m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00516)

Target Name	C-X-C motif chemokine 11 (CXCL11)
Synonyms	Beta-R1; H174; Interferon gamma-inducible protein 9; IP-9; Interferon-inducible T-cell alpha chemoattractant; I-TAC; Small-inducible cytokine B11 Click to Show/Hide
Gene Name	CXCL11
Chromosomal Location	4q21.1
Family	Intercrine alpha (chemokine CxC) family
Function	Chemotactic for interleukin-activated T-cells but not unstimulated T-cells, neutrophils or monocytes. Induces calcium release in activated T-cells. Binds to CXCR3. May play an important role in CNS diseases which involve T-cell recruitment. May play a role in skin immune responses. Click to Show/Hide
Gene ID	6373
Uniprot ID	CXL11_HUMAN
HGNC ID	HGNC:10638
KEGG ID	hsa:6373

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CXCL11 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

RNA-binding motif protein 15 (RBM15) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	RBM15 enhanced the stability of C-X-C motif chemokine 11 (CXCL11) mRNA in an m6A-dependent manner. These findings highlight the function of RBM15 in ccRCC and reveal a novel identified EP300/CBP-RBM15-CXCL11 signaling axis, which promotes ccRCC progression and provides new insight into ccRCC therapy.
Target Regulation	Up regulation
Responsed Disease	Renal cell carcinoma of kidney		ICD-11: 2C90.0	Disease Info
Pathway Response	mRNA surveillance pathway			hsa03015
Pathway Response	RNA degradation			hsa03018
Cell Process	RNA stability
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	A total of 5 × 10⁶ 786O cells were subcutaneously injected into the left flanks of the mice.

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	RBM15 enhanced the stability of C-X-C motif chemokine 11 (CXCL11) mRNA in an m6A-dependent manner. These findings highlight the function of RBM15 in ccRCC and reveal a novel identified EP300/CBP-RBM15-CXCL11 signaling axis, which promotes ccRCC progression and provides new insight into ccRCC therapy.
Responsed Disease	Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator	RNA-binding motif protein 15 (RBM15)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mRNA surveillance pathway			hsa03015
Pathway Response	RNA degradation			hsa03018
Cell Process	RNA stability
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HK-2 [Human kidney]	Normal	Homo sapiens	CVCL_0302
	Caki-2	Papillary renal cell carcinoma	Homo sapiens	CVCL_0235
	Caki-1	Clear cell renal cell carcinoma	Homo sapiens	CVCL_0234
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	A total of 5 × 10⁶ 786O cells were subcutaneously injected into the left flanks of the mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: RNA-binding motif protein 15 (RBM15)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03173		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Renal cell carcinoma of kidney	Disease Info
Drug	SETDB1-TTD-IN-1	Drug Info
Crosstalk ID: M6ACROT03174		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 9 acetylation (H3K9Ac)
Crosstalk relationship	Histone modification → m6A
Disease	Renal cell carcinoma of kidney	Disease Info
Drug	SETDB1-TTD-IN-1	Drug Info
Crosstalk ID: M6ACROT03175		Crosstalk Info
Epigenetic Regulator	CREB-binding protein (CREBBP)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Renal cell carcinoma of kidney	Disease Info
Drug	SETDB1-TTD-IN-1	Drug Info
Crosstalk ID: M6ACROT03176		Crosstalk Info
Epigenetic Regulator	CREB-binding protein (CREBBP)
Regulated Target	Histone H3 lysine 9 acetylation (H3K9Ac)
Crosstalk relationship	Histone modification → m6A
Disease	Renal cell carcinoma of kidney	Disease Info
Drug	SETDB1-TTD-IN-1	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00516)

C-X-C motif chemokine 11 (CXCL11)

N6-methyladenosine (m6A)

In total 6 m6A sequence/site(s) in this target gene
mod ID: M6ASITE066175		Click to Show/Hide the Full List
mod site	chr4:76034612-76034613:-		[2]
Sequence	GGTGGGTGAAAGGACCAAAAACAGAAATACAGTCTTCCTGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7; NB4; MM6
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000306621.7
External Link	RMBase: m6A_site_640946
mod ID: M6ASITE066176		Click to Show/Hide the Full List
mod site	chr4:76034619-76034620:-		[2]
Sequence	GATGAAAGGTGGGTGAAAGGACCAAAAACAGAAATACAGTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7; NB4; MM6
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000306621.7
External Link	RMBase: m6A_site_640947
mod ID: M6ASITE066177		Click to Show/Hide the Full List
mod site	chr4:76034687-76034688:-		[2]
Sequence	TTCTACAGTAGGAAACTGAGACTTTTCTATGGTTTTGTGAC
Motif Score	3.319380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000306621.7
External Link	RMBase: m6A_site_640948
mod ID: M6ASITE066178		Click to Show/Hide the Full List
mod site	chr4:76034693-76034694:-		[3]
Sequence	CAAGAATTCTACAGTAGGAAACTGAGACTTTTCTATGGTTT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000503860.1; ENST00000306621.7
External Link	RMBase: m6A_site_640949
mod ID: M6ASITE066179		Click to Show/Hide the Full List
mod site	chr4:76034741-76034742:-		[3]
Sequence	GAGCATCTGAAAAACCTAGAACAAGTTTAACTGTGACTACT
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000503860.1; ENST00000306621.7
External Link	RMBase: m6A_site_640950
mod ID: M6ASITE066180		Click to Show/Hide the Full List
mod site	chr4:76034748-76034749:-		[3]
Sequence	TGGAAAAGAGCATCTGAAAAACCTAGAACAAGTTTAACTGT
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000503860.1; ENST00000306621.7
External Link	RMBase: m6A_site_640951

Ref 1	Epigenetic activation of RBM15 promotes clear cell renal cell carcinoma growth, metastasis and macrophage infiltration by regulating the m6A modification of CXCL11. Free Radic Biol Med. 2022 May 1;184:135-147. doi: 10.1016/j.freeradbiomed.2022.03.031. Epub 2022 Apr 2.
Ref 2	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 3	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map