m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00342)
Target Name Myeloid differentiation primary response protein MyD88 (MYD88)
Gene Name MYD88
Chromosomal Location 3p22.2
Function
Adapter protein involved in the Toll-like receptor and IL-1 receptor signaling pathway in the innate immune response. Acts via IRAK1, IRAK2, IRF7 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Increases IL-8 transcription. Involved in IL-18-mediated signaling pathway. Activates IRF1 resulting in its rapid migration into the nucleus to mediate an efficient induction of IFN-beta, NOS2/INOS, and IL12A genes. Upon TLR8 activation by GU-rich single-stranded RNA (GU-rich RNA) derived from viruses such as SARS-CoV-2, SARS-CoV and HIV-1, induces IL1B release through NLRP3 inflammasome activation. MyD88-mediated signaling in intestinal epithelial cells is crucial for maintenance of gut homeostasis and controls the expression of the antimicrobial lectin REG3G in the small intestine (By similarity).
    Click to Show/Hide
Gene ID 4615
Uniprot ID
MYD88_HUMAN
HGNC ID
HGNC:7562
KEGG ID
hsa:4615
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MYD88 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line MOLM-13 cell line Homo sapiens
Treatment: shMETTL3 MOLM13 cells
Control: MOLM13 cells
 GSE98623
Regulation
logFC: -1.07E+00
p-value: 1.83E-13
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MYD88 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 1.16E+00 GSE60213
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knocked down METTL3 and demonstrated that METTL3 depletion decreased the expression of inflammatory cytokines and the phosphorylation of IKK-alpha/beta, p65 and IKappa-B-alpha in the NF-Kappa-B signalling pathway as well as p38, ERK and JNK in the MAPK signalling pathway in LPS-induced HDPCs. METTL3 inhibits the LPS-induced inflammatory response of HDPCs by regulating alternative splicing of Myeloid differentiation primary response protein MyD88 (MYD88).
Target Regulation Down regulation
Responsed Disease Pulpitis ICD-11: DA09
 Disease Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Alternative splicing
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 positively regulates expression of Myeloid differentiation primary response protein MyD88 (MYD88), a critical upstream regulator of NF-Kappa-B signaling, by facilitating m6A methylation modification to MYD88-RNA, subsequently inducing the activation of NF-Kappa-B which is widely regarded as a repressor of osteogenesis and therefore suppressing osteogenic progression. The METTL3-mediated m6A methylation is found to be dynamically reversed by the demethylase ALKBH5.
Target Regulation Up regulation
Responsed Disease Skeletal anomaly ICD-11: LD24
 Disease Info 
Pathway Response Central carbon metabolism in cancer hsa05230
Cell Process Glucose metabolism
In-vitro Model Mesenchymal stem cell line (NP tissues were used to isolate NP cells)
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line 143B cell line Homo sapiens
Treatment: siALKBH5 transfected 143B cells
Control: siControl 143B cells
 GSE154528
Regulation
logFC: 9.11E-01
p-value: 2.76E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 positively regulates expression of Myeloid differentiation primary response protein MyD88 (MYD88), a critical upstream regulator of NF-Kappa-B signaling, by facilitating m6A methylation modification to MYD88-RNA, subsequently inducing the activation of NF-Kappa-B which is widely regarded as a repressor of osteogenesis and therefore suppressing osteogenic progression. The METTL3-mediated m6A methylation is found to be dynamically reversed by the demethylase ALKBH5.
Target Regulation Down regulation
Responsed Disease Skeletal anomaly ICD-11: LD24
 Disease Info 
Pathway Response Central carbon metabolism in cancer hsa05230
Cell Process Glucose metabolism
In-vitro Model Mesenchymal stem cell line (NP tissues were used to isolate NP cells)
RNA-binding motif protein 15 (RBM15) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by RBM15
Cell Line Human BJ Fibroblast Homo sapiens
Treatment: siRBM15 BJ fibroblast
Control: siControl BJ fibroblast
 GSE154148
Regulation
logFC: -3.36E+00
p-value: 3.10E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary RBM15 silencing inhibited the CRC growth and metastasis in vitro and in vivo. RBM15 mediated m6A methylation modification of Myeloid differentiation primary response protein MyD88 (MYD88) mRNA in colorectal cancer cells.
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Cell Process Cell proliferative
Cell invasive
In-vitro Model HCT 116 Colon carcinoma Homo sapiens CVCL_0291
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary RBM15 silencing inhibited the CRC growth and metastasis in vitro and in vivo. RBM15 mediated m6A methylation modification of Myeloid differentiation primary response protein MyD88 (MYD88) mRNA in colorectal cancer cells.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator RNA-binding motif protein 15 (RBM15) WRITER
 Regulator Info 
Target Regulation Down regulation
Cell Process Cell proliferative
Cell invasive
In-vitro Model HCT 116 Colon carcinoma Homo sapiens CVCL_0291
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
Pulpitis [ICD-11: DA09]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knocked down METTL3 and demonstrated that METTL3 depletion decreased the expression of inflammatory cytokines and the phosphorylation of IKK-alpha/beta, p65 and IKappa-B-alpha in the NF-Kappa-B signalling pathway as well as p38, ERK and JNK in the MAPK signalling pathway in LPS-induced HDPCs. METTL3 inhibits the LPS-induced inflammatory response of HDPCs by regulating alternative splicing of Myeloid differentiation primary response protein MyD88 (MYD88).
Responsed Disease Pulpitis [ICD-11: DA09]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response MAPK signaling pathway hsa04010
Cell Process Alternative splicing
Skeletal anomaly [ICD-11: LD24]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 positively regulates expression of Myeloid differentiation primary response protein MyD88 (MYD88), a critical upstream regulator of NF-Kappa-B signaling, by facilitating m6A methylation modification to MYD88-RNA, subsequently inducing the activation of NF-Kappa-B which is widely regarded as a repressor of osteogenesis and therefore suppressing osteogenic progression. The METTL3-mediated m6A methylation is found to be dynamically reversed by the demethylase ALKBH5.
Responsed Disease Skeletal anomaly [ICD-11: LD24]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Central carbon metabolism in cancer hsa05230
Cell Process Glucose metabolism
In-vitro Model Mesenchymal stem cell line (NP tissues were used to isolate NP cells)
Experiment 2 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 positively regulates expression of Myeloid differentiation primary response protein MyD88 (MYD88), a critical upstream regulator of NF-Kappa-B signaling, by facilitating m6A methylation modification to MYD88-RNA, subsequently inducing the activation of NF-Kappa-B which is widely regarded as a repressor of osteogenesis and therefore suppressing osteogenic progression. The METTL3-mediated m6A methylation is found to be dynamically reversed by the demethylase ALKBH5.
Responsed Disease Skeletal anomaly [ICD-11: LD24]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Central carbon metabolism in cancer hsa05230
Cell Process Glucose metabolism
In-vitro Model Mesenchymal stem cell line (NP tissues were used to isolate NP cells)
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00342)
Myeloid differentiation primary response protein MyD88 (MYD88)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011663 Click to Show/Hide the Full List
mod site chr3:38141149-38141150:+ [4]
Sequence AGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGG
Transcript ID List ENST00000463956.1; ENST00000484513.1; ENST00000652590.1; ENST00000417037.7; ENST00000652213.1; ENST00000421516.3; ENST00000443433.7; ENST00000648963.1; ENST00000424893.6; ENST00000650112.1; ENST00000481122.5; ENST00000650905.1; ENST00000652534.1; ENST00000495303.6; ENST00000651800.1; ENST00000416282.3; ENST00000396334.8
External Link RMBase: RNA-editing_site_95811
N6-methyladenosine (m6A)
In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE060053 Click to Show/Hide the Full List
mod site chr3:38138658-38138659:+ [5]
Sequence GAAAGAGGAAGCGCTGGCAGACAATGCGACCCGACCGCGCT
Motif Score 2.897386905
Cell/Tissue List HeLa; fibroblasts; A549; Jurkat; GSC-11; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651800.1; ENST00000396334.8; ENST00000650112.1; ENST00000495303.6; ENST00000424893.6; ENST00000417037.7; ENST00000652534.1; ENST00000652213.1; ENST00000460295.1; ENST00000416282.3
External Link RMBase: m6A_site_583356
mod ID: M6ASITE060054 Click to Show/Hide the Full List
mod site chr3:38138690-38138691:+ [5]
Sequence GACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650112.1; ENST00000417037.7; ENST00000443433.7; ENST00000652534.1; ENST00000652213.1; ENST00000396334.8; ENST00000650905.1; ENST00000495303.6; ENST00000424893.6; ENST00000460295.1; ENST00000416282.3; ENST00000421516.3; ENST00000651800.1; ENST00000652590.1; ENST00000648963.1
External Link RMBase: m6A_site_583357
mod ID: M6ASITE060055 Click to Show/Hide the Full List
mod site chr3:38138820-38138821:+ [5]
Sequence CTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650112.1; ENST00000652213.1; ENST00000460295.1; ENST00000421516.3; ENST00000650905.1; ENST00000651800.1; ENST00000424893.6; ENST00000416282.3; ENST00000648963.1; ENST00000652590.1; ENST00000495303.6; ENST00000396334.8; ENST00000443433.7; ENST00000652534.1; ENST00000417037.7
External Link RMBase: m6A_site_583358
mod ID: M6ASITE060056 Click to Show/Hide the Full List
mod site chr3:38138841-38138842:+ [5]
Sequence CACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652213.1; ENST00000651800.1; ENST00000417037.7; ENST00000416282.3; ENST00000396334.8; ENST00000652590.1; ENST00000650112.1; ENST00000424893.6; ENST00000460295.1; ENST00000421516.3; ENST00000648963.1; ENST00000652534.1; ENST00000495303.6; ENST00000650905.1; ENST00000443433.7
External Link RMBase: m6A_site_583359
mod ID: M6ASITE060057 Click to Show/Hide the Full List
mod site chr3:38138863-38138864:+ [5]
Sequence CGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000652590.1; ENST00000416282.3; ENST00000417037.7; ENST00000396334.8; ENST00000651800.1; ENST00000421516.3; ENST00000495303.6; ENST00000648963.1; ENST00000650112.1; ENST00000650905.1; ENST00000652213.1; ENST00000424893.6; ENST00000460295.1; ENST00000443433.7; ENST00000652534.1
External Link RMBase: m6A_site_583360
mod ID: M6ASITE060058 Click to Show/Hide the Full List
mod site chr3:38138895-38138896:+ [5]
Sequence TGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000648963.1; ENST00000416282.3; ENST00000443433.7; ENST00000650905.1; ENST00000652534.1; ENST00000495303.6; ENST00000652213.1; ENST00000460295.1; ENST00000651800.1; ENST00000421516.3; ENST00000417037.7; ENST00000650112.1; ENST00000396334.8; ENST00000652590.1; ENST00000424893.6
External Link RMBase: m6A_site_583361
mod ID: M6ASITE060059 Click to Show/Hide the Full List
mod site chr3:38138905-38138906:+ [5]
Sequence GCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000648963.1; ENST00000421516.3; ENST00000652590.1; ENST00000650112.1; ENST00000652534.1; ENST00000443433.7; ENST00000460295.1; ENST00000651800.1; ENST00000424893.6; ENST00000416282.3; ENST00000652213.1; ENST00000495303.6; ENST00000417037.7; ENST00000650905.1; ENST00000396334.8
External Link RMBase: m6A_site_583362
mod ID: M6ASITE060060 Click to Show/Hide the Full List
mod site chr3:38139017-38139018:+ [6]
Sequence GACGTGCTGCTGGAGCTGGGACCCAGCATTGGTGAGGACGT
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652213.1; ENST00000650905.1; ENST00000648963.1; ENST00000652590.1; ENST00000424893.6; ENST00000416282.3; ENST00000443433.7; ENST00000421516.3; ENST00000417037.7; ENST00000495303.6; ENST00000396334.8; ENST00000651800.1; ENST00000460295.1; ENST00000650112.1; ENST00000652534.1
External Link RMBase: m6A_site_583363
mod ID: M6ASITE060061 Click to Show/Hide the Full List
mod site chr3:38139160-38139161:+ [6]
Sequence AAGAAGCCTGCAGAGGGAGAACCATGCGGGTCCCGTTCCTT
Motif Score 2.930744048
Cell/Tissue List HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652213.1; ENST00000650112.1; ENST00000443433.7; ENST00000424893.6; ENST00000651800.1; ENST00000396334.8; ENST00000481122.5; ENST00000495303.6; ENST00000652590.1; ENST00000416282.3; ENST00000650905.1; ENST00000421516.3; ENST00000652534.1; ENST00000648963.1; ENST00000460295.1; ENST00000417037.7
External Link RMBase: m6A_site_583364
mod ID: M6ASITE060062 Click to Show/Hide the Full List
mod site chr3:38139211-38139212:+ [7]
Sequence GGTCGCGGTTATTAAGAAGGACTGGAGAAAGGTCCGGATAG
Motif Score 4.065041667
Cell/Tissue List HepG2; peripheral-blood; HEC-1-A; NB4; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000651800.1; ENST00000652213.1; ENST00000650905.1; ENST00000416282.3; ENST00000396334.8; ENST00000648963.1; ENST00000460295.1; ENST00000495303.6; ENST00000417037.7; ENST00000424893.6; ENST00000481122.5; ENST00000650112.1; ENST00000443433.7; ENST00000421516.3; ENST00000652534.1; ENST00000652590.1
External Link RMBase: m6A_site_583365
mod ID: M6ASITE060063 Click to Show/Hide the Full List
mod site chr3:38140472-38140473:+ [8]
Sequence GAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAA
Motif Score 2.951386905
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000650905.1; ENST00000481122.5; ENST00000417037.7; ENST00000484513.1; ENST00000652590.1; ENST00000443433.7; ENST00000421516.3; ENST00000495303.6; ENST00000416282.3; ENST00000460295.1; ENST00000396334.8; ENST00000652213.1; ENST00000424893.6; ENST00000651800.1; ENST00000650112.1; ENST00000463956.1; ENST00000652534.1; ENST00000648963.1
External Link RMBase: m6A_site_583366
mod ID: M6ASITE060064 Click to Show/Hide the Full List
mod site chr3:38140480-38140481:+ [8]
Sequence CCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTG
Motif Score 2.627720238
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000443433.7; ENST00000650905.1; ENST00000651800.1; ENST00000652213.1; ENST00000495303.6; ENST00000652590.1; ENST00000481122.5; ENST00000421516.3; ENST00000463956.1; ENST00000417037.7; ENST00000416282.3; ENST00000648963.1; ENST00000396334.8; ENST00000484513.1; ENST00000460295.1; ENST00000652534.1; ENST00000650112.1; ENST00000424893.6
External Link RMBase: m6A_site_583367
mod ID: M6ASITE060065 Click to Show/Hide the Full List
mod site chr3:38140820-38140821:+ [9]
Sequence GCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTC
Motif Score 2.876744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000443433.7; ENST00000396334.8; ENST00000651800.1; ENST00000421516.3; ENST00000417037.7; ENST00000481122.5; ENST00000424893.6; ENST00000463956.1; ENST00000495303.6; ENST00000416282.3; ENST00000652534.1; ENST00000650905.1; ENST00000484513.1; ENST00000652590.1; ENST00000650112.1; ENST00000652213.1; ENST00000648963.1
External Link RMBase: m6A_site_583368
mod ID: M6ASITE060066 Click to Show/Hide the Full List
mod site chr3:38141253-38141254:+ [7]
Sequence GCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTG
Motif Score 4.065041667
Cell/Tissue List HepG2; U2OS; H1A; H1B; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650112.1; ENST00000463956.1; ENST00000650905.1; ENST00000443433.7; ENST00000648963.1; ENST00000495303.6; ENST00000417037.7; ENST00000651800.1; ENST00000652213.1; ENST00000484513.1; ENST00000424893.6; ENST00000416282.3; ENST00000396334.8; ENST00000481122.5; ENST00000421516.3; ENST00000652534.1; ENST00000652590.1
External Link RMBase: m6A_site_583369
mod ID: M6ASITE060067 Click to Show/Hide the Full List
mod site chr3:38141288-38141289:+ [6]
Sequence GCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTG
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650905.1; ENST00000484513.1; ENST00000652213.1; ENST00000650112.1; ENST00000495303.6; ENST00000421516.3; ENST00000443433.7; ENST00000396334.8; ENST00000651800.1; ENST00000652534.1; ENST00000424893.6; ENST00000481122.5; ENST00000416282.3; ENST00000652590.1; ENST00000417037.7
External Link RMBase: m6A_site_583370
mod ID: M6ASITE060068 Click to Show/Hide the Full List
mod site chr3:38141420-38141421:+ [6]
Sequence TGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGAC
Motif Score 2.897386905
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000396334.8; ENST00000651800.1; ENST00000443433.7; ENST00000416282.3; ENST00000495303.6; ENST00000424893.6; ENST00000652590.1; ENST00000652534.1; ENST00000650112.1; ENST00000650905.1; ENST00000652213.1; ENST00000421516.3; ENST00000417037.7; ENST00000484513.1
External Link RMBase: m6A_site_583371
mod ID: M6ASITE060069 Click to Show/Hide the Full List
mod site chr3:38141439-38141440:+ [6]
Sequence GACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGC
Motif Score 3.643047619
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000396334.8; ENST00000652213.1; ENST00000650905.1; ENST00000495303.6; ENST00000652590.1; ENST00000650112.1; ENST00000421516.3; ENST00000416282.3; ENST00000417037.7; ENST00000484513.1; ENST00000443433.7; ENST00000424893.6; ENST00000652534.1; ENST00000651800.1
External Link RMBase: m6A_site_583372
mod ID: M6ASITE060070 Click to Show/Hide the Full List
mod site chr3:38141465-38141466:+ [6]
Sequence CATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCAT
Motif Score 2.930744048
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000652590.1; ENST00000651800.1; ENST00000417037.7; ENST00000421516.3; ENST00000424893.6; ENST00000652213.1; ENST00000650112.1; ENST00000396334.8; ENST00000652534.1; ENST00000416282.3; ENST00000650905.1; ENST00000495303.6; ENST00000484513.1
External Link RMBase: m6A_site_583373
mod ID: M6ASITE060071 Click to Show/Hide the Full List
mod site chr3:38141512-38141513:+ [6]
Sequence TTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGC
Motif Score 3.643047619
Cell/Tissue List HepG2; HEK293T; kidney; A549; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000484513.1; ENST00000652213.1; ENST00000651800.1; ENST00000421516.3; ENST00000417037.7; ENST00000396334.8; ENST00000652590.1; ENST00000424893.6; ENST00000652534.1; ENST00000650112.1; ENST00000495303.6; ENST00000416282.3; ENST00000650905.1
External Link RMBase: m6A_site_583374
mod ID: M6ASITE060072 Click to Show/Hide the Full List
mod site chr3:38141522-38141523:+ [6]
Sequence ATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAG
Motif Score 2.951386905
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000424893.6; ENST00000416282.3; ENST00000650112.1; ENST00000495303.6; ENST00000652213.1; ENST00000417037.7; ENST00000651800.1; ENST00000652590.1; ENST00000396334.8; ENST00000421516.3; ENST00000650905.1; ENST00000652534.1; ENST00000484513.1
External Link RMBase: m6A_site_583375
mod ID: M6ASITE060073 Click to Show/Hide the Full List
mod site chr3:38141527-38141528:+ [6]
Sequence CCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGA
Motif Score 3.622404762
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000417037.7; ENST00000652590.1; ENST00000651800.1; ENST00000396334.8; ENST00000495303.6; ENST00000650905.1; ENST00000652213.1; ENST00000421516.3; ENST00000416282.3; ENST00000484513.1; ENST00000424893.6; ENST00000650112.1; ENST00000652534.1
External Link RMBase: m6A_site_583376
mod ID: M6ASITE060074 Click to Show/Hide the Full List
mod site chr3:38141537-38141538:+ [6]
Sequence ATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGCAGAGC
Motif Score 3.319380952
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000396334.8; ENST00000652590.1; ENST00000652213.1; ENST00000651800.1; ENST00000650112.1; ENST00000417037.7; ENST00000652534.1; ENST00000495303.6; ENST00000484513.1; ENST00000424893.6; ENST00000421516.3; ENST00000416282.3; ENST00000650905.1
External Link RMBase: m6A_site_583377
mod ID: M6ASITE060075 Click to Show/Hide the Full List
mod site chr3:38141547-38141548:+ [6]
Sequence ACCAGCTGAGACTAAGAAGGACCAGCAGAGCCAGCTCAGCT
Motif Score 3.622404762
Cell/Tissue List HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000424893.6; ENST00000396334.8; ENST00000652590.1; ENST00000421516.3; ENST00000416282.3; ENST00000650112.1; ENST00000650905.1; ENST00000652534.1; ENST00000652213.1; ENST00000651800.1; ENST00000484513.1; ENST00000417037.7; ENST00000495303.6
External Link RMBase: m6A_site_583378
mod ID: M6ASITE060076 Click to Show/Hide the Full List
mod site chr3:38141579-38141580:+ [10]
Sequence AGCTCAGCTCTGAGCCATTCACACATCTTCACCCTCAGTTT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000424893.6; ENST00000416282.3; ENST00000650905.1; ENST00000651800.1; ENST00000652213.1; ENST00000484513.1; ENST00000396334.8; ENST00000417037.7; ENST00000421516.3; ENST00000652590.1; ENST00000650112.1; ENST00000652534.1; ENST00000495303.6
External Link RMBase: m6A_site_583379
mod ID: M6ASITE060077 Click to Show/Hide the Full List
mod site chr3:38141627-38141628:+ [5]
Sequence TGAGGAGTGGGATGGGGAGAACAGAGAGTAGCTGTGTTTGA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650112.1; ENST00000652534.1; ENST00000651800.1; ENST00000650905.1; ENST00000421516.3; ENST00000417037.7; ENST00000484513.1; ENST00000652213.1; ENST00000424893.6; ENST00000652590.1; ENST00000495303.6; ENST00000416282.3; ENST00000396334.8
External Link RMBase: m6A_site_583380
mod ID: M6ASITE060078 Click to Show/Hide the Full List
mod site chr3:38141695-38141696:+ [5]
Sequence CTCTGGGTCTCCTGGGGGAGACCAGGCTTGGCTGCGGGAGA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; U2OS; H1A; H1B; hESCs; HEK293T; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000396334.8; ENST00000417037.7; ENST00000652534.1; ENST00000650905.1; ENST00000651800.1; ENST00000421516.3; ENST00000484513.1; ENST00000650112.1; ENST00000416282.3; ENST00000652213.1; ENST00000652590.1
External Link RMBase: m6A_site_583381
mod ID: M6ASITE060079 Click to Show/Hide the Full List
mod site chr3:38141731-38141732:+ [5]
Sequence GGAGAGCTGGCTGTTGCTGGACTACATGCTGGCCACTGCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; U2OS; H1A; H1B; hESCs; HEK293T; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000421516.3; ENST00000650112.1; ENST00000652590.1; ENST00000652213.1; ENST00000650905.1; ENST00000396334.8; ENST00000416282.3; ENST00000651800.1; ENST00000484513.1; ENST00000417037.7; ENST00000652534.1
External Link RMBase: m6A_site_583382
mod ID: M6ASITE060080 Click to Show/Hide the Full List
mod site chr3:38141886-38141887:+ [11]
Sequence GTTTGGCCCAGCCCAAGGAGACCCCACCTTGAGCCTTATTT
Motif Score 2.876744048
Cell/Tissue List A549; U2OS; GM12878; LCLs; Huh7; peripheral-blood; iSLK; MSC; TIME; TREX; HEC-1-A; NB4; MM6
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000652213.1; ENST00000396334.8; ENST00000417037.7; ENST00000650112.1; ENST00000652534.1; ENST00000651800.1; ENST00000652590.1; ENST00000650905.1; ENST00000421516.3; ENST00000416282.3; ENST00000484513.1
External Link RMBase: m6A_site_583383
mod ID: M6ASITE060081 Click to Show/Hide the Full List
mod site chr3:38141988-38141989:+ [11]
Sequence CAGTGACAAGTCCCCAAGAGACTCGCCTGAGCAGCTTGGGC
Motif Score 3.319380952
Cell/Tissue List A549; H1A; GM12878; LCLs; Huh7; HEK293A-TOA; TREX; iSLK; HEC-1-A; NB4; MM6
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000417037.7; ENST00000652213.1; ENST00000652590.1; ENST00000421516.3; ENST00000651800.1; ENST00000416282.3; ENST00000652534.1; ENST00000484513.1; ENST00000650905.1; ENST00000650112.1; ENST00000396334.8
External Link RMBase: m6A_site_583384
mod ID: M6ASITE060082 Click to Show/Hide the Full List
mod site chr3:38142227-38142228:+ [12]
Sequence ACAAAGTTATTTGTTTACAAACAGCGACCATATAAAAGCCT
Motif Score 2.20572619
Cell/Tissue List CD34; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000652590.1; ENST00000417037.7; ENST00000650905.1; ENST00000421516.3; ENST00000484513.1; ENST00000652213.1; ENST00000396334.8; ENST00000651800.1; ENST00000650112.1; ENST00000652534.1; ENST00000416282.3
External Link RMBase: m6A_site_583385
mod ID: M6ASITE060083 Click to Show/Hide the Full List
mod site chr3:38142285-38142286:+ [12]
Sequence GGGCACATGGGCACATACAGACTCACATACAGACACACACA
Motif Score 3.319380952
Cell/Tissue List CD34; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000484513.1; ENST00000416282.3; ENST00000650112.1; ENST00000396334.8; rmsk_936837; ENST00000650905.1; ENST00000417037.7; ENST00000651800.1; ENST00000652213.1; ENST00000652590.1; ENST00000421516.3; ENST00000652534.1
External Link RMBase: m6A_site_583386
mod ID: M6ASITE060084 Click to Show/Hide the Full List
mod site chr3:38142297-38142298:+ [12]
Sequence ACATACAGACTCACATACAGACACACACATATATGTACAGA
Motif Score 2.897386905
Cell/Tissue List CD34; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000416282.3; ENST00000421516.3; ENST00000652590.1; ENST00000417037.7; ENST00000650905.1; ENST00000652213.1; rmsk_936837; ENST00000484513.1; ENST00000650112.1; ENST00000651800.1; ENST00000652534.1; ENST00000396334.8
External Link RMBase: m6A_site_583387
mod ID: M6ASITE060085 Click to Show/Hide the Full List
mod site chr3:38142317-38142318:+ [13]
Sequence ACACACACATATATGTACAGACATGTACTCTCACACACACA
Motif Score 2.897386905
Cell/Tissue List MT4; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651800.1; ENST00000396334.8; ENST00000416282.3; ENST00000652213.1; ENST00000484513.1; ENST00000652534.1; ENST00000650112.1; ENST00000652590.1; rmsk_936837; ENST00000421516.3; ENST00000650905.1; ENST00000417037.7
External Link RMBase: m6A_site_583388
mod ID: M6ASITE060086 Click to Show/Hide the Full List
mod site chr3:38142380-38142381:+ [14]
Sequence TCTAGGTACAGCTCCCAGGAACAGCTAGGTGGGAAAGTCCC
Motif Score 2.951386905
Cell/Tissue List liver; A549; MT4; Huh7
Seq Type List m6A-REF-seq; m6A-seq; MeRIP-seq
Transcript ID List ENST00000652213.1; ENST00000650112.1; ENST00000652534.1; ENST00000650905.1; ENST00000651800.1; ENST00000652590.1; ENST00000421516.3; ENST00000416282.3; ENST00000417037.7; ENST00000484513.1; ENST00000396334.8
External Link RMBase: m6A_site_583389
mod ID: M6ASITE060087 Click to Show/Hide the Full List
mod site chr3:38142431-38142432:+ [10]
Sequence GAGCCTAACCATGTCCCTGAACAAAAATTGGGCACTCATCT
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T; LCLs; Huh7
Seq Type List MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List ENST00000652590.1; ENST00000652534.1; ENST00000651800.1; ENST00000652213.1; ENST00000396334.8; ENST00000650112.1; ENST00000416282.3; ENST00000650905.1; ENST00000417037.7; ENST00000421516.3; ENST00000484513.1
External Link RMBase: m6A_site_583390
mod ID: M6ASITE060088 Click to Show/Hide the Full List
mod site chr3:38142484-38142485:+ [15]
Sequence TTGTGTCCCTACTCATTGAAACCAAACTCTGGAAAGGACCC
Motif Score 2.185083333
Cell/Tissue List A549; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650112.1; ENST00000396334.8; ENST00000417037.7; ENST00000484513.1; ENST00000652213.1; ENST00000421516.3; ENST00000651800.1; ENST00000652534.1; ENST00000652590.1; ENST00000416282.3; ENST00000650905.1
External Link RMBase: m6A_site_583391
mod ID: M6ASITE060089 Click to Show/Hide the Full List
mod site chr3:38142489-38142490:+ [15]
Sequence TCCCTACTCATTGAAACCAAACTCTGGAAAGGACCCAATGT
Motif Score 2.627720238
Cell/Tissue List A549; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000421516.3; ENST00000650905.1; ENST00000652213.1; ENST00000416282.3; ENST00000396334.8; ENST00000417037.7; ENST00000651800.1; ENST00000484513.1; ENST00000650112.1; ENST00000652590.1; ENST00000652534.1
External Link RMBase: m6A_site_583392
mod ID: M6ASITE060090 Click to Show/Hide the Full List
mod site chr3:38142501-38142502:+ [15]
Sequence GAAACCAAACTCTGGAAAGGACCCAATGTACCAGTATTTAT
Motif Score 3.622404762
Cell/Tissue List A549; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650905.1; ENST00000651800.1; ENST00000652213.1; ENST00000417037.7; ENST00000484513.1; ENST00000421516.3; ENST00000650112.1; ENST00000416282.3; ENST00000652534.1; ENST00000396334.8; ENST00000652590.1
External Link RMBase: m6A_site_583393
mod ID: M6ASITE060091 Click to Show/Hide the Full List
mod site chr3:38142562-38142563:+ [15]
Sequence AGAGGAAGAGAGCTGCTTAAACTCACACAACAATGAACTGC
Motif Score 2.627720238
Cell/Tissue List hESCs; A549; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000417037.7; ENST00000416282.3; ENST00000484513.1; ENST00000650112.1; ENST00000652590.1; ENST00000396334.8; ENST00000651800.1; ENST00000652534.1; ENST00000421516.3; ENST00000652213.1; ENST00000650905.1
External Link RMBase: m6A_site_583394
mod ID: M6ASITE060092 Click to Show/Hide the Full List
mod site chr3:38142578-38142579:+ [15]
Sequence TTAAACTCACACAACAATGAACTGCAGACACAGCTGTTCTC
Motif Score 3.373380952
Cell/Tissue List hESCs; A549; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000396334.8; ENST00000417037.7; ENST00000416282.3; ENST00000650905.1; ENST00000652213.1; ENST00000421516.3; ENST00000650112.1; ENST00000652534.1; ENST00000652590.1; ENST00000651800.1; ENST00000484513.1
External Link RMBase: m6A_site_583395
mod ID: M6ASITE060093 Click to Show/Hide the Full List
mod site chr3:38142585-38142586:+ [15]
Sequence CACACAACAATGAACTGCAGACACAGCTGTTCTCTCCCTCT
Motif Score 2.897386905
Cell/Tissue List hESCs; A549; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000650112.1; ENST00000396334.8; ENST00000417037.7; ENST00000416282.3; ENST00000652590.1; ENST00000652534.1; ENST00000650905.1; ENST00000484513.1; ENST00000652213.1; ENST00000421516.3; ENST00000651800.1
External Link RMBase: m6A_site_583396