General Information of the m6A Target Gene (ID: M6ATAR00419)
Target Name Stimulator of interferon genes protein (STING1)
Synonyms
hSTING; Endoplasmic reticulum interferon stimulator; ERIS; Mediator of IRF3 activation; hMITA; Transmembrane protein 173; ERIS; MITA; STING; TMEM173
    Click to Show/Hide
Gene Name STING1
Chromosomal Location 5q31.2
Family STING family
Function
Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm. Acts by binding cyclic dinucleotides: recognizes and binds cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced by CGAS in response to DNA virus in the cytosol. Upon binding of c-di-GMP or cGAMP, STING1 oligomerizes, translocates from the endoplasmic reticulum and is phosphorylated by TBK1 on the pLxIS motif, leading to recruitment and subsequent activation of the transcription factor IRF3 to induce expression of type I interferon and exert a potent anti-viral state. In addition to promote the production of type I interferons, plays a direct role in autophagy. Following cGAMP-binding, STING1 buds from the endoplasmic reticulum into COPII vesicles, which then form the endoplasmic reticulum-Golgi intermediate compartment (ERGIC). The ERGIC serves as the membrane source for WIPI2 recruitment and LC3 lipidation, leading to formation of autophagosomes that target cytosolic DNA or DNA viruses for degradation by the lysosome. The autophagy- and interferon-inducing activities can be uncoupled and autophagy induction is independent of TBK1 phosphorylation . Autophagy is also triggered upon infection by bacteria: following c-di-GMP-binding, which is produced by live Gram-positive bacteria, promotes reticulophagy (By similarity). Exhibits 2',3' phosphodiester linkage-specific ligand recognition: can bind both 2'-3' linked cGAMP (2'-3'-cGAMP) and 3'-3' linked cGAMP but is preferentially activated by 2'-3' linked cGAMP. The preference for 2'-3'-cGAMP, compared to other linkage isomers is probably due to the ligand itself, whichs adopts an organized free-ligand conformation that resembles the STING1-bound conformation and pays low energy costs in changing into the active conformation . May be involved in translocon function, the translocon possibly being able to influence the induction of type I interferons. May be involved in transduction of apoptotic signals via its association with the major histocompatibility complex class II (MHC-II) (By similarity).; (Microbial infection) Antiviral activity is antagonized by oncoproteins, such as papillomavirus (HPV) protein E7 and adenovirus early E1A protein . Such oncoproteins prevent the ability to sense cytosolic DNA.
    Click to Show/Hide
Gene ID 340061
Uniprot ID
STING_HUMAN
HGNC ID
HGNC:27962
KEGG ID
hsa:340061
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
STING1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line CAG cell line Homo sapiens
Treatment: shALKBH5 CAG cells
Control: shNC CAG cells
GSE180214
Regulation
logFC: 6.04E-01
p-value: 6.54E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary ALKBH5-dependent HMGB1 expression mediates Stimulator of interferon genes protein (STING1)-interferon regulatory factor 3 innate immune response in radiation-induced liver diseases.
Target Regulation Down regulation
Responsed Disease Liver disease ICD-11: DB9Z
Cell Process Immune Response
Cell apoptosis
Liver disease [ICD-11: DB9Z]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary ALKBH5-dependent HMGB1 expression mediates Stimulator of interferon genes protein (STING1)-interferon regulatory factor 3 innate immune response in radiation-induced liver diseases.
Responsed Disease Liver disease [ICD-11: DB9Z]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
Target Regulation Down regulation
Cell Process Immune Response
Cell apoptosis
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03076
Epigenetic Regulator Bifunctional arginine demethylase and lysyl-hydroxylase JMJD6 (JMJD6)
Regulated Target Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship Histone modification → m6A
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05222
Epigenetic Regulator Circ_ASPH
Regulated Target Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00419)
Stimulator of interferon genes protein (STING1)
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003614 Click to Show/Hide the Full List
mod site chr5:139482232-139482233:- [6]
Sequence CTCCTCGTCATCATCCAGAGCAGCCAGTGTCCGGGAGGCAG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000512606.6; ENST00000514542.1; ENST00000651699.1; ENST00000652110.1; ENST00000330794.9; ENST00000650883.1; ENST00000502362.2; ENST00000514348.1; ENST00000652543.1; ENST00000507297.5; ENST00000651565.1; ENST00000515507.5; ENST00000511886.6; ENST00000511850.1; ENST00000514119.6
External Link RMBase: m5C_site_35928
N6-methyladenosine (m6A)
In total 27 m6A sequence/site(s) in this target gene
mod ID: M6ASITE071180 Click to Show/Hide the Full List
mod site chr5:139475688-139475689:- [7]
Sequence GCAACTCTTGCGTAATCATGACTATCTCTAGGATTCTGGCA
Motif Score 3.28175
Cell/Tissue List AML
Seq Type List miCLIP
Transcript ID List ENST00000651699.1; ENST00000650883.1; ENST00000330794.9; ENST00000652293.1; ENST00000502362.2; ENST00000652271.1; ENST00000512606.6; ENST00000507297.5; ENST00000652640.1; ENST00000651565.1
External Link RMBase: m6A_site_687385
mod ID: M6ASITE071181 Click to Show/Hide the Full List
mod site chr5:139475721-139475722:- [8]
Sequence CAGCATCAAGGTTGCTATGGACTCTCCTGCCGGGCAACTCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000502362.2; ENST00000330794.9; ENST00000650883.1; ENST00000507297.5; ENST00000651565.1; ENST00000652293.1; ENST00000512606.6; ENST00000652640.1; ENST00000651699.1; ENST00000652271.1
External Link RMBase: m6A_site_687386
mod ID: M6ASITE071182 Click to Show/Hide the Full List
mod site chr5:139475877-139475878:- [8]
Sequence CCTTTGCCCGGGGACGCCGAACTCTCTCAATGGTATCAACA
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; HepG2; fibroblasts; GM12878; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652110.1; ENST00000652293.1; ENST00000512606.6; ENST00000514119.6; ENST00000652271.1; ENST00000651699.1; ENST00000650883.1; ENST00000502362.2; rmsk_1762550; ENST00000330794.9; ENST00000507297.5; ENST00000652640.1; ENST00000651565.1
External Link RMBase: m6A_site_687387
mod ID: M6ASITE071183 Click to Show/Hide the Full List
mod site chr5:139475922-139475923:- [8]
Sequence TCTTTCATGGGGCCTTCCAGACCCACTCCCCACCCTTCTCC
Motif Score 2.876744048
Cell/Tissue List HeLa; A549; HepG2; GM12878; MM6; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000514119.6; ENST00000652640.1; ENST00000652293.1; ENST00000650883.1; ENST00000502362.2; ENST00000652110.1; rmsk_1762550; ENST00000651565.1; ENST00000651699.1; ENST00000512606.6; ENST00000507297.5; ENST00000652271.1; ENST00000330794.9
External Link RMBase: m6A_site_687388
mod ID: M6ASITE071184 Click to Show/Hide the Full List
mod site chr5:139475980-139475981:- [8]
Sequence TGTGTGGAAGTTTTTCATAAACTTTGGATGCTAGTGTACTT
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; HepG2; GM12878; MM6; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000514119.6; rmsk_1762551; ENST00000650883.1; ENST00000652271.1; ENST00000652543.1; ENST00000502362.2; ENST00000652293.1; ENST00000652640.1; ENST00000651565.1; ENST00000651699.1; ENST00000652110.1; ENST00000330794.9; ENST00000512606.6; ENST00000507297.5
External Link RMBase: m6A_site_687389
mod ID: M6ASITE071185 Click to Show/Hide the Full List
mod site chr5:139476006-139476007:- [8]
Sequence CCCTCACGGTTGTTGTGAGGACTGAGTGTGTGGAAGTTTTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List rmsk_1762551; ENST00000330794.9; ENST00000514119.6; ENST00000652640.1; ENST00000652293.1; ENST00000507297.5; ENST00000512606.6; ENST00000651699.1; ENST00000652271.1; ENST00000651565.1; ENST00000650883.1; ENST00000652543.1; ENST00000652110.1; ENST00000502362.2
External Link RMBase: m6A_site_687390
mod ID: M6ASITE071186 Click to Show/Hide the Full List
mod site chr5:139476132-139476133:- [9]
Sequence CTTGCAGGGAAGGGTCCAGGACTTGACATCTTAAGATGCGT
Motif Score 4.065041667
Cell/Tissue List HepG2; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000652271.1; ENST00000512606.6; ENST00000652110.1; ENST00000652293.1; ENST00000652543.1; ENST00000502362.2; ENST00000650883.1; ENST00000651565.1; ENST00000509573.5; ENST00000652640.1; ENST00000511886.6; ENST00000651699.1; ENST00000507297.5; ENST00000514119.6; ENST00000330794.9
External Link RMBase: m6A_site_687391
mod ID: M6ASITE071187 Click to Show/Hide the Full List
mod site chr5:139476211-139476212:- [8]
Sequence AGTGGTCTCCAAGCCTCTGGACTGGGGGCTCTCTTCAGTGG
Motif Score 4.065041667
Cell/Tissue List HeLa; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000651565.1; ENST00000652271.1; ENST00000502362.2; ENST00000511886.6; ENST00000507297.5; ENST00000652640.1; ENST00000330794.9; ENST00000514119.6; ENST00000652293.1; ENST00000509573.5; ENST00000651699.1; ENST00000652110.1; ENST00000512606.6; ENST00000650883.1; ENST00000652543.1
External Link RMBase: m6A_site_687392
mod ID: M6ASITE071188 Click to Show/Hide the Full List
mod site chr5:139476258-139476259:- [8]
Sequence CCGCACGGATTTCTCTTGAGACCCAGGGTCACCAGGCCAGA
Motif Score 2.876744048
Cell/Tissue List HeLa; MM6; CD4T; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000652543.1; ENST00000502362.2; ENST00000651565.1; ENST00000652110.1; ENST00000650883.1; ENST00000512606.6; ENST00000509573.5; ENST00000514119.6; ENST00000511886.6; ENST00000652293.1; ENST00000652271.1; ENST00000652640.1; ENST00000330794.9; ENST00000651699.1; ENST00000507297.5
External Link RMBase: m6A_site_687393
mod ID: M6ASITE071189 Click to Show/Hide the Full List
mod site chr5:139476358-139476359:- [8]
Sequence TTACTGTGGGCAGCTTGAAGACCTCAGCGGTGCCCAGTACC
Motif Score 2.876744048
Cell/Tissue List HeLa; MM6; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000651699.1; ENST00000330794.9; ENST00000503287.5; ENST00000650883.1; ENST00000512606.6; ENST00000514119.6; ENST00000507297.5; ENST00000651565.1; ENST00000502362.2; ENST00000511886.6; ENST00000509573.5; ENST00000652110.1; ENST00000652271.1; ENST00000652640.1; ENST00000652543.1; ENST00000652293.1
External Link RMBase: m6A_site_687394
mod ID: M6ASITE071190 Click to Show/Hide the Full List
mod site chr5:139477354-139477355:- [10]
Sequence AGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCT
Motif Score 2.951386905
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000509573.5; ENST00000652640.1; ENST00000650883.1; ENST00000514119.6; ENST00000652543.1; ENST00000512606.6; ENST00000651699.1; ENST00000330794.9; ENST00000511886.6; ENST00000651565.1; ENST00000503287.5; ENST00000652271.1; ENST00000652293.1; ENST00000507297.5; ENST00000502362.2; ENST00000652110.1; ENST00000510817.2
External Link RMBase: m6A_site_687395
mod ID: M6ASITE071191 Click to Show/Hide the Full List
mod site chr5:139477384-139477385:- [10]
Sequence CTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTG
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000652543.1; ENST00000511886.6; ENST00000652293.1; ENST00000652110.1; ENST00000514119.6; ENST00000510817.2; ENST00000503287.5; ENST00000507297.5; ENST00000651699.1; ENST00000502362.2; ENST00000509573.5; ENST00000652640.1; ENST00000330794.9; ENST00000652271.1; ENST00000651565.1; ENST00000512606.6; ENST00000650883.1
External Link RMBase: m6A_site_687396
mod ID: M6ASITE071192 Click to Show/Hide the Full List
mod site chr5:139477394-139477395:- [10]
Sequence AGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCA
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000652640.1; ENST00000507297.5; ENST00000510817.2; ENST00000502362.2; ENST00000650883.1; ENST00000511886.6; ENST00000652543.1; ENST00000330794.9; ENST00000651565.1; ENST00000503287.5; ENST00000651699.1; ENST00000652110.1; ENST00000512606.6; ENST00000509573.5; ENST00000652293.1; ENST00000652271.1; ENST00000514119.6
External Link RMBase: m6A_site_687397
mod ID: M6ASITE071193 Click to Show/Hide the Full List
mod site chr5:139477407-139477408:- [10]
Sequence GATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGA
Motif Score 2.627720238
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000512606.6; ENST00000652293.1; ENST00000502362.2; ENST00000509573.5; ENST00000651699.1; ENST00000510817.2; ENST00000651565.1; ENST00000652110.1; ENST00000503287.5; ENST00000650883.1; ENST00000330794.9; ENST00000507297.5; ENST00000511886.6; ENST00000652640.1; ENST00000652271.1; ENST00000652543.1; ENST00000514119.6
External Link RMBase: m6A_site_687398
mod ID: M6ASITE071194 Click to Show/Hide the Full List
mod site chr5:139477475-139477476:- [10]
Sequence AGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAA
Motif Score 3.319380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000652293.1; ENST00000502362.2; ENST00000511886.6; ENST00000509573.5; ENST00000650883.1; ENST00000503287.5; ENST00000507297.5; ENST00000510817.2; ENST00000651565.1; ENST00000652110.1; ENST00000651699.1; ENST00000330794.9; ENST00000514119.6; ENST00000652271.1; ENST00000512606.6; ENST00000652543.1; ENST00000652640.1
External Link RMBase: m6A_site_687399
mod ID: M6ASITE071195 Click to Show/Hide the Full List
mod site chr5:139477883-139477884:- [11]
Sequence CCCAGACGAAGGCTGTGAGAACATCTGAAGGATTCATGTGG
Motif Score 2.951386905
Cell/Tissue List MM6; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000651699.1; ENST00000503287.5; ENST00000652543.1; ENST00000507297.5; ENST00000330794.9; ENST00000651565.1; ENST00000652640.1; ENST00000509573.5; ENST00000650883.1; ENST00000502362.2; ENST00000652110.1; ENST00000652271.1; ENST00000510817.2; ENST00000511886.6; ENST00000652293.1; ENST00000502825.1; ENST00000514119.6; ENST00000512606.6
External Link RMBase: m6A_site_687400
mod ID: M6ASITE071196 Click to Show/Hide the Full List
mod site chr5:139478343-139478344:- [8]
Sequence TGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATC
Motif Score 2.876744048
Cell/Tissue List HeLa; MM6; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000510817.2; ENST00000511886.6; ENST00000509573.5; ENST00000502362.2; ENST00000514119.6; ENST00000652110.1; ENST00000502825.1; ENST00000650883.1; ENST00000330794.9; ENST00000651699.1; ENST00000651565.1; ENST00000507297.5; ENST00000652271.1; ENST00000652293.1; ENST00000652640.1; ENST00000503287.5; ENST00000512606.6; ENST00000652543.1
External Link RMBase: m6A_site_687401
mod ID: M6ASITE071197 Click to Show/Hide the Full List
mod site chr5:139478356-139478357:- [8]
Sequence AACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGA
Motif Score 2.627720238
Cell/Tissue List HeLa; MM6; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000510817.2; ENST00000503287.5; ENST00000652271.1; ENST00000651565.1; ENST00000511886.6; ENST00000652640.1; ENST00000652110.1; ENST00000502362.2; ENST00000650883.1; ENST00000330794.9; ENST00000509573.5; ENST00000512606.6; ENST00000514119.6; ENST00000652543.1; ENST00000651699.1; ENST00000502825.1; ENST00000652293.1; ENST00000507297.5
External Link RMBase: m6A_site_687402
mod ID: M6ASITE071198 Click to Show/Hide the Full List
mod site chr5:139478414-139478415:- [8]
Sequence GTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACC
Motif Score 4.065041667
Cell/Tissue List HeLa; MM6; HEC-1-A; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000509573.5; ENST00000650883.1; ENST00000511886.6; ENST00000330794.9; ENST00000507297.5; ENST00000652640.1; ENST00000651699.1; ENST00000652110.1; ENST00000502362.2; ENST00000514119.6; ENST00000512606.6; ENST00000651565.1; ENST00000652293.1; ENST00000652271.1; ENST00000515507.5; ENST00000503287.5; ENST00000652543.1; ENST00000502825.1; ENST00000510817.2
External Link RMBase: m6A_site_687403
mod ID: M6ASITE071199 Click to Show/Hide the Full List
mod site chr5:139478487-139478488:- [8]
Sequence AGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAAC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000515507.5; ENST00000330794.9; ENST00000514119.6; ENST00000652110.1; ENST00000651565.1; ENST00000652271.1; ENST00000651699.1; ENST00000503287.5; ENST00000510817.2; ENST00000511850.1; ENST00000652293.1; ENST00000650883.1; ENST00000511886.6; ENST00000512606.6; ENST00000507297.5; ENST00000509573.5; ENST00000652543.1; ENST00000652640.1; ENST00000502362.2; ENST00000502825.1
External Link RMBase: m6A_site_687404
mod ID: M6ASITE071200 Click to Show/Hide the Full List
mod site chr5:139481319-139481320:- [10]
Sequence ACCGGGGCAGCTACTGGAGGACTGTGCGGGCCTGCCTGGGC
Motif Score 4.065041667
Cell/Tissue List HEC-1-A; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000652110.1; ENST00000652543.1; ENST00000651565.1; ENST00000514119.6; ENST00000650883.1; ENST00000502362.2; ENST00000503287.5; ENST00000503838.1; ENST00000509573.5; ENST00000515507.5; ENST00000510817.2; ENST00000511850.1; ENST00000512606.6; ENST00000651699.1; ENST00000507297.5; ENST00000652271.1; ENST00000511886.6; ENST00000330794.9
External Link RMBase: m6A_site_687405
mod ID: M6ASITE071201 Click to Show/Hide the Full List
mod site chr5:139481399-139481400:- [10]
Sequence CTAGCCCTGCCCCTCCTTGAACCTCTCTGGCTGAGCTGGGC
Motif Score 2.930744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000507297.5; ENST00000514119.6; ENST00000650883.1; ENST00000515507.5; ENST00000651699.1; ENST00000510817.2; ENST00000503287.5; ENST00000652110.1; ENST00000511886.6; ENST00000652271.1; ENST00000511850.1; ENST00000652543.1; ENST00000651565.1; ENST00000512606.6; ENST00000502362.2; ENST00000330794.9
External Link RMBase: m6A_site_687406
mod ID: M6ASITE071202 Click to Show/Hide the Full List
mod site chr5:139481533-139481534:- [8]
Sequence CTAGCCTCCCTGCAGCTGGGACTGCTGTTAAACGGGGTCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; peripheral-blood; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000651699.1; ENST00000652271.1; ENST00000502362.2; ENST00000511886.6; ENST00000510817.2; ENST00000514348.1; ENST00000650883.1; ENST00000511850.1; ENST00000512606.6; ENST00000515507.5; ENST00000652543.1; ENST00000507297.5; ENST00000514119.6; ENST00000330794.9; ENST00000651565.1; ENST00000652110.1
External Link RMBase: m6A_site_687407
mod ID: M6ASITE071203 Click to Show/Hide the Full List
mod site chr5:139482059-139482060:- [12]
Sequence CCCTGGGGTGGGTTCCGGGGACAGGGGAACCCAGGTCCCCA
Motif Score 3.643047619
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000514348.1; ENST00000514119.6; ENST00000512606.6; ENST00000651565.1; ENST00000511850.1; ENST00000514542.1; ENST00000651699.1; ENST00000507297.5; ENST00000502362.2; ENST00000652110.1; ENST00000515507.5; ENST00000650883.1; ENST00000652271.1; ENST00000511886.6; ENST00000652543.1; ENST00000330794.9
External Link RMBase: m6A_site_687408
mod ID: M6ASITE071204 Click to Show/Hide the Full List
mod site chr5:139482330-139482331:- [13]
Sequence GGCTAGAGTGTTGTGGAGAAACCAATCGTTGTTAACATCTC
Motif Score 2.185083333
Cell/Tissue List MSC; TIME; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000330794.9; ENST00000652543.1; ENST00000651565.1; ENST00000514348.1; ENST00000502362.2; ENST00000650883.1; ENST00000514542.1; ENST00000511886.6; ENST00000651699.1; ENST00000507297.5
External Link RMBase: m6A_site_687409
mod ID: M6ASITE071205 Click to Show/Hide the Full List
mod site chr5:139482574-139482575:- [14]
Sequence ATCGTGGTGGCTTGAGGGGAACCCGCTGTTCAGAGCTGTGA
Motif Score 2.930744048
Cell/Tissue List fibroblasts; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651565.1; ENST00000514542.1; ENST00000511886.6; ENST00000330794.9; ENST00000652543.1; ENST00000507297.5; ENST00000514348.1; ENST00000650883.1
External Link RMBase: m6A_site_687410
mod ID: M6ASITE071206 Click to Show/Hide the Full List
mod site chr5:139482695-139482696:- [8]
Sequence AAAGAATCTGCATCCTGGAAACCAGAAGAAAAATATGAGAC
Motif Score 2.185083333
Cell/Tissue List HeLa; fibroblasts; MM6; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000330794.9; ENST00000652543.1; ENST00000514542.1; ENST00000514348.1; ENST00000511886.6; ENST00000507297.5
External Link RMBase: m6A_site_687411