase: RNA-editing_site_15253 | ||
| mod ID: A2ISITE004050 | Click to Show/Hide the Full List | ||
| mod site | chr10:29459993-29459994:+ | [2] | |
| Sequence | CTACCTACTTGGGGTGGCTGAGGTGGTAGGGTCGTTTGAGC | ||
| Transcript ID List | ENST00000413405.5; ENST00000455774.1; ENST00000446807.5; ENST00000423223.5; ENST00000414457.5; rmsk_3271266; ENST00000445521.5 | ||
| External Link | RMBase: RNA-editing_site_15255 | ||
| mod ID: A2ISITE004051 | Click to Show/Hide the Full List | ||
| mod site | chr10:29460000-29460001:+ | [2] | |
| Sequence | CTTGGGGTGGCTGAGGTGGTAGGGTCGTTTGAGCCCAGGGG | ||
| Transcript ID List | rmsk_3271266; ENST00000414457.5; ENST00000455774.1; ENST00000413405.5; ENST00000423223.5; ENST00000445521.5; ENST00000446807.5 | ||
| External Link | RMBase: RNA-editing_site_15256 | ||
| mod ID: A2ISITE004052 | Click to Show/Hide the Full List | ||
| mod site | chr10:29460024-29460025:+ | [2] | |
| Sequence | TCGTTTGAGCCCAGGGGTTCAAGGTTTGTGTGAGCCATGAT | ||
| Transcript ID List | ENST00000446807.5; ENST00000423223.5; ENST00000445521.5; rmsk_3271266; ENST00000414457.5; ENST00000455774.1; ENST00000413405.5 | ||
| External Link | RMBase: RNA-editing_site_15257 | ||
| mod ID: A2ISITE004053 | Click to Show/Hide the Full List | ||
| mod site | chr10:29460040-29460041:+ | [2] | |
| Sequence | GTTCAAGGTTTGTGTGAGCCATGATTGAGTCACCACACTGC | ||
| Transcript ID List | ENST00000414457.5; ENST00000455774.1; ENST00000446807.5; ENST00000445521.5; ENST00000423223.5; ENST00000413405.5; rmsk_3271266 | ||
| External Link | RMBase: RNA-editing_site_15258 | ||
| mod ID: A2ISITE004054 | Click to Show/Hide the Full List | ||
| mod site | chr10:29460054-29460055:+ | [2] | |
| Sequence | TGAGCCATGATTGAGTCACCACACTGCAGCCTGGGTGACAA | ||
| Transcript ID List | ENST00000414457.5; ENST00000413405.5; ENST00000423223.5; ENST00000455774.1; ENST00000445521.5; ENST00000446807.5; rmsk_3271266 | ||
| External Link | RMBase: RNA-editing_site_15259 | ||
N6-methyladenosine (m6A)
| In total 35 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE095984 | Click to Show/Hide the Full List | ||
| mod site | chr10:29410254-29410255:+ | [3] | |
| Sequence | TATTAGTCGTCTGTGAAAGAACAGCTGGATCTTGTGAAGTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; GSC-11; HEK293A-TOA; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000438202.5; ENST00000445521.5; ENST00000446807.5; ENST00000609413.5; ENST00000623175.3; ENST00000455774.1; ENST00000423223.5; ENST00000414457.5; ENST00000413405.5; ENST00000430295.5; ENST00000608994.5; ENST00000646086.1; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96567 | ||
| mod ID: M6ASITE095985 | Click to Show/Hide the Full List | ||
| mod site | chr10:29415395-29415396:+ | [4] | |
| Sequence | GATGATACCTTTGATCCAGAACTTGCAGCAACAATAGGTGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000413405.5; ENST00000455774.1; ENST00000445521.5; ENST00000430295.5; ENST00000414457.5; ENST00000423223.5; ENST00000446807.5; ENST00000438202.5; ENST00000623175.3; ENST00000646086.1; ENST00000609413.5; ENST00000608994.5; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96568 | ||
| mod ID: M6ASITE095986 | Click to Show/Hide the Full List | ||
| mod site | chr10:29418207-29418208:+ | [4] | |
| Sequence | CACTTTACATCACTTTCCAGACAACTGGAATTTGAGACAAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000608994.5; ENST00000430295.5; ENST00000623175.3; ENST00000455774.1; ENST00000445521.5; ENST00000413405.5; ENST00000423223.5; ENST00000414457.5; ENST00000438202.5; ENST00000609413.5; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96569 | ||
| mod ID: M6ASITE095987 | Click to Show/Hide the Full List | ||
| mod site | chr10:29418223-29418224:+ | [4] | |
| Sequence | CCAGACAACTGGAATTTGAGACAATGTCTGTGACAGCAGTC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000609413.5; ENST00000413405.5; ENST00000623175.3; ENST00000427063.6; ENST00000455774.1; ENST00000445521.5; ENST00000438202.5; ENST00000414457.5; ENST00000446807.5; ENST00000608994.5; ENST00000430295.5; ENST00000423223.5 | ||
| External Link | RMBase: m6A_site_96570 | ||
| mod ID: M6ASITE095988 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420510-29420511:+ | [3] | |
| Sequence | ACAATGCAGGAATCACATGAACCTGTCCATCCACAGATAAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000609413.5; ENST00000445521.5; ENST00000423223.5; ENST00000427063.6; rmsk_3271187; ENST00000446807.5; ENST00000430295.5; ENST00000623175.3; ENST00000438202.5; ENST00000413405.5; ENST00000608994.5; ENST00000455774.1; ENST00000414457.5 | ||
| External Link | RMBase: m6A_site_96571 | ||
| mod ID: M6ASITE095989 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420542-29420543:+ | [3] | |
| Sequence | ACAGATAAAGTGGTAAAGAAACTGCCGTATTAGATACATGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; fibroblasts | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000455774.1; ENST00000414457.5; ENST00000609413.5; ENST00000427063.6; rmsk_3271187; ENST00000438202.5; ENST00000423223.5; ENST00000445521.5; ENST00000446807.5; ENST00000413405.5; ENST00000430295.5; ENST00000623175.3 | ||
| External Link | RMBase: m6A_site_96572 | ||
| mod ID: M6ASITE095990 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420595-29420596:+ | [3] | |
| Sequence | CAGCCATAAAGCTTCGGGAAACCCTGTCATCCGCAACCACG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; fibroblasts; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000423223.5; ENST00000427063.6; ENST00000438202.5; ENST00000623175.3; rmsk_3271187; ENST00000609413.5; ENST00000445521.5; ENST00000413405.5; ENST00000430295.5; ENST00000414457.5; ENST00000455774.1 | ||
| External Link | RMBase: m6A_site_96573 | ||
| mod ID: M6ASITE095991 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420623-29420624:+ | [3] | |
| Sequence | ATCCGCAACCACGTGGAGAAACCTGTCCATCCACAGATGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000455774.1; ENST00000438202.5; rmsk_3271187; ENST00000427063.6; ENST00000446807.5; ENST00000609413.5; ENST00000430295.5; ENST00000445521.5; ENST00000413405.5; ENST00000414457.5; ENST00000423223.5; ENST00000623175.3 | ||
| External Link | RMBase: m6A_site_96574 | ||
| mod ID: M6ASITE095992 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420735-29420736:+ | [3] | |
| Sequence | GTTTGGAGCAACACAGATGAACCTGTCCATCCACAAATGAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000455774.1; ENST00000623175.3; ENST00000446807.5; ENST00000430295.5; ENST00000427063.6; ENST00000609413.5; ENST00000413405.5; ENST00000423223.5; rmsk_3271188; ENST00000445521.5; ENST00000414457.5; ENST00000438202.5 | ||
| External Link | RMBase: m6A_site_96575 | ||
| mod ID: M6ASITE095993 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420757-29420758:+ | [3] | |
| Sequence | CTGTCCATCCACAAATGAAGACATCAAGAAACTCTAGTATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000430295.5; rmsk_3271189; ENST00000414457.5; ENST00000413405.5; ENST00000455774.1; ENST00000438202.5; ENST00000423223.5; ENST00000427063.6; ENST00000445521.5 | ||
| External Link | RMBase: m6A_site_96576 | ||
| mod ID: M6ASITE095994 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420767-29420768:+ | [3] | |
| Sequence | ACAAATGAAGACATCAAGAAACTCTAGTATGTACACAAGGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423223.5; rmsk_3271189; ENST00000430295.5; ENST00000414457.5; ENST00000446807.5; ENST00000413405.5; ENST00000455774.1; ENST00000438202.5; ENST00000445521.5; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96577 | ||
| mod ID: M6ASITE095995 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420791-29420792:+ | [3] | |
| Sequence | TAGTATGTACACAAGGCAAAACACTTCAGCTATCAAAATCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413405.5; rmsk_3271189; ENST00000455774.1; ENST00000438202.5; ENST00000414457.5; ENST00000445521.5; ENST00000430295.5; ENST00000423223.5; ENST00000446807.5; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96578 | ||
| mod ID: M6ASITE095996 | Click to Show/Hide the Full List | ||
| mod site | chr10:29420984-29420985:+ | [3] | |
| Sequence | GCTGACCCAGCAATAACTGAACAGCTGATATGTACCTCACA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000445521.5; ENST00000430295.5; ENST00000423223.5; ENST00000438202.5; ENST00000446807.5; ENST00000413405.5; ENST00000427063.6; ENST00000455774.1; ENST00000414457.5 | ||
| External Link | RMBase: m6A_site_96579 | ||
| mod ID: M6ASITE095997 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421119-29421120:+ | [3] | |
| Sequence | TTAATCCCAGTGAGCTCCAAACAAGTTTTAGGAGGCTCCCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413405.5; ENST00000446807.5; ENST00000430295.5; ENST00000438202.5; ENST00000423223.5; ENST00000414457.5; ENST00000427063.6; ENST00000455774.1; ENST00000445521.5 | ||
| External Link | RMBase: m6A_site_96580 | ||
| mod ID: M6ASITE095998 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421143-29421144:+ | [3] | |
| Sequence | GTTTTAGGAGGCTCCCCAAAACCAGTGAAGACTTTAACTAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000445521.5; ENST00000414457.5; ENST00000446807.5; ENST00000438202.5; ENST00000430295.5; ENST00000455774.1; ENST00000423223.5; ENST00000427063.6; ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96581 | ||
| mod ID: M6ASITE095999 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421153-29421154:+ | [3] | |
| Sequence | GCTCCCCAAAACCAGTGAAGACTTTAACTAAAAGTAGAATT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000438202.5; ENST00000423223.5; ENST00000445521.5; ENST00000427063.6; ENST00000430295.5; ENST00000413405.5; ENST00000446807.5; ENST00000414457.5; ENST00000455774.1 | ||
| External Link | RMBase: m6A_site_96582 | ||
| mod ID: M6ASITE096000 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421188-29421189:+ | [3] | |
| Sequence | AGAATTTCAAAGTATTAGAAACCAAACCCCAAAATTAAATG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000430295.5; ENST00000455774.1; ENST00000438202.5; ENST00000413405.5; ENST00000445521.5; ENST00000446807.5; ENST00000423223.5; ENST00000427063.6; ENST00000414457.5 | ||
| External Link | RMBase: m6A_site_96583 | ||
| mod ID: M6ASITE096001 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421193-29421194:+ | [3] | |
| Sequence | TTCAAAGTATTAGAAACCAAACCCCAAAATTAAATGTGAAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000414457.5; ENST00000413405.5; ENST00000430295.5; ENST00000423223.5; ENST00000438202.5; ENST00000445521.5; ENST00000455774.1; ENST00000427063.6 | ||
| External Link | RMBase: m6A_site_96584 | ||
| mod ID: M6ASITE096002 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421248-29421249:+ | [3] | |
| Sequence | TGAGCTGGCCCATCTGGTGGACACAGGATTTGCGTTATCGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000455774.1; ENST00000445521.5; ENST00000423223.5; ENST00000430295.5; ENST00000427063.6; ENST00000438202.5; ENST00000413405.5; ENST00000414457.5 | ||
| External Link | RMBase: m6A_site_96585 | ||
| mod ID: M6ASITE096003 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421352-29421353:+ | [3] | |
| Sequence | TACCAAATACAGCAGAGCAAACCCGGCTTTGAGGCAAGGGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000455774.1; ENST00000413405.5; ENST00000445521.5; ENST00000438202.5; ENST00000423223.5; ENST00000414457.5; ENST00000427063.6; ENST00000430295.5; ENST00000446807.5 | ||
| External Link | RMBase: m6A_site_96586 | ||
| mod ID: M6ASITE096004 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421460-29421461:+ | [5] | |
| Sequence | TTCTCCTGGCCTCCTTGTAAACCCAAACCGCCAGGTACCTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000446807.5; ENST00000438202.5; ENST00000455774.1; ENST00000413405.5; ENST00000427063.6; ENST00000445521.5; ENST00000414457.5; ENST00000430295.5; ENST00000423223.5 | ||
| External Link | RMBase: m6A_site_96587 | ||
| mod ID: M6ASITE096005 | Click to Show/Hide the Full List | ||
| mod site | chr10:29421466-29421467:+ | [5] | |
| Sequence | TGGCCTCCTTGTAAACCCAAACCGCCAGGTACCTCAATTTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000430295.5; ENST00000446807.5; ENST00000445521.5; ENST00000438202.5; ENST00000427063.6; ENST00000414457.5; ENST00000455774.1; ENST00000413405.5; ENST00000423223.5 | ||
| External Link | RMBase: m6A_site_96588 | ||
| mod ID: M6ASITE096006 | Click to Show/Hide the Full List | ||
| mod site | chr10:29422028-29422029:+ | [3] | |
| Sequence | GCCCTACACCAAAGTGGGAGACATTCAGAATCGAGGCGAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000427063.6; ENST00000438202.5; ENST00000413405.5; ENST00000445521.5; ENST00000446807.5; ENST00000455774.1; ENST00000430295.5; ENST00000423223.5; ENST00000414457.5 | ||
| External Link | RMBase: m6A_site_96597 | ||
| mod ID: M6ASITE096007 | Click to Show/Hide the Full List | ||
| mod site | chr10:29422125-29422126:+ | [3] | |
| Sequence | GCCCTGTGTGAATGTGGAAGACCAGCAGATTGGAGGTGGAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000427063.6; ENST00000413405.5; ENST00000438202.5; ENST00000445521.5; ENST00000446807.5; ENST00000455774.1; ENST00000414457.5; ENST00000430295.5; ENST00000423223.5 | ||
| External Link | RMBase: m6A_site_96598 | ||
| mod ID: M6ASITE096008 | Click to Show/Hide the Full List | ||
| mod site | chr10:29424094-29424095:+ | [6] | |
| Sequence | AACTATAACATGACTTAAGAACTTTTATGCATGGACTTTGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000445521.5; ENST00000455774.1; ENST00000438202.5; ENST00000423223.5; ENST00000414457.5; ENST00000413405.5; ENST00000430295.5; ENST00000446807.5 | ||
| External Link | RMBase: m6A_site_96599 | ||
| mod ID: M6ASITE096009 | Click to Show/Hide the Full List | ||
| mod site | chr10:29458332-29458333:+ | [3] | |
| Sequence | CCTCGTCATGTCTAGTGCAAACTGGAAACATTGGGAGAAGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445521.5; ENST00000423223.5; ENST00000438202.5; ENST00000455774.1; ENST00000430295.5; ENST00000414457.5; ENST00000446807.5; ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96609 | ||
| mod ID: M6ASITE096010 | Click to Show/Hide the Full List | ||
| mod site | chr10:29458339-29458340:+ | [3] | |
| Sequence | ATGTCTAGTGCAAACTGGAAACATTGGGAGAAGCGCCCCGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445521.5; ENST00000413405.5; ENST00000423223.5; ENST00000455774.1; ENST00000438202.5; ENST00000414457.5; ENST00000446807.5; ENST00000430295.5 | ||
| External Link | RMBase: m6A_site_96610 | ||
| mod ID: M6ASITE096011 | Click to Show/Hide the Full List | ||
| mod site | chr10:29458424-29458425:+ | [3] | |
| Sequence | ATCCCCACCCCACCGGAAGAACCGCTTACCTCGAAGTCTTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000455774.1; ENST00000445521.5; ENST00000446807.5; ENST00000414457.5; ENST00000423223.5; ENST00000413405.5; ENST00000438202.5 | ||
| External Link | RMBase: m6A_site_96611 | ||
| mod ID: M6ASITE096012 | Click to Show/Hide the Full List | ||
| mod site | chr10:29458661-29458662:+ | [7] | |
| Sequence | GTTTTATTAAGTGCTTACAGACACACAGCCCTGTGCCACCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000413405.5; ENST00000438202.5; ENST00000446807.5; ENST00000414457.5; ENST00000423223.5; ENST00000455774.1; ENST00000445521.5 | ||
| External Link | RMBase: m6A_site_96615 | ||
| mod ID: M6ASITE096013 | Click to Show/Hide the Full List | ||
| mod site | chr10:29458773-29458774:+ | [5] | |
| Sequence | AAAGCCCTGCAGTTGTCTGGACTTTTAATTTTTAAAATTTT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000414457.5; ENST00000455774.1; ENST00000445521.5; ENST00000423223.5; ENST00000413405.5; ENST00000438202.5; ENST00000446807.5 | ||
| External Link | RMBase: m6A_site_96616 | ||
| mod ID: M6ASITE096014 | Click to Show/Hide the Full List | ||
| mod site | chr10:29483278-29483279:+ | [8] | |
| Sequence | CAGATTGCAGGGTGAGGGGGACAAACCTGGGCCAGGAGCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000413405.5; ENST00000414457.5; ENST00000446807.5 | ||
| External Link | RMBase: m6A_site_96638 | ||
| mod ID: M6ASITE096015 | Click to Show/Hide the Full List | ||
| mod site | chr10:29487188-29487189:+ | [3] | |
| Sequence | CTTTTCTATGACGTTTGCAAACTCTCCTACCCACAGGAAGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96653 | ||
| mod ID: M6ASITE096016 | Click to Show/Hide the Full List | ||
| mod site | chr10:29487303-29487304:+ | [3] | |
| Sequence | TGCACATGTCTTCTTCCTGAACACGAGGCAGACAGTCACCG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96658 | ||
| mod ID: M6ASITE096017 | Click to Show/Hide the Full List | ||
| mod site | chr10:29487314-29487315:+ | [3] | |
| Sequence | TCTTCCTGAACACGAGGCAGACAGTCACCGTCTTTCCAGAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96659 | ||
| mod ID: M6ASITE096018 | Click to Show/Hide the Full List | ||
| mod site | chr10:29487333-29487334:+ | [3] | |
| Sequence | GACAGTCACCGTCTTTCCAGACAGAACGGGGATAGGACGCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413405.5 | ||
| External Link | RMBase: m6A_site_96660 | ||
References