m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00416)
Target Name Serine/arginine-rich splicing factor 3 (SRSF3)
Synonyms
Pre-mRNA-splicing factor SRP20; Splicing factor, arginine/serine-rich 3; SFRS3; SRP20
    Click to Show/Hide
Gene Name SRSF3
Chromosomal Location 6p21.31-p21.2
Family splicing factor SR family
Function
Splicing factor that specifically promotes exon-inclusion during alternative splicing. Interaction with YTHDC1, a RNA-binding protein that recognizes and binds N6-methyladenosine (m6A)-containing RNAs, promotes recruitment of SRSF3 to its mRNA-binding elements adjacent to m6A sites, leading to exon-inclusion during alternative splicing. Also functions as export adapter involved in mRNA nuclear export . Binds mRNA which is thought to be transferred to the NXF1-NXT1 heterodimer for export (TAP/NXF1 pathway); enhances NXF1-NXT1 RNA-binding activity. Involved in nuclear export of m6A-containing mRNAs via interaction with YTHDC1: interaction with YTHDC1 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1, promoting mRNA nuclear export. RNA-binding is semi-sequence specific .
    Click to Show/Hide
Gene ID 6428
Uniprot ID
SRSF3_HUMAN
HGNC ID
HGNC:10785
KEGG ID
hsa:6428
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SRSF3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LNCaP cell line Homo sapiens
Treatment: shMETTL3 LNCaP cells
Control: shControl LNCaP cells
 GSE147884
Regulation
logFC: -6.96E-01
p-value: 4.00E-41
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 3 (SRSF3), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression.
Target Regulation Up regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process mRNA decay
In-vitro Model U251 (Fibroblasts or fibroblast like cells)
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
In-vivo Model For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS.
YTH domain-containing protein 1 (YTHDC1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDC1
Cell Line ICM cell line Mus musculus
Treatment: YTHDC1 knockout ICM cells
Control: Wild type ICM cells
 GSE157267
Regulation
logFC: -1.77E+00
p-value: 4.66E-05
More Results Click to View More RNA-seq Results
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 3 (SRSF3), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression.
Target Regulation Up regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
Pathway Response RNA degradation hsa03018
Cell Process mRNA decay
In-vitro Model U251 (Fibroblasts or fibroblast like cells)
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
In-vivo Model For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Kaposi's sarcoma-associated herpesvirus(KSHV) productive lytic replication plays a pivotal role in the initiation and progression of Kaposi's sarcoma tumors. m6A sites in RTA pre-mRNA crucial for splicing through interactions with YTHDC1, Serine/arginine-rich splicing factor 3 (SRSF3) and SRSF10. m6A in regulating RTA pre-mRNA splicing but also suggest that KSHV has evolved a mechanism to manipulate the host m6A machinery to its advantage in promoting lytic replication.
Target Regulation Up regulation
Responsed Disease Kaposi's sarcoma ICD-11: 2B57
 Disease Info 
Pathway Response Spliceosome hsa03040
In-vitro Model TIVE-KSHV (KSHV-infected telomerase-immortalized human umbilical vein endothelial cells (TIVE-KSHV cells))
iSLK-BAC16 cells (Kaposi's sarcoma cells carrying the recombinant KSHV bacterial artificial chromosome 16 (BAC16) (iSLK-BAC16 cells))
HUVEC-C Normal Homo sapiens CVCL_2959
Brain cancer [ICD-11: 2A00]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 3 (SRSF3), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response RNA degradation hsa03018
Cell Process mRNA decay
In-vitro Model U251 (Fibroblasts or fibroblast like cells)
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
In-vivo Model For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 3 (SRSF3), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator YTH domain-containing protein 1 (YTHDC1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response RNA degradation hsa03018
Cell Process mRNA decay
In-vitro Model U251 (Fibroblasts or fibroblast like cells)
U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
In-vivo Model For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS.
Kaposi's sarcoma [ICD-11: 2B57]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary Kaposi's sarcoma-associated herpesvirus(KSHV) productive lytic replication plays a pivotal role in the initiation and progression of Kaposi's sarcoma tumors. m6A sites in RTA pre-mRNA crucial for splicing through interactions with YTHDC1, Serine/arginine-rich splicing factor 3 (SRSF3) and SRSF10. m6A in regulating RTA pre-mRNA splicing but also suggest that KSHV has evolved a mechanism to manipulate the host m6A machinery to its advantage in promoting lytic replication.
Responsed Disease Kaposi's sarcoma [ICD-11: 2B57]
Target Regulator YTH domain-containing protein 1 (YTHDC1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Spliceosome hsa03040
In-vitro Model TIVE-KSHV (KSHV-infected telomerase-immortalized human umbilical vein endothelial cells (TIVE-KSHV cells))
iSLK-BAC16 cells (Kaposi's sarcoma cells carrying the recombinant KSHV bacterial artificial chromosome 16 (BAC16) (iSLK-BAC16 cells))
HUVEC-C Normal Homo sapiens CVCL_2959
Pancreatic cancer [ICD-11: 2C10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary Serine/arginine-rich splicing factor 3 (SRSF3) promotes gemcitabine resistance by regulating ANRIL's splicing and ANRIL-208 (one of the ANRIL spliceosomes) can enhance DNA homologous recombination repair (HR) capacity by forming a complex with Ring1b and EZH2. Demonstrates that abnormal alternative splicing and m6A modification are closely related to chemotherapy resistance in pancreatic cancer.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Responsed Drug Gemcitabine Approved
 Drug Info 
Pathway Response mRNA surveillance pathway hsa03015
Cell Process mRNA alternative splicing
In-vitro Model ()
()
In-vivo Model Gemcitabine-resistant Panc1 cells (Panc1-GR) were prepared as stable luciferase clones after transduction with CTRL or shSRSF3 or sh-ANRIL-L vector or SRSF3 or ANRIL-L. For the PDX models, pieces of fresh human pancreatic cancer tissues were transplanted subcutaneously into the axilla of 4-6 week-old NOD/SCID mice.
Gemcitabine [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary Serine/arginine-rich splicing factor 3 (SRSF3) promotes gemcitabine resistance by regulating ANRIL's splicing and ANRIL-208 (one of the ANRIL spliceosomes) can enhance DNA homologous recombination repair (HR) capacity by forming a complex with Ring1b and EZH2. Demonstrates that abnormal alternative splicing and m6A modification are closely related to chemotherapy resistance in pancreatic cancer.
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response mRNA surveillance pathway hsa03015
Cell Process mRNA alternative splicing
In-vitro Model ()
()
In-vivo Model Gemcitabine-resistant Panc1 cells (Panc1-GR) were prepared as stable luciferase clones after transduction with CTRL or shSRSF3 or sh-ANRIL-L vector or SRSF3 or ANRIL-L. For the PDX models, pieces of fresh human pancreatic cancer tissues were transplanted subcutaneously into the axilla of 4-6 week-old NOD/SCID mice.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03294
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Brain cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00416)
Serine/arginine-rich splicing factor 3 (SRSF3)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000105 Click to Show/Hide the Full List
mod site chr6:36602440-36602441:+ [6]
Sequence TGCTGTGAAACACAGGCCATCAGGGAAAACGAAATGCTGCA
Cell/Tissue List H1
Seq Type List ac4C-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000614136.1
External Link RMBase: ac4C_site_1592
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003933 Click to Show/Hide the Full List
mod site chr6:36596757-36596758:+ [7]
Sequence ATTTTTGGTATTTTTCATTACAGAAATGCATCGTGATTCCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000613941.4; ENST00000620941.1; ENST00000620242.1; ENST00000339436.11; ENST00000477442.6; ENST00000373715.11
External Link RMBase: m5C_site_37932
mod ID: M5CSITE003934 Click to Show/Hide the Full List
mod site chr6:36598925-36598926:+ [7]
Sequence AAATCGTGGCCCACCTCCCTCTTGGGGTCGTCGCCCTCGAG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000373715.11; ENST00000613941.4; ENST00000477442.6; ENST00000620941.1; ENST00000339436.11
External Link RMBase: m5C_site_37933
N6-methyladenosine (m6A)
In total 57 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074805 Click to Show/Hide the Full List
mod site chr6:36594428-36594429:+ [8]
Sequence GGCCGGAGGAAAGCGGGAAGACTCATCGGAGCGTGTGGATT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; H1B; MM6; CD4T; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477442.6; ENST00000620242.1; ENST00000613941.4; ENST00000339436.11; ENST00000373715.11
External Link RMBase: m6A_site_715072
mod ID: M6ASITE074806 Click to Show/Hide the Full List
mod site chr6:36596787-36596788:+ [9]
Sequence TCGTGATTCCTGTCCATTGGACTGTAAGGTTTATGTAGGCA
Motif Score 4.065041667
Cell/Tissue List BGC823
Seq Type List m6A-seq
Transcript ID List ENST00000339436.11; ENST00000620941.1; ENST00000613941.4; ENST00000620242.1; ENST00000477442.6; ENST00000373715.11
External Link RMBase: m6A_site_715073
mod ID: M6ASITE074807 Click to Show/Hide the Full List
mod site chr6:36596817-36596818:+ [10]
Sequence TTATGTAGGCAATCTTGGAAACAATGGCAACAAGACGGAAT
Motif Score 2.20572619
Cell/Tissue List HEK293T; hESC-HEK293T; BGC823; HepG2; AML
Seq Type List DART-seq; MAZTER-seq; m6A-seq; miCLIP
Transcript ID List ENST00000477442.6; ENST00000620941.1; ENST00000339436.11; ENST00000620242.1; ENST00000613941.4; ENST00000373715.11
External Link RMBase: m6A_site_715074
mod ID: M6ASITE074808 Click to Show/Hide the Full List
mod site chr6:36596826-36596827:+ [10]
Sequence CAATCTTGGAAACAATGGCAACAAGACGGAATTGGAACGGG
Motif Score 2.173910714
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000620941.1; ENST00000373715.11; ENST00000477442.6; ENST00000613941.4; ENST00000339436.11; ENST00000620242.1
External Link RMBase: m6A_site_715075
mod ID: M6ASITE074809 Click to Show/Hide the Full List
mod site chr6:36596863-36596864:+ [9]
Sequence CGGGCTTTTGGCTACTATGGACCACTCCGAAGTGTGTGGGT
Motif Score 3.622404762
Cell/Tissue List BGC823; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000620941.1; ENST00000477442.6; ENST00000613941.4; ENST00000339436.11; ENST00000373715.11; ENST00000620242.1
External Link RMBase: m6A_site_715076
mod ID: M6ASITE074810 Click to Show/Hide the Full List
mod site chr6:36596892-36596893:+ [9]
Sequence AAGTGTGTGGGTTGCTAGAAACCCACCCGGCTTTGCTTTTG
Motif Score 2.185083333
Cell/Tissue List BGC823; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000620941.1; ENST00000477442.6; ENST00000373715.11; ENST00000613941.4; ENST00000339436.11; ENST00000620242.1
External Link RMBase: m6A_site_715077
mod ID: M6ASITE074811 Click to Show/Hide the Full List
mod site chr6:36598849-36598850:+ [11]
Sequence AATATCTTTGCCCCCTCAGAACACTATGTGGCTGCCGTGTA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11; ENST00000613941.4; ENST00000477442.6; ENST00000620941.1; ENST00000339436.11
External Link RMBase: m6A_site_715078
mod ID: M6ASITE074812 Click to Show/Hide the Full List
mod site chr6:36599808-36599809:+ [8]
Sequence CCATCTATTAATAAAAATGAACCCCGTTACAGAGTCACCAT
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11; ENST00000339436.11; ENST00000620389.1; ENST00000613941.4; ENST00000620941.1; ENST00000477442.6
External Link RMBase: m6A_site_715079
mod ID: M6ASITE074813 Click to Show/Hide the Full List
mod site chr6:36600197-36600198:+ [12]
Sequence CCAACGCAACATCTGGCAAAACCTTTTCAGCAAATTCTTCC
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000339436.11; ENST00000620941.1; ENST00000620389.1; ENST00000373715.11; ENST00000477442.6
External Link RMBase: m6A_site_715080
mod ID: M6ASITE074814 Click to Show/Hide the Full List
mod site chr6:36600265-36600266:+ [12]
Sequence ACCATTTCTAGCTTGTTGAAACCCAAAACTAGTAAGTTTTT
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000339436.11; ENST00000620941.1; ENST00000477442.6
External Link RMBase: m6A_site_715081
mod ID: M6ASITE074815 Click to Show/Hide the Full List
mod site chr6:36600272-36600273:+ [12]
Sequence CTAGCTTGTTGAAACCCAAAACTAGTAAGTTTTTCCTGCTT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000339436.11; ENST00000620941.1; ENST00000620389.1; ENST00000373715.11; ENST00000477442.6
External Link RMBase: m6A_site_715082
mod ID: M6ASITE074816 Click to Show/Hide the Full List
mod site chr6:36601250-36601251:+ [13]
Sequence AGTGTTTCTGCTATTCCTAAACTTTTCCAGGTGGCTTAGTT
Motif Score 2.627720238
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000614136.1; ENST00000620389.1; ENST00000620941.1; ENST00000477442.6; ENST00000373715.11
External Link RMBase: m6A_site_715083
mod ID: M6ASITE074817 Click to Show/Hide the Full List
mod site chr6:36601760-36601761:+ [11]
Sequence GCTGTCTCGGGAGAGAAATCACAAGCCGTCCCGATCCTTCT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000620389.1; ENST00000620941.1; ENST00000614136.1; ENST00000477442.6; ENST00000373715.11
External Link RMBase: m6A_site_715084
mod ID: M6ASITE074818 Click to Show/Hide the Full List
mod site chr6:36601822-36601823:+ [14]
Sequence TTTGATAACTTGTATTTAAGACTTTGCATACATAGTATGCT
Motif Score 3.319380952
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000620941.1; ENST00000477442.6; ENST00000614136.1
External Link RMBase: m6A_site_715085
mod ID: M6ASITE074819 Click to Show/Hide the Full List
mod site chr6:36602015-36602016:+ [15]
Sequence GTTTGCAAGAGAAGTGGTGTACAGGAAATTACTTCATTTGA
Motif Score 2.856142857
Cell/Tissue List kidney; liver; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000620941.1; ENST00000614136.1; ENST00000373715.11; ENST00000477442.6; ENST00000620389.1
External Link RMBase: m6A_site_715086
mod ID: M6ASITE074820 Click to Show/Hide the Full List
mod site chr6:36602025-36602026:+ [10]
Sequence GAAGTGGTGTACAGGAAATTACTTCATTTGACAGGAGTATG
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000477442.6; ENST00000373715.11; ENST00000620389.1; ENST00000614136.1; ENST00000620941.1
External Link RMBase: m6A_site_715087
mod ID: M6ASITE074821 Click to Show/Hide the Full List
mod site chr6:36602035-36602036:+ [10]
Sequence ACAGGAAATTACTTCATTTGACAGGAGTATGTACAGAAAAT
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000614136.1; ENST00000477442.6; ENST00000620941.1
External Link RMBase: m6A_site_715088
mod ID: M6ASITE074822 Click to Show/Hide the Full List
mod site chr6:36602047-36602048:+ [10]
Sequence TTCATTTGACAGGAGTATGTACAGAAAATTCAAGTTTTGTT
Motif Score 2.856142857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11; ENST00000614136.1; ENST00000620941.1; ENST00000620389.1
External Link RMBase: m6A_site_715089
mod ID: M6ASITE074823 Click to Show/Hide the Full List
mod site chr6:36602072-36602073:+ [8]
Sequence AAATTCAAGTTTTGTTTGAGACTTCATAAGCTTGGTGCATT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000620941.1; ENST00000614136.1
External Link RMBase: m6A_site_715090
mod ID: M6ASITE074824 Click to Show/Hide the Full List
mod site chr6:36602134-36602135:+ [8]
Sequence AAATCTGTTTGTCTCTTGAAACAGTGACACAAAGGTGTAAT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11; ENST00000620941.1; ENST00000620389.1; ENST00000614136.1
External Link RMBase: m6A_site_715091
mod ID: M6ASITE074825 Click to Show/Hide the Full List
mod site chr6:36602140-36602141:+ [10]
Sequence GTTTGTCTCTTGAAACAGTGACACAAAGGTGTAATTCTCTA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000620389.1; ENST00000620941.1; ENST00000373715.11
External Link RMBase: m6A_site_715092
mod ID: M6ASITE074826 Click to Show/Hide the Full List
mod site chr6:36602206-36602207:+ [10]
Sequence ATGTAATACCAAGAATTGTTACTTTACAATGTTCCCTTAAG
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000614136.1
External Link RMBase: m6A_site_715093
mod ID: M6ASITE074827 Click to Show/Hide the Full List
mod site chr6:36602211-36602212:+ [11]
Sequence ATACCAAGAATTGTTACTTTACAATGTTCCCTTAAGCAAAA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11; ENST00000614136.1; ENST00000620389.1
External Link RMBase: m6A_site_715094
mod ID: M6ASITE074828 Click to Show/Hide the Full List
mod site chr6:36602247-36602248:+ [8]
Sequence CAAAATTGAATTTGCTTTGAACTTTTAGTTATGCACAGACT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715095
mod ID: M6ASITE074829 Click to Show/Hide the Full List
mod site chr6:36602261-36602262:+ [15]
Sequence CTTTGAACTTTTAGTTATGCACAGACTGATAATAAACCTCT
Motif Score 2.830589286
Cell/Tissue List liver; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715096
mod ID: M6ASITE074830 Click to Show/Hide the Full List
mod site chr6:36602265-36602266:+ [8]
Sequence GAACTTTTAGTTATGCACAGACTGATAATAAACCTCTAAAC
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000373715.11; ENST00000614136.1; ENST00000620389.1
External Link RMBase: m6A_site_715097
mod ID: M6ASITE074831 Click to Show/Hide the Full List
mod site chr6:36602276-36602277:+ [8]
Sequence TATGCACAGACTGATAATAAACCTCTAAACCTGCCCAGCGG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715098
mod ID: M6ASITE074832 Click to Show/Hide the Full List
mod site chr6:36602284-36602285:+ [8]
Sequence GACTGATAATAAACCTCTAAACCTGCCCAGCGGAAGTGTGT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715099
mod ID: M6ASITE074834 Click to Show/Hide the Full List
mod site chr6:36602323-36602324:+ [10]
Sequence GTTTTTTTTTAAATTTAAATACAGAAACAACTGGCAAAAAT
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715100
mod ID: M6ASITE074835 Click to Show/Hide the Full List
mod site chr6:36602329-36602330:+ [8]
Sequence TTTTAAATTTAAATACAGAAACAACTGGCAAAAATTGAACT
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000620389.1; ENST00000373715.11
External Link RMBase: m6A_site_715101
mod ID: M6ASITE074836 Click to Show/Hide the Full List
mod site chr6:36602332-36602333:+ [10]
Sequence TAAATTTAAATACAGAAACAACTGGCAAAAATTGAACTAAG
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715102
mod ID: M6ASITE074837 Click to Show/Hide the Full List
mod site chr6:36602347-36602348:+ [8]
Sequence AAACAACTGGCAAAAATTGAACTAAGATTTACTTTTTTTTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715103
mod ID: M6ASITE074838 Click to Show/Hide the Full List
mod site chr6:36602401-36602402:+ [8]
Sequence TAGGCTGCAGCTATAGTTGAACAAGCAGTCTTTAAAAACTG
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715104
mod ID: M6ASITE074839 Click to Show/Hide the Full List
mod site chr6:36602418-36602419:+ [8]
Sequence TGAACAAGCAGTCTTTAAAAACTGCTGTGAAACACAGGCCA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715105
mod ID: M6ASITE074840 Click to Show/Hide the Full List
mod site chr6:36602429-36602430:+ [8]
Sequence TCTTTAAAAACTGCTGTGAAACACAGGCCATCAGGGAAAAC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715106
mod ID: M6ASITE074841 Click to Show/Hide the Full List
mod site chr6:36602599-36602600:+ [11]
Sequence TTTGATTGCTGTATATGGATACATGGCTGTTCGTGACATTC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000620389.1; ENST00000373715.11; ENST00000614136.1
External Link RMBase: m6A_site_715107
mod ID: M6ASITE074842 Click to Show/Hide the Full List
mod site chr6:36602614-36602615:+ [10]
Sequence TGGATACATGGCTGTTCGTGACATTCTTTATGTGCAAATTT
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715108
mod ID: M6ASITE074843 Click to Show/Hide the Full List
mod site chr6:36602668-36602669:+ [11]
Sequence TGTCCTGCCAGTTTAAGGGTACATTGTAGAGCCGAACTTTG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000620389.1; ENST00000373715.11
External Link RMBase: m6A_site_715109
mod ID: M6ASITE074844 Click to Show/Hide the Full List
mod site chr6:36602683-36602684:+ [8]
Sequence AGGGTACATTGTAGAGCCGAACTTTGAGTTACTGTGCAAGA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000373715.11; ENST00000620389.1; ENST00000614136.1
External Link RMBase: m6A_site_715110
mod ID: M6ASITE074845 Click to Show/Hide the Full List
mod site chr6:36602693-36602694:+ [10]
Sequence GTAGAGCCGAACTTTGAGTTACTGTGCAAGATTTTTTTTTC
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11; ENST00000614136.1; ENST00000620389.1
External Link RMBase: m6A_site_715111
mod ID: M6ASITE074846 Click to Show/Hide the Full List
mod site chr6:36602768-36602769:+ [11]
Sequence TTGGGATTAAAGTTTTGGTTACAAATTGTTCTTTAACTTGA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000614136.1; ENST00000373715.11; ENST00000620389.1
External Link RMBase: m6A_site_715112
mod ID: M6ASITE074847 Click to Show/Hide the Full List
mod site chr6:36602783-36602784:+ [10]
Sequence TGGTTACAAATTGTTCTTTAACTTGAAAGCCTGTTTTTCCT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715113
mod ID: M6ASITE074848 Click to Show/Hide the Full List
mod site chr6:36602809-36602810:+ [8]
Sequence AAGCCTGTTTTTCCTTGCAAACTCAAATCTGTGAGCTTGGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715114
mod ID: M6ASITE074849 Click to Show/Hide the Full List
mod site chr6:36602846-36602847:+ [11]
Sequence TGGTACCAAGTCCAGGTATAACATTCCTATTGGAAGCCATA
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715115
mod ID: M6ASITE074850 Click to Show/Hide the Full List
mod site chr6:36602866-36602867:+ [10]
Sequence ACATTCCTATTGGAAGCCATACTTATATTTTCTTGTAAAGT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715116
mod ID: M6ASITE074851 Click to Show/Hide the Full List
mod site chr6:36602978-36602979:+ [11]
Sequence CCCATGGGAAGCAGTTGGTTACACGATTCTTATTTTATAAG
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715117
mod ID: M6ASITE074852 Click to Show/Hide the Full List
mod site chr6:36603001-36603002:+ [8]
Sequence CGATTCTTATTTTATAAGAAACAGCTGAGAGGCACTATGGA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715118
mod ID: M6ASITE074853 Click to Show/Hide the Full List
mod site chr6:36603132-36603133:+ [11]
Sequence TCCATAATATTTAGTGACCAACATTTTAAAGTATAGCAGCA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715119
mod ID: M6ASITE074854 Click to Show/Hide the Full List
mod site chr6:36603166-36603167:+ [8]
Sequence AGCAGCAACCTGGTTCTTAAACACAAAGTAAGTTGCCCATT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715120
mod ID: M6ASITE074855 Click to Show/Hide the Full List
mod site chr6:36603216-36603217:+ [8]
Sequence CTTTTATCTTTAGCATGAAAACTTTCCACAGGTCTAAAAAT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715121
mod ID: M6ASITE074856 Click to Show/Hide the Full List
mod site chr6:36603305-36603306:+ [11]
Sequence CCATCATGATGTAAAAGTTCACAATATGGTTCAAATGTAAC
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715122
mod ID: M6ASITE074857 Click to Show/Hide the Full List
mod site chr6:36603324-36603325:+ [11]
Sequence CACAATATGGTTCAAATGTAACAGTGCAGAATTGAATATGG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T; AML
Seq Type List MAZTER-seq; miCLIP
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715123
mod ID: M6ASITE074858 Click to Show/Hide the Full List
mod site chr6:36603654-36603655:+ [11]
Sequence GTTAAGCATGTTCAAGAAAGACACTTTTCAGACAGCCTGTT
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715124
mod ID: M6ASITE074859 Click to Show/Hide the Full List
mod site chr6:36603722-36603723:+ [11]
Sequence ATTTTGTCTTTAGTATTCTCACATAGCCTACAACCTGTTCC
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715125
mod ID: M6ASITE074860 Click to Show/Hide the Full List
mod site chr6:36603751-36603752:+ [11]
Sequence ACAACCTGTTCCTGTTAGGAACAAGCCAAGATAGCTAAGAA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715126
mod ID: M6ASITE074861 Click to Show/Hide the Full List
mod site chr6:36603800-36603801:+ [11]
Sequence AGCCATGCAATATGTCAATTACATTGCTTTTTATAAATGGA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715127
mod ID: M6ASITE074862 Click to Show/Hide the Full List
mod site chr6:36604198-36604199:+ [11]
Sequence GTGTAAAAATGAAAGGAATCACAAAACTGAACTTAGACCTG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373715.11
External Link RMBase: m6A_site_715128