m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00401)

Target Name	Suppressor of cytokine signaling 2 (SOCS2)
Synonyms	SOCS-2; Cytokine-inducible SH2 protein 2; CIS-2; STAT-induced STAT inhibitor 2; SSI-2; CIS2; SSI2; STATI2 Click to Show/Hide
Gene Name	SOCS2
Chromosomal Location	12q
Function	SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS2 appears to be a negative regulator in the growth hormone/IGF1 signaling pathway. Probable substrate recognition component of a SCF-like ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Click to Show/Hide
Gene ID	8835
Uniprot ID	SOCS2_HUMAN
HGNC ID	HGNC:19382
KEGG ID	hsa:8835

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SOCS2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Human umbilical cord blood CD34+ cells	Homo sapiens
Treatment: YTHDF2 knockdown UCB CD34+ cells Control: Wild type UCB CD34+ cells		GSE107956
Regulation		logFC: 9.71E-01 p-value: 1.71E-04
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between SOCS2 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.81E+00	GSE49339

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 is frequently up-regulated in human HCC and contributes to HCC progression. METTL3 represses Suppressor of cytokine signaling 2 (SOCS2) expression in HCC through an m6A-YTHDF2-dependent mechanism.
Target Regulation	Down regulation
Responsed Disease	Liver cancer		ICD-11: 2C12	Disease Info
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	RNA degradation (hsa03018)
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-L	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4973
In-vivo Model	For the subcutaneous implantation model, 2 × 10⁶ METTL3 stable knockdown Huh-7 cells or METTL3 overexpression MHCC97L cells were injected subcutaneously into BABL/cAnN-nude mice. For orthotopic implantation, wild-type and METTL3 knockout Huh-7 cells were luciferase labelled, and 2 × 10⁶ cells were then injected orthotopically into the left liver lobe of nude mice.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: 8.91E-01 p-value: 2.94E-04
More Results	Click to View More RNA-seq Results

In total 5 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	MiR-302a was identified to target METTL3, which could inhibit Suppressor of cytokine signaling 2 (SOCS2) expression via m6A modification in glioma.
Target Regulation	Down regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	RNA stability
In-vitro Model	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	LN-18	Glioblastoma	Homo sapiens	CVCL_0392
	HEB (human normal glial cell line HEB were obtained from Tongpai (Shanghai) biotechnology co., LTD (Shanghai, China))
In-vivo Model	Mice were subcutaneously injected with 2.5 × 10⁶ U251 cells stably infected with OE-NC, OE-JMJD1C, OE-NC and sh-NC, OE-JMJD1C and sh-NC or OE-JMJD1C and sh-SOCS2 (n = 10 in each group) in 0.1 ml PBS.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3-KO in gastric cancer cells resulted in the suppression of cell proliferation by inducing Suppressor of cytokine signaling 2 (SOCS2), suggesting a potential role of elevated METTL3 expression in gastric cancer progression.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	An increased level of METTL3 may maintain the tumorigenicity of colon cancer cells by suppressing Suppressor of cytokine signaling 2 (SOCS2).
Target Regulation	Down regulation
Responsed Disease	Colon cancer		ICD-11: 2B90	Disease Info
Cell Process	Cell proliferation
In-vitro Model	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 is frequently up-regulated in human HCC and contributes to HCC progression. METTL3 represses Suppressor of cytokine signaling 2 (SOCS2) expression in HCC through an m6A-YTHDF2-dependent mechanism.
Target Regulation	Down regulation
Responsed Disease	Liver cancer		ICD-11: 2C12	Disease Info
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	RNA degradation (hsa03018)
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-L	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4973
In-vivo Model	For the subcutaneous implantation model, 2 × 10⁶ METTL3 stable knockdown Huh-7 cells or METTL3 overexpression MHCC97L cells were injected subcutaneously into BABL/cAnN-nude mice. For orthotopic implantation, wild-type and METTL3 knockout Huh-7 cells were luciferase labelled, and 2 × 10⁶ cells were then injected orthotopically into the left liver lobe of nude mice.
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	METTL3 knock-down experiment revealed that expressions of SOCS family members SOCS1, Suppressor of cytokine signaling 2 (SOCS2), SOCS4, SOCS5, and SOCS6 were increased after METTL3 knock-down. It indicated that METTL3 is involved in the development of Graves' disease (GD) by inducing mRNA m6A methylation modification of SOCS family members.
Target Regulation	Down regulation
Responsed Disease	Graves disease		ICD-11: 5A02.0	Disease Info
In-vitro Model	PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	MiR-302a was identified to target METTL3, which could inhibit Suppressor of cytokine signaling 2 (SOCS2) expression via m6A modification in glioma.
Responsed Disease	Glioma [ICD-11: 2A00.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	RNA stability
In-vitro Model	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	LN-18	Glioblastoma	Homo sapiens	CVCL_0392
	HEB (human normal glial cell line HEB were obtained from Tongpai (Shanghai) biotechnology co., LTD (Shanghai, China))
In-vivo Model	Mice were subcutaneously injected with 2.5 × 10⁶ U251 cells stably infected with OE-NC, OE-JMJD1C, OE-NC and sh-NC, OE-JMJD1C and sh-NC or OE-JMJD1C and sh-SOCS2 (n = 10 in each group) in 0.1 ml PBS.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	In this review, we discuss the specific roles of m6A "writers", "erasers", and "readers" in normal physiology and how their altered expression promotes tumorigenesis. We also describe the potential of exploiting the aberrant expression of these enzymes for cancer diagnosis, prognosis, and the development of novel therapies. The abnormal expression of m6A regulatory enzymes affects m6A abundance and consequently dysregulates the expression of tumor suppressor genes and oncogenes, including MYC, Suppressor of cytokine signaling 2 (SOCS2), ADAM19, and PTEN.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3-KO in gastric cancer cells resulted in the suppression of cell proliferation by inducing Suppressor of cytokine signaling 2 (SOCS2), suggesting a potential role of elevated METTL3 expression in gastric cancer progression.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139

Colon cancer [ICD-11: 2B90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	An increased level of METTL3 may maintain the tumorigenicity of colon cancer cells by suppressing Suppressor of cytokine signaling 2 (SOCS2).
Responsed Disease	Colon cancer [ICD-11: 2B90]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell proliferation
In-vitro Model	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Liver cancer [ICD-11: 2C12]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 is frequently up-regulated in human HCC and contributes to HCC progression. METTL3 represses Suppressor of cytokine signaling 2 (SOCS2) expression in HCC through an m6A-YTHDF2-dependent mechanism.
Responsed Disease	Liver cancer [ICD-11: 2C12]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	RNA degradation (hsa03018)
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-L	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4973
In-vivo Model	For the subcutaneous implantation model, 2 × 10⁶ METTL3 stable knockdown Huh-7 cells or METTL3 overexpression MHCC97L cells were injected subcutaneously into BABL/cAnN-nude mice. For orthotopic implantation, wild-type and METTL3 knockout Huh-7 cells were luciferase labelled, and 2 × 10⁶ cells were then injected orthotopically into the left liver lobe of nude mice.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 is frequently up-regulated in human HCC and contributes to HCC progression. METTL3 represses Suppressor of cytokine signaling 2 (SOCS2) expression in HCC through an m6A-YTHDF2-dependent mechanism.
Responsed Disease	Liver cancer [ICD-11: 2C12]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cells proliferation
	Cells migration
	Cells invasion
	RNA degradation (hsa03018)
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-L	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4973
In-vivo Model	For the subcutaneous implantation model, 2 × 10⁶ METTL3 stable knockdown Huh-7 cells or METTL3 overexpression MHCC97L cells were injected subcutaneously into BABL/cAnN-nude mice. For orthotopic implantation, wild-type and METTL3 knockout Huh-7 cells were luciferase labelled, and 2 × 10⁶ cells were then injected orthotopically into the left liver lobe of nude mice.

Thyrotoxicosis [ICD-11: 5A02]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[5]
Response Summary	METTL3 knock-down experiment revealed that expressions of SOCS family members SOCS1, Suppressor of cytokine signaling 2 (SOCS2), SOCS4, SOCS5, and SOCS6 were increased after METTL3 knock-down. It indicated that METTL3 is involved in the development of Graves' disease (GD) by inducing mRNA m6A methylation modification of SOCS family members.
Responsed Disease	Graves disease [ICD-11: 5A02.0]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00070		Crosstalk Info
Epigenetic Regulator	tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 (NSUN6)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	m5C → m6A
Disease	Colon cancer	Disease Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03072		Crosstalk Info
Epigenetic Regulator	Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target	Histone H3 lysine 9 monomethylation (H3K9me1)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info
Crosstalk ID: M6ACROT03659		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Wilms tumor 1-associating protein (WTAP)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05155		Crosstalk Info
Epigenetic Regulator	AC115619-22aa
Regulated Target	Pre-mRNA-splicing regulator WTAP (WTAP)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05360		Crosstalk Info
Epigenetic Regulator	hsa-miR-302a
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00401)

Suppressor of cytokine signaling 2 (SOCS2)

5-methylcytidine (m5C)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000085		Click to Show/Hide the Full List
mod site	chr12:93570424-93570425:+
Sequence	TCAAGGGGACCGCCTCCGGTCCCCGGCCGTGGGCACCGGGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000340600.6; ENST00000549206.5
External Link	RMBase: m5C_site_10707
mod ID: M5CSITE000086		Click to Show/Hide the Full List
mod site	chr12:93570425-93570426:+
Sequence	CAAGGGGACCGCCTCCGGTCCCCGGCCGTGGGCACCGGGAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000340600.6; ENST00000549206.5
External Link	RMBase: m5C_site_10708
mod ID: M5CSITE000087		Click to Show/Hide the Full List
mod site	chr12:93570426-93570427:+
Sequence	AAGGGGACCGCCTCCGGTCCCCGGCCGTGGGCACCGGGACG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000340600.6; ENST00000549206.5
External Link	RMBase: m5C_site_10709
mod ID: M5CSITE000088		Click to Show/Hide the Full List
mod site	chr12:93570427-93570428:+
Sequence	AGGGGACCGCCTCCGGTCCCCGGCCGTGGGCACCGGGACGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000340600.6; ENST00000549206.5
External Link	RMBase: m5C_site_10710
mod ID: M5CSITE000089		Click to Show/Hide the Full List
mod site	chr12:93570619-93570620:+
Sequence	CCCCGTGGCAGGCCAAGGGCCAAGGATCGCTATCCTTCCCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000549206.5; ENST00000340600.6
External Link	RMBase: m5C_site_10711

N6-methyladenosine (m6A)

In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE014545		Click to Show/Hide the Full List
mod site	chr12:93570141-93570142:+		[8]
Sequence	CCCTGCAGGGAATGGCAGAGACACTCTCCGGACTGAGGGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; endometrial; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000340600.6
External Link	RMBase: m6A_site_202237
mod ID: M6ASITE014546		Click to Show/Hide the Full List
mod site	chr12:93570152-93570153:+		[8]
Sequence	ATGGCAGAGACACTCTCCGGACTGAGGGAACCGAGGCCAGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; endometrial; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000340600.6
External Link	RMBase: m6A_site_202238
mod ID: M6ASITE014547		Click to Show/Hide the Full List
mod site	chr12:93570161-93570162:+		[8]
Sequence	ACACTCTCCGGACTGAGGGAACCGAGGCCAGTCACCAAGCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; endometrial; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000340600.6
External Link	RMBase: m6A_site_202239
mod ID: M6ASITE014548		Click to Show/Hide the Full List
mod site	chr12:93570412-93570413:+		[8]
Sequence	TCCAGGACCTGATCAAGGGGACCGCCTCCGGTCCCCGGCCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549206.5; ENST00000340600.6
External Link	RMBase: m6A_site_202240
mod ID: M6ASITE014549		Click to Show/Hide the Full List
mod site	chr12:93570642-93570643:+		[8]
Sequence	GGATCGCTATCCTTCCCTGAACCCGGGCGCTCAGCTGGCCC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000340600.6; ENST00000549206.5
External Link	RMBase: m6A_site_202241
mod ID: M6ASITE014550		Click to Show/Hide the Full List
mod site	chr12:93571029-93571030:+		[8]
Sequence	GCGCACTCGCTGCTCCTGGGACCGACGTTTAACTCTTGCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000536696.6; ENST00000549206.5; ENST00000340600.6
External Link	RMBase: m6A_site_202242
mod ID: M6ASITE014551		Click to Show/Hide the Full List
mod site	chr12:93571144-93571145:+		[8]
Sequence	CCTCACCGCGTGGCCCGCGGACAGTGCGCGCCGGGGTCCCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000549206.5; ENST00000340600.6; ENST00000536696.6
External Link	RMBase: m6A_site_202243
mod ID: M6ASITE014552		Click to Show/Hide the Full List
mod site	chr12:93571357-93571358:+		[8]
Sequence	CCGGGGAAGAGAGAGTCCGAACCGCGGCTCTGCCCCGCGGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000536696.6; ENST00000549206.5; ENST00000340600.6; ENST00000548091.5
External Link	RMBase: m6A_site_202245
mod ID: M6ASITE014553		Click to Show/Hide the Full List
mod site	chr12:93571457-93571458:+		[8]
Sequence	CTTTTTTTTATTTCCCCTAAACTGCCATTCAAATTAATAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000536696.6; ENST00000548091.5; ENST00000549206.5; ENST00000340600.6; ENST00000549122.5
External Link	RMBase: m6A_site_202246
mod ID: M6ASITE014554		Click to Show/Hide the Full List
mod site	chr12:93571590-93571591:+		[8]
Sequence	AGGGTCGCAGCCGGAGGGAAACCCGGCAGCAGTCCGAGAGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549122.5; ENST00000548091.5; ENST00000536696.6; ENST00000549206.5; ENST00000340600.6
External Link	RMBase: m6A_site_202247
mod ID: M6ASITE014555		Click to Show/Hide the Full List
mod site	chr12:93571706-93571707:+		[8]
Sequence	GTGTGCCCTCTGCGCACGGAACTCCGACCGCCGCCTCCGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549122.5; ENST00000340600.6; ENST00000536696.6; ENST00000548537.1; ENST00000622746.4; ENST00000548091.5; ENST00000549206.5
External Link	RMBase: m6A_site_202250
mod ID: M6ASITE014556		Click to Show/Hide the Full List
mod site	chr12:93572047-93572048:+		[8]
Sequence	CAGCGCCCGCGGCGGCGAGAACCACCGCAGCCATCCTGGTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000548091.5; ENST00000548537.1; ENST00000549206.5; ENST00000549122.5; ENST00000622746.4; ENST00000536696.6; ENST00000340600.6; ENST00000549887.1
External Link	RMBase: m6A_site_202251
mod ID: M6ASITE014557		Click to Show/Hide the Full List
mod site	chr12:93572225-93572226:+		[8]
Sequence	GCAGCGCTTTAGGGCGGAGAACCAAGTTTGTGTGGGTGCTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549887.1; ENST00000548537.1; ENST00000549122.5; ENST00000536696.6; ENST00000549206.5; ENST00000622746.4; ENST00000548091.5; ENST00000340600.6; ENST00000547229.1
External Link	RMBase: m6A_site_202252
mod ID: M6ASITE014558		Click to Show/Hide the Full List
mod site	chr12:93572714-93572715:+		[8]
Sequence	GGTGACCGCGGCTGCGAGGGACTTTGTCATCCGTCCTCCAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; H1A; hESCs; MM6; GSC-11; HEK293T; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549206.5; ENST00000549122.5; ENST00000551556.2; ENST00000549887.1; ENST00000547229.1; ENST00000622746.4; ENST00000340600.6; ENST00000536696.6; ENST00000548537.1; ENST00000548091.5
External Link	RMBase: m6A_site_202253
mod ID: M6ASITE014559		Click to Show/Hide the Full List
mod site	chr12:93572784-93572785:+		[8]
Sequence	TCTCTCTGCCACCATTTCGGACACCCCGCAGGGACTCGTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1B; H1A; hESCs; GM12878; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000622746.4; ENST00000548537.1; ENST00000549887.1; ENST00000340600.6; ENST00000549122.5; ENST00000551556.2; ENST00000547229.1; ENST00000549206.5; ENST00000536696.6; ENST00000548091.5
External Link	RMBase: m6A_site_202254
mod ID: M6ASITE014560		Click to Show/Hide the Full List
mod site	chr12:93572797-93572798:+		[8]
Sequence	ATTTCGGACACCCCGCAGGGACTCGTTTTGGGATTCGCACT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1B; H1A; hESCs; GM12878; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548537.1; ENST00000340600.6; ENST00000622746.4; ENST00000549122.5; ENST00000549206.5; ENST00000551556.2; ENST00000536696.6; ENST00000549887.1; ENST00000547229.1; ENST00000548091.5
External Link	RMBase: m6A_site_202255
mod ID: M6ASITE014561		Click to Show/Hide the Full List
mod site	chr12:93572838-93572839:+		[8]
Sequence	GACTTCAAGGAAGGACGCGAACCCTTCTCTGACCCCAGCTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; hESCs; GM12878; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; TREX; MSC; endometrial; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000551556.2; ENST00000548537.1; ENST00000536696.6; ENST00000549122.5; ENST00000548091.5; ENST00000547229.1; ENST00000622746.4; ENST00000549206.5; ENST00000549887.1; ENST00000340600.6
External Link	RMBase: m6A_site_202256
mod ID: M6ASITE014562		Click to Show/Hide the Full List
mod site	chr12:93572960-93572961:+		[8]
Sequence	GGACGCGGAGCCAGTGGGGGACCGCGGGGTCGGCGGAGGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; GM12878; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; TREX; endometrial; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549887.1; ENST00000551556.2; ENST00000548091.5; ENST00000536696.6; ENST00000549122.5; ENST00000549206.5; ENST00000622746.4; ENST00000548537.1; ENST00000340600.6
External Link	RMBase: m6A_site_202257
mod ID: M6ASITE014563		Click to Show/Hide the Full List
mod site	chr12:93573032-93573033:+		[8]
Sequence	CCCTGCGGGAGCTCGGTCAGACAGGTAGGGAGCCGATCGGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; MM6; Jurkat; GSC-11; HEK293A-TOA; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551556.2; ENST00000549122.5; ENST00000536696.6; ENST00000549206.5; ENST00000549887.1; ENST00000622746.4; ENST00000340600.6; ENST00000548091.5; ENST00000548537.1
External Link	RMBase: m6A_site_202258
mod ID: M6ASITE014564		Click to Show/Hide the Full List
mod site	chr12:93573158-93573159:+		[8]
Sequence	ACGTCCCTTGCTTCCAAGGGACCGCGGAGAGCACGCTCGCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548091.5; ENST00000340600.6; ENST00000536696.6; ENST00000549206.5; ENST00000548537.1; ENST00000551556.2; ENST00000622746.4; ENST00000549887.1; ENST00000549122.5
External Link	RMBase: m6A_site_202259
mod ID: M6ASITE014565		Click to Show/Hide the Full List
mod site	chr12:93573485-93573486:+		[9]
Sequence	CTTGGCGGCCAAGTTCAGGGACTGACACTGCCGCGAGGGCG
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000536696.6; ENST00000340600.6; ENST00000622746.4; ENST00000549206.5; ENST00000549887.1; ENST00000548537.1; ENST00000548091.5; ENST00000551556.2; ENST00000549122.5
External Link	RMBase: m6A_site_202260
mod ID: M6ASITE014566		Click to Show/Hide the Full List
mod site	chr12:93574040-93574041:+		[8]
Sequence	GAGTTTAGGGAAGATTGTAAACTTGAAGTAGTAATTATCAC
Motif Score	2.627720238
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000340600.6; ENST00000551556.2; ENST00000549887.1; ENST00000548091.5; ENST00000536696.6; ENST00000549122.5; ENST00000622746.4; ENST00000548537.1; ENST00000549206.5
External Link	RMBase: m6A_site_202261
mod ID: M6ASITE014567		Click to Show/Hide the Full List
mod site	chr12:93574708-93574709:+		[8]
Sequence	TCTTTTCTTTTTCTTTTTGAACAAAAACCCCAGGATGGTAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536696.6; ENST00000622746.4; ENST00000548091.5; ENST00000549887.1; ENST00000549122.5; ENST00000551556.2; ENST00000549206.5; ENST00000340600.6; ENST00000548537.1
External Link	RMBase: m6A_site_202262
mod ID: M6ASITE014568		Click to Show/Hide the Full List
mod site	chr12:93574714-93574715:+		[8]
Sequence	CTTTTTCTTTTTGAACAAAAACCCCAGGATGGTACTGGGGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548537.1; ENST00000536696.6; ENST00000340600.6; ENST00000549122.5; ENST00000548091.5; ENST00000549206.5; ENST00000549887.1; ENST00000551556.2; ENST00000622746.4
External Link	RMBase: m6A_site_202263
mod ID: M6ASITE014569		Click to Show/Hide the Full List
mod site	chr12:93574741-93574742:+		[10]
Sequence	GATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAG
Motif Score	3.28175
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000549887.1; ENST00000548537.1; ENST00000549122.5; ENST00000548091.5; ENST00000549206.5; ENST00000536696.6; ENST00000622746.4; ENST00000551556.2; ENST00000340600.6
External Link	RMBase: m6A_site_202264
mod ID: M6ASITE014570		Click to Show/Hide the Full List
mod site	chr12:93574786-93574787:+		[8]
Sequence	TAAAAGAGGCACCAGAAGGAACTTTCTTGATTAGAGATAGC
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000622746.4; ENST00000536696.6; ENST00000340600.6; ENST00000549122.5; ENST00000549887.1; ENST00000551556.2; ENST00000548091.5; ENST00000549206.5; ENST00000548537.1
External Link	RMBase: m6A_site_202265
mod ID: M6ASITE014571		Click to Show/Hide the Full List
mod site	chr12:93574817-93574818:+		[8]
Sequence	TAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536696.6; ENST00000340600.6; ENST00000549887.1; ENST00000622746.4; ENST00000551556.2; ENST00000548091.5; ENST00000549206.5; ENST00000549122.5; ENST00000548537.1
External Link	RMBase: m6A_site_202266
mod ID: M6ASITE014572		Click to Show/Hide the Full List
mod site	chr12:93574843-93574844:+		[8]
Sequence	TACTAACAATATCTGTTAAAACATCAGCTGGACCAACTAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549122.5; ENST00000548091.5; ENST00000536696.6; ENST00000549887.1; ENST00000340600.6; ENST00000548537.1; ENST00000549206.5; ENST00000551556.2; ENST00000622746.4
External Link	RMBase: m6A_site_202267
mod ID: M6ASITE014573		Click to Show/Hide the Full List
mod site	chr12:93574854-93574855:+		[8]
Sequence	TCTGTTAAAACATCAGCTGGACCAACTAATCTTCGAATCGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548537.1; ENST00000549206.5; ENST00000548091.5; ENST00000536696.6; ENST00000551556.2; ENST00000549887.1; ENST00000549122.5; ENST00000622746.4; ENST00000340600.6
External Link	RMBase: m6A_site_202268
mod ID: M6ASITE014574		Click to Show/Hide the Full List
mod site	chr12:93574901-93574902:+		[8]
Sequence	AGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536696.6; ENST00000549887.1; ENST00000549206.5; ENST00000340600.6; ENST00000548091.5; ENST00000551556.2; ENST00000549122.5; ENST00000548537.1; ENST00000622746.4
External Link	RMBase: m6A_site_202269
mod ID: M6ASITE014575		Click to Show/Hide the Full List
mod site	chr12:93574932-93574933:+		[8]
Sequence	TGTGTCAAATCCAAGCTTAAACAATTTGACAGTGTGGTTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551556.2; ENST00000549887.1; ENST00000622746.4; ENST00000549122.5; ENST00000536696.6; ENST00000549206.5; ENST00000548537.1; ENST00000340600.6; ENST00000548091.5
External Link	RMBase: m6A_site_202270
mod ID: M6ASITE014576		Click to Show/Hide the Full List
mod site	chr12:93574993-93574994:+		[8]
Sequence	AGATGTGCAAGGATAAGCGGACAGGTCCAGAAGCCCCCCGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549122.5; ENST00000551556.2; ENST00000548091.5; ENST00000549887.1; ENST00000340600.6; ENST00000536696.6; ENST00000549206.5; ENST00000551883.1; ENST00000548537.1; ENST00000622746.4
External Link	RMBase: m6A_site_202271
mod ID: M6ASITE014577		Click to Show/Hide the Full List
mod site	chr12:93575043-93575044:+		[8]
Sequence	GTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551883.1; ENST00000549122.5; ENST00000340600.6; ENST00000548537.1; ENST00000549206.5; ENST00000551556.2; ENST00000536696.6; ENST00000622746.4; ENST00000549887.1
External Link	RMBase: m6A_site_202272
mod ID: M6ASITE014578		Click to Show/Hide the Full List
mod site	chr12:93575051-93575052:+		[11]
Sequence	TTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTGC
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000549206.5; ENST00000548537.1; ENST00000549122.5; ENST00000549887.1; ENST00000622746.4; ENST00000551556.2; ENST00000536696.6; ENST00000551883.1; ENST00000340600.6
External Link	RMBase: m6A_site_202273
mod ID: M6ASITE014579		Click to Show/Hide the Full List
mod site	chr12:93575096-93575097:+		[10]
Sequence	TCTCTGTAGGCTCACCATTAACAAATGTACCGGTGCCATCT
Motif Score	2.168095238
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000551556.2; ENST00000551883.1; ENST00000340600.6; ENST00000536696.6; ENST00000622746.4; ENST00000549510.1; ENST00000549206.5; ENST00000549122.5; ENST00000548537.1
External Link	RMBase: m6A_site_202274
mod ID: M6ASITE014580		Click to Show/Hide the Full List
mod site	chr12:93575121-93575122:+		[8]
Sequence	TGTACCGGTGCCATCTGGGGACTGCCTTTACCAACAAGACT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; hESCs; fibroblasts; GM12878; H1299; Huh7; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000340600.6; ENST00000622746.4; ENST00000548537.1; ENST00000551883.1; ENST00000536696.6; ENST00000549122.5; ENST00000551556.2; ENST00000549206.5; ENST00000549510.1
External Link	RMBase: m6A_site_202275
mod ID: M6ASITE014581		Click to Show/Hide the Full List
mod site	chr12:93575139-93575140:+		[8]
Sequence	GGACTGCCTTTACCAACAAGACTAAAAGATTACTTGGAAGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; hESCs; fibroblasts; GM12878; H1299; Huh7; iSLK; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; miCLIP
Transcript ID List	ENST00000551883.1; ENST00000622746.4; ENST00000549122.5; ENST00000549510.1; ENST00000548537.1; ENST00000536696.6; ENST00000551556.2; ENST00000549206.5; ENST00000340600.6
External Link	RMBase: m6A_site_202276
mod ID: M6ASITE014582		Click to Show/Hide the Full List
mod site	chr12:93575197-93575198:+		[8]
Sequence	AAATGTTTCTCTTTTTTTAAACATGTCTCACATAGAGTATC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; hESCs; fibroblasts; GM12878; LCLs; H1299; Huh7; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551883.1; ENST00000549510.1; ENST00000340600.6; ENST00000549206.5; ENST00000549122.5; ENST00000548537.1; ENST00000622746.4; ENST00000551556.2
External Link	RMBase: m6A_site_202277
mod ID: M6ASITE014583		Click to Show/Hide the Full List
mod site	chr12:93575206-93575207:+		[11]
Sequence	TCTTTTTTTAAACATGTCTCACATAGAGTATCTCCGAATGC
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000551556.2; ENST00000549206.5; ENST00000548537.1; ENST00000549510.1; ENST00000340600.6; ENST00000549122.5; ENST00000551883.1; ENST00000622746.4
External Link	RMBase: m6A_site_202278
mod ID: M6ASITE014584		Click to Show/Hide the Full List
mod site	chr12:93575243-93575244:+		[8]
Sequence	ATGCAGCTATGTAAAAGAGAACCAAAACTTGAGTGCTCTGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; LCLs; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000549510.1; ENST00000622746.4; ENST00000548537.1; ENST00000551883.1; ENST00000549122.5; ENST00000340600.6; ENST00000549206.5; ENST00000551556.2
External Link	RMBase: m6A_site_202279
mod ID: M6ASITE014585		Click to Show/Hide the Full List
mod site	chr12:93575249-93575250:+		[8]
Sequence	CTATGTAAAAGAGAACCAAAACTTGAGTGCTCTGGATAACT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; LCLs; Huh7; iSLK; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; miCLIP
Transcript ID List	ENST00000622746.4; ENST00000549206.5; ENST00000549510.1; ENST00000551883.1; ENST00000551556.2; ENST00000549122.5; ENST00000548537.1; ENST00000340600.6
External Link	RMBase: m6A_site_202280
mod ID: M6ASITE014586		Click to Show/Hide the Full List
mod site	chr12:93575290-93575291:+		[8]
Sequence	ATATGGAATGCTTTCTAAGAACAGCTGAAGCTAATCTAATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; Huh7; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000549206.5; ENST00000551883.1; ENST00000549122.5; ENST00000622746.4; ENST00000549510.1; ENST00000340600.6; ENST00000551556.2; ENST00000548537.1
External Link	RMBase: m6A_site_202281
mod ID: M6ASITE014587		Click to Show/Hide the Full List
mod site	chr12:93575403-93575404:+		[8]
Sequence	CCTTCCTAAGGCTGACCAAGACCTGTTGATCCTTTTAGATT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000548537.1; ENST00000551556.2; ENST00000549122.5; ENST00000549206.5; ENST00000551883.1; ENST00000549510.1; ENST00000622746.4; ENST00000340600.6
External Link	RMBase: m6A_site_202282
mod ID: M6ASITE014588		Click to Show/Hide the Full List
mod site	chr12:93575535-93575536:+		[8]
Sequence	GCTCCAGTAGGAGAGAAAGAACTCCTCATAGGAATACTGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549510.1; ENST00000551556.2; ENST00000548537.1; ENST00000622746.4; ENST00000549122.5; ENST00000340600.6; ENST00000549206.5; ENST00000551883.1
External Link	RMBase: m6A_site_202283
mod ID: M6ASITE014589		Click to Show/Hide the Full List
mod site	chr12:93575569-93575570:+		[8]
Sequence	TACTGAAGAAGTGGGAAGGAACCAAGCTGACACAGGCCTCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549206.5; ENST00000551556.2; ENST00000548537.1; ENST00000549510.1; ENST00000340600.6; ENST00000549122.5; ENST00000622746.4; ENST00000551883.1
External Link	RMBase: m6A_site_202284
mod ID: M6ASITE014590		Click to Show/Hide the Full List
mod site	chr12:93575840-93575841:+		[8]
Sequence	TTATTTCAGAAATATTTCAAACTGGTGCAAATGGAAAAGAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000549122.5; ENST00000551556.2; ENST00000622746.4; ENST00000340600.6; ENST00000549206.5; ENST00000548537.1; ENST00000549510.1; ENST00000551883.1
External Link	RMBase: m6A_site_202285
mod ID: M6ASITE014591		Click to Show/Hide the Full List
mod site	chr12:93575859-93575860:+		[8]
Sequence	AACTGGTGCAAATGGAAAAGACTTTCTCTTTTCCTTTAAAG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000622746.4; ENST00000551556.2; ENST00000549206.5; ENST00000548537.1; ENST00000340600.6; ENST00000549510.1; ENST00000551883.1; ENST00000549122.5
External Link	RMBase: m6A_site_202286
mod ID: M6ASITE014592		Click to Show/Hide the Full List
mod site	chr12:93575886-93575887:+		[8]
Sequence	CTTTTCCTTTAAAGCTAAAGACAAGAATATCATGCTATACA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000340600.6; ENST00000551556.2; ENST00000548537.1; ENST00000549510.1; ENST00000549122.5; ENST00000622746.4; ENST00000551883.1; ENST00000549206.5
External Link	RMBase: m6A_site_202287
mod ID: M6ASITE014593		Click to Show/Hide the Full List
mod site	chr12:93575934-93575935:+		[8]
Sequence	CTCAATCCCCGTTAATAAAAACCAATGTAGGTATAGGCATT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000551556.2; ENST00000340600.6; ENST00000622746.4; ENST00000549510.1; ENST00000549122.5; ENST00000551883.1; ENST00000549206.5; ENST00000548537.1
External Link	RMBase: m6A_site_202288

Ref 1	RNA N6-methyladenosine methyltransferase-like 3 promotes liver cancer progression through YTHDF2-dependent posttranscriptional silencing of SOCS2. Hepatology. 2018 Jun;67(6):2254-2270. doi: 10.1002/hep.29683. Epub 2018 Apr 19.
Ref 2	Histone demethylase JMJD1C promotes the polarization of M1 macrophages to prevent glioma by upregulating miR-302a. Clin Transl Med. 2021 Sep;11(9):e424. doi: 10.1002/ctm2.424.
Ref 3	Knockdown of m6A methyltransferase METTL3 in gastric cancer cells results in suppression of cell proliferation. Oncol Lett. 2020 Sep;20(3):2191-2198. doi: 10.3892/ol.2020.11794. Epub 2020 Jul 1.
Ref 4	m6A methyltransferase METTL3 maintains colon cancer tumorigenicity by suppressing SOCS2 to promote cell proliferation. Oncol Rep. 2020 Sep;44(3):973-986. doi: 10.3892/or.2020.7665. Epub 2020 Jun 26.
Ref 5	METTL3 Is Involved in the Development of Graves' Disease by Inducing SOCS mRNA m6A Modification. Front Endocrinol (Lausanne). 2021 Sep 20;12:666393. doi: 10.3389/fendo.2021.666393. eCollection 2021.
Ref 6	A new tumor-specific variant of GRP78 as target for antibody-based therapy. Lab Invest. 2008 Apr;88(4):375-86. doi: 10.1038/labinvest.2008.2. Epub 2008 Feb 11.
Ref 7	Drug-drug and food-drug pharmacokinetic interactions with new insulinotropic agents repaglinide and nateglinide. Clin Pharmacokinet. 2007;46(2):93-108. doi: 10.2165/00003088-200746020-00001.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 10	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map