m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00450)
Target Name Wnt inhibitory factor 1 (WIF1)
Synonyms
WIF-1; UNQ191/PRO217
    Click to Show/Hide
Gene Name WIF1
Chromosomal Location 12q14.3
Function
Binds to WNT proteins and inhibits their activities. May be involved in mesoderm segmentation.
    Click to Show/Hide
Gene ID 11197
Uniprot ID
WIF1_HUMAN
HGNC ID
HGNC:18081
KEGG ID
hsa:11197
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
WIF1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary ALKBH5 overexpression sensitizes Pancreatic cancer cells to gemcitabine treatment, and it represses PDAC tumorigenesis by reducing m6A levels of Wnt inhibitory factor 1 (WIF1) and hindering activation of Wnt signaling.
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Responsed Drug Gemcitabine Approved
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model AsPC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0152
BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
Capan-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0237
Capan-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0026
CFPAC-1 Cystic fibrosis Homo sapiens CVCL_1119
HPDE6c7 Normal Homo sapiens CVCL_0P38
MIA PaCa-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0428
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
Pancreatic cancer [ICD-11: 2C10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary ALKBH5 overexpression sensitizes Pancreatic cancer cells to gemcitabine treatment, and it represses PDAC tumorigenesis by reducing m6A levels of Wnt inhibitory factor 1 (WIF1) and hindering activation of Wnt signaling.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Gemcitabine Approved
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model AsPC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0152
BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
Capan-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0237
Capan-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0026
CFPAC-1 Cystic fibrosis Homo sapiens CVCL_1119
HPDE6c7 Normal Homo sapiens CVCL_0P38
MIA PaCa-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0428
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
Gemcitabine [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary ALKBH5 overexpression sensitizes Pancreatic cancer cells to gemcitabine treatment, and it represses PDAC tumorigenesis by reducing m6A levels of Wnt inhibitory factor 1 (WIF1) and hindering activation of Wnt signaling.
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model AsPC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0152
BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
Capan-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0237
Capan-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0026
CFPAC-1 Cystic fibrosis Homo sapiens CVCL_1119
HPDE6c7 Normal Homo sapiens CVCL_0P38
MIA PaCa-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0428
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05304
 Crosstalk Info 
Epigenetic Regulator hsa-miR-21-5p
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Endometriosis
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00450)
Wnt inhibitory factor 1 (WIF1)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005631 Click to Show/Hide the Full List
mod site chr12:65056474-65056475:- [3]
Sequence CCAGCACTTTTGAGAGGCCAAGGCGGGCGGATCACTTGAGG
Transcript ID List ENST00000543094.1; ENST00000286574.9; rmsk_3814473
External Link RMBase: RNA-editing_site_29757
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000071 Click to Show/Hide the Full List
mod site chr12:65068799-65068800:- [4]
Sequence GCAACACCATTCTCCAAACACCTCAAAATGCTATCTTCTTT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000286574.9; ENST00000546001.1
External Link RMBase: m5C_site_10594
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013754 Click to Show/Hide the Full List
mod site chr12:65068872-65068873:- [5]
Sequence GGTTTCCCATGTCTTGGAAAACAGGATGGGGTGGCAGCATT
Motif Score 2.20572619
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000546001.1; ENST00000286574.9
External Link RMBase: m6A_site_197228