m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00327)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MAPK1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
| In total 3 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | hnRNPA2B1 promotes colon cancer progression via the MAPK pathway. hnRNPA2B1 is an upstream regulator of the ERK/Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) pathway and inhibition of MAPK signaling blocked the effects of hnRNPA2B1. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colon cancer | ICD-11: 2B90 | ||
| Pathway Response | MAPK signaling | hsa04010 | ||
| Cell Process | Arrest cell cycle at G0/G1 phase | |||
| Cell apoptosis | ||||
| In-vitro Model | HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| In-vivo Model | Four-week-old male BALB/c nude mice (purchased from Lingchang company) were randomly divided into three groups, each group has five mice. Each of the mice was injected subcutaneously on the right lateral back with 1 × 106 of each lentivirus infected SW480 cells in which hnRNPA2B1 was knocked out or negative control cells. Mice were killed at day 29, and tumors were then isolated, photographed. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Fulvestrant | Approved | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Tamoxifen | Approved | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [5] | |||
| Response Summary | N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Gangrene or necrosis of lung | ICD-11: CA43 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Biological regulation | |||
| Cell apoptosis | ||||
| In-vitro Model | BEAS-2B | Normal | Homo sapiens | CVCL_0168 |
| In-vivo Model | After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1. | |||
YTH domain-containing family protein 3 (YTHDF3) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [5] | |||
| Response Summary | N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Gangrene or necrosis of lung | ICD-11: CA43 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Biological regulation | |||
| Cell apoptosis | ||||
| In-vitro Model | BEAS-2B | Normal | Homo sapiens | CVCL_0168 |
| In-vivo Model | After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1. | |||
Colon cancer [ICD-11: 2B90]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | hnRNPA2B1 promotes colon cancer progression via the MAPK pathway. hnRNPA2B1 is an upstream regulator of the ERK/Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) pathway and inhibition of MAPK signaling blocked the effects of hnRNPA2B1. | |||
| Responsed Disease | Colon cancer [ICD-11: 2B90] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling | hsa04010 | ||
| Cell Process | Arrest cell cycle at G0/G1 phase | |||
| Cell apoptosis | ||||
| In-vitro Model | HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| In-vivo Model | Four-week-old male BALB/c nude mice (purchased from Lingchang company) were randomly divided into three groups, each group has five mice. Each of the mice was injected subcutaneously on the right lateral back with 1 × 106 of each lentivirus infected SW480 cells in which hnRNPA2B1 was knocked out or negative control cells. Mice were killed at day 29, and tumors were then isolated, photographed. | |||
Colorectal cancer [ICD-11: 2B91]
Breast cancer [ICD-11: 2C60]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Fulvestrant | Approved | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Tamoxifen | Approved | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
Gangrene or necrosis of lung [ICD-11: CA43]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [5] | |||
| Response Summary | N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion. | |||
| Responsed Disease | Gangrene or necrosis of lung [ICD-11: CA43] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Biological regulation | |||
| Cell apoptosis | ||||
| In-vitro Model | BEAS-2B | Normal | Homo sapiens | CVCL_0168 |
| In-vivo Model | After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [5] | |||
| Response Summary | N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion. | |||
| Responsed Disease | Gangrene or necrosis of lung [ICD-11: CA43] | |||
| Target Regulator | YTH domain-containing family protein 3 (YTHDF3) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Biological regulation | |||
| Cell apoptosis | ||||
| In-vitro Model | BEAS-2B | Normal | Homo sapiens | CVCL_0168 |
| In-vivo Model | After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1. | |||
Fulvestrant
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant- resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
Tamoxifen
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [2] | |||
| Response Summary | In breast cancer, modest stable overexpression of A2B1 in MCF-7 cells (MCF-7-A2B1 cells) resulted in tamoxifen and fulvestrant - resistance whereas knockdown of A2B1 in LCC9 and LY2 cells restored tamoxifen and fulvestrant, endocrine-sensitivity. MCF-7-A2B1 cells have increased ER-alpha and reduced miR-222-3p that targets ER-alpha. MCF-7-A2B1 have activated AKT and Mitogen-activated protein kinase 1 (MAPK/ERK2/MAPK1) that depend on A2B1 expression and are growth inhibited by inhibitors of these pathways. | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell migration and invasion | |||
| In-vitro Model | HCC1806 | Breast squamous cell carcinoma | Homo sapiens | CVCL_1258 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05144 | ||
| Epigenetic Regulator | Prostate cancer associated transcript 6 (PCAT6) | |
| Regulated Target | Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Drug | Tamoxifen | |
| Crosstalk ID: M6ACROT05146 | ||
| Epigenetic Regulator | Prostate cancer associated transcript 6 (PCAT6) | |
| Regulated Target | Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Drug | Fulvestrant | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00327)
| In total 28 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE011083 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764059-21764060:- | [8] | |
| Sequence | AGAATTTCTTCAGTCCAGAGAATTCCTCCTGGCAGCCCTGT | ||
| Transcript ID List | ENST00000215832.10; ENST00000491588.1 | ||
| External Link | RMBase: RNA-editing_site_91006 | ||
| mod ID: A2ISITE011084 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764143-21764144:- | [8] | |
| Sequence | CAGCCCGTCTTGGCTTATCCACTTTGACTCCTTTGAGCCGT | ||
| Transcript ID List | ENST00000491588.1; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91007 | ||
| mod ID: A2ISITE011085 | Click to Show/Hide the Full List | ||
| mod site | chr22:21769623-21769624:- | [9] | |
| Sequence | CTCAGCCTCCTGAGTAGCTGAGATTATAGGCGTGCACCACC | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91008 | ||
| mod ID: A2ISITE011086 | Click to Show/Hide the Full List | ||
| mod site | chr22:21770222-21770223:- | [9] | |
| Sequence | CCGTGGCGCAATCTCGGCTCACTGCAACCTCCGCCTCCTGG | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91009 | ||
| mod ID: A2ISITE011087 | Click to Show/Hide the Full List | ||
| mod site | chr22:21770496-21770497:- | [9] | |
| Sequence | ACCTCCACCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCC | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91010 | ||
| mod ID: A2ISITE011088 | Click to Show/Hide the Full List | ||
| mod site | chr22:21770869-21770870:- | [9] | |
| Sequence | CAGGAGGCAGAGGTTGCAGTAAGCCGGGATCGTACCACTGC | ||
| Transcript ID List | ENST00000398822.7; rmsk_5251866; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91011 | ||
| mod ID: A2ISITE011089 | Click to Show/Hide the Full List | ||
| mod site | chr22:21777501-21777502:- | [9] | |
| Sequence | GGATTCCATCCTGGGCAACAAAGTGAGACCCTGTCTCAAAA | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1; rmsk_5251876 | ||
| External Link | RMBase: RNA-editing_site_91012 | ||
| mod ID: A2ISITE011090 | Click to Show/Hide the Full List | ||
| mod site | chr22:21789738-21789739:- | [9] | |
| Sequence | ACCTCTGCCTCCTAGGTTCAAGCAATTCTCCTGCCTCTGCC | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91013 | ||
| mod ID: A2ISITE011091 | Click to Show/Hide the Full List | ||
| mod site | chr22:21790589-21790590:- | [9] | |
| Sequence | GCTACTCAGTAGTGCCAGCTACTCAGGACCTGGCTGAGGTG | ||
| Transcript ID List | rmsk_5251919; ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91014 | ||
| mod ID: A2ISITE011092 | Click to Show/Hide the Full List | ||
| mod site | chr22:21793343-21793344:- | [9] | |
| Sequence | GACAGGGTTTTAACCATGTTAGCCAGGATGGGCTCAACCTC | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91015 | ||
| mod ID: A2ISITE011093 | Click to Show/Hide the Full List | ||
| mod site | chr22:21814507-21814508:- | [9] | |
| Sequence | TAAAATTGTTTTGGTTAATTATATGTTTTGGTAAAAAGCAT | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91016 | ||
| mod ID: A2ISITE011094 | Click to Show/Hide the Full List | ||
| mod site | chr22:21824675-21824676:- | [9] | |
| Sequence | AGTTTAGGGCTGTTAGGAATAAAGCTCCTACAGACATCTGT | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91017 | ||
| mod ID: A2ISITE011095 | Click to Show/Hide the Full List | ||
| mod site | chr22:21832823-21832824:- | [9] | |
| Sequence | TTTCAACCTGCCCCCAGATAACAGCCACGCCCACAACACTC | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91018 | ||
| mod ID: A2ISITE011096 | Click to Show/Hide the Full List | ||
| mod site | chr22:21832824-21832825:- | [9] | |
| Sequence | TTTTCAACCTGCCCCCAGATAACAGCCACGCCCACAACACT | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91019 | ||
| mod ID: A2ISITE011097 | Click to Show/Hide the Full List | ||
| mod site | chr22:21833115-21833116:- | [9] | |
| Sequence | CGTGGGTTAGTGTTGTGGGCATGGCTGCTATCTGGGGGCAG | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91020 | ||
| mod ID: A2ISITE011098 | Click to Show/Hide the Full List | ||
| mod site | chr22:21833174-21833175:- | [9] | |
| Sequence | GCGAAGACGGCACAAGTTTGAACATTCGTCCTGGAGATCAT | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91021 | ||
| mod ID: A2ISITE011099 | Click to Show/Hide the Full List | ||
| mod site | chr22:21833213-21833214:- | [10] | |
| Sequence | CAAATATACTCTATCACTTAAGTAGGTTTTCGGGAGTGAGC | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91022 | ||
| mod ID: A2ISITE011100 | Click to Show/Hide the Full List | ||
| mod site | chr22:21833214-21833215:- | [10] | |
| Sequence | TCAAATATACTCTATCACTTAAGTAGGTTTTCGGGAGTGAG | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91023 | ||
| mod ID: A2ISITE011101 | Click to Show/Hide the Full List | ||
| mod site | chr22:21844964-21844965:- | [9] | |
| Sequence | AGACGGGATTTCACCCTGTTAGCTAGGATGGTCTCCATCTG | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91024 | ||
| mod ID: A2ISITE011102 | Click to Show/Hide the Full List | ||
| mod site | chr22:21863404-21863405:- | [11] | |
| Sequence | CCGTGGCGGTGTGCGCCTGTAGTCTCAGCTGCTGGGGAGGC | ||
| Transcript ID List | rmsk_5252130; ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91025 | ||
| mod ID: A2ISITE011103 | Click to Show/Hide the Full List | ||
| mod site | chr22:21863430-21863431:- | [11] | |
| Sequence | AAAATACAAAAAAAAAAAGTAGCCGGCCGTGGCGGTGTGCG | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; rmsk_5252130; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91026 | ||
| mod ID: A2ISITE011104 | Click to Show/Hide the Full List | ||
| mod site | chr22:21863460-21863461:- | [11] | |
| Sequence | GGCTAACATGGTGAAACCCTATCTCTACTAAAAATACAAAA | ||
| Transcript ID List | rmsk_5252130; ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91027 | ||
| mod ID: A2ISITE011105 | Click to Show/Hide the Full List | ||
| mod site | chr22:21863465-21863466:- | [11] | |
| Sequence | ATCCTGGCTAACATGGTGAAACCCTATCTCTACTAAAAATA | ||
| Transcript ID List | ENST00000215832.10; rmsk_5252130; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: RNA-editing_site_91028 | ||
| mod ID: A2ISITE011106 | Click to Show/Hide the Full List | ||
| mod site | chr22:21863545-21863546:- | [11] | |
| Sequence | AGGCGCGGTGGCTCACGCCTATAATCCCAGCACTTTGGGAG | ||
| Transcript ID List | rmsk_5252130; ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91029 | ||
| mod ID: A2ISITE011107 | Click to Show/Hide the Full List | ||
| mod site | chr22:21864312-21864313:- | [11] | |
| Sequence | GCGTTTTGCCATGTTGGCCAAGATGGTCTCAAACTCCTGAC | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: RNA-editing_site_91030 | ||
| mod ID: A2ISITE011108 | Click to Show/Hide the Full List | ||
| mod site | chr22:21864333-21864334:- | [11] | |
| Sequence | TTTTGTATTTTTGTAGAGACAGCGTTTTGCCATGTTGGCCA | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91031 | ||
| mod ID: A2ISITE011109 | Click to Show/Hide the Full List | ||
| mod site | chr22:21864374-21864375:- | [11] | |
| Sequence | TGGGACTACAGGCGCGTGCCACCATGCTCAGCTAATTTTTT | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91032 | ||
| mod ID: A2ISITE011110 | Click to Show/Hide the Full List | ||
| mod site | chr22:21866247-21866248:- | [11] | |
| Sequence | CTACAGGCGCGCGACACCACGCCCGGCCCATTTTTGTATTT | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: RNA-editing_site_91033 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 129 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE056653 | Click to Show/Hide the Full List | ||
| mod site | chr22:21755942-21755943:- | [12] | |
| Sequence | GGCAGGCAATGGCTGATAAGACATGAATTTGTAAGGCGATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556847 | ||
| mod ID: M6ASITE056654 | Click to Show/Hide the Full List | ||
| mod site | chr22:21758576-21758577:- | [13] | |
| Sequence | CTAGACCCCGCCATGTCCGGACAATGATATAGAGCGTCTCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | H1B | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556848 | ||
| mod ID: M6ASITE056655 | Click to Show/Hide the Full List | ||
| mod site | chr22:21758592-21758593:- | [13] | |
| Sequence | GGTGTGGGCAGTGGTCCTAGACCCCGCCATGTCCGGACAAT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | H1A; H1B | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556849 | ||
| mod ID: M6ASITE056657 | Click to Show/Hide the Full List | ||
| mod site | chr22:21758648-21758649:- | [13] | |
| Sequence | GCTGTGGCACGTGGGCGGAGACTGAGTGGCTGGGCATGTGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | H1B | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556850 | ||
| mod ID: M6ASITE056658 | Click to Show/Hide the Full List | ||
| mod site | chr22:21758680-21758681:- | [13] | |
| Sequence | AGGTGGGATGCAACCACAGGACCAGTGGAGGGGCTGTGGCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | H1B | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556851 | ||
| mod ID: M6ASITE056659 | Click to Show/Hide the Full List | ||
| mod site | chr22:21759781-21759782:- | [12] | |
| Sequence | GCTTTCTTCCTCTGCTTCAGACTGTCAGCTGTAAAGTGGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10; rmsk_5251854 | ||
| External Link | RMBase: m6A_site_556852 | ||
| mod ID: M6ASITE056660 | Click to Show/Hide the Full List | ||
| mod site | chr22:21759855-21759856:- | [12] | |
| Sequence | CCCATCCAGCTGGGTTCAGAACTACCCCCTGCTTATAACTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_5251854; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556853 | ||
| mod ID: M6ASITE056661 | Click to Show/Hide the Full List | ||
| mod site | chr22:21759876-21759877:- | [12] | |
| Sequence | GGAAAGAGCACAGGCCTTGGACCCATCCAGCTGGGTTCAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_5251854; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556854 | ||
| mod ID: M6ASITE056662 | Click to Show/Hide the Full List | ||
| mod site | chr22:21759933-21759934:- | [12] | |
| Sequence | TGTAATGACTTATTTACAAAACAAAGATACTGGAAAATGTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556855 | ||
| mod ID: M6ASITE056663 | Click to Show/Hide the Full List | ||
| mod site | chr22:21759983-21759984:- | [12] | |
| Sequence | ATAAAGATAGGATTTCTTGGACATTTGGTTCTTATCAATAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556856 | ||
| mod ID: M6ASITE056664 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760318-21760319:- | [14] | |
| Sequence | GTCCCTGTATTACCAAAATAACACAGCACCGTGCATGTATA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556857 | ||
| mod ID: M6ASITE056665 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760368-21760369:- | [15] | |
| Sequence | ACTTGTAAAAAAAAAAAACTACAAAAAAATCCTTAGAATCA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556858 | ||
| mod ID: M6ASITE056666 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760371-21760372:- | [15] | |
| Sequence | CTGACTTGTAAAAAAAAAAAACTACAAAAAAATCCTTAGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556859 | ||
| mod ID: M6ASITE056668 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760388-21760389:- | [15] | |
| Sequence | TTGAATGTTTATGGCACCTGACTTGTAAAAAAAAAAAACTA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556860 | ||
| mod ID: M6ASITE056669 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760526-21760527:- | [15] | |
| Sequence | ATTGTTACAATTTAACATTAACATTTATTTGTGGTATTTGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556861 | ||
| mod ID: M6ASITE056670 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760532-21760533:- | [15] | |
| Sequence | CATTATATTGTTACAATTTAACATTAACATTTATTTGTGGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556862 | ||
| mod ID: M6ASITE056671 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760540-21760541:- | [15] | |
| Sequence | TGTTTATTCATTATATTGTTACAATTTAACATTAACATTTA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556863 | ||
| mod ID: M6ASITE056672 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760639-21760640:- | [15] | |
| Sequence | TGGTGCCTTCTTGGTATTGTACCCCAAAATTCTGCATAGAT | ||
| Motif Score | 2.8355 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556864 | ||
| mod ID: M6ASITE056673 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760664-21760665:- | [15] | |
| Sequence | CTGCTTTGTATCTGCTTTGTACTGTTGGTGCCTTCTTGGTA | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556865 | ||
| mod ID: M6ASITE056674 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760685-21760686:- | [15] | |
| Sequence | GCACTCAAGAAAGTTCTGAAACTGCTTTGTATCTGCTTTGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556866 | ||
| mod ID: M6ASITE056675 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760749-21760750:- | [15] | |
| Sequence | TCCAGGGTTGCACCAGGTTTACCTAAAGCTTGTTGCCTTTT | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556867 | ||
| mod ID: M6ASITE056676 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760758-21760759:- | [15] | |
| Sequence | AGCAAGTCCTCCAGGGTTGCACCAGGTTTACCTAAAGCTTG | ||
| Motif Score | 2.809946429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556868 | ||
| mod ID: M6ASITE056677 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760794-21760795:- | [14] | |
| Sequence | CTTGACATGATGGGTCAGAAACAAATGGAAATCCAGAGCAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556869 | ||
| mod ID: M6ASITE056679 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760810-21760811:- | [15] | |
| Sequence | CTCTTACGTCATCCACCTTGACATGATGGGTCAGAAACAAA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556870 | ||
| mod ID: M6ASITE056680 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760825-21760826:- | [15] | |
| Sequence | GTGAATATGTGGTTTCTCTTACGTCATCCACCTTGACATGA | ||
| Motif Score | 2.046785714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556871 | ||
| mod ID: M6ASITE056681 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760848-21760849:- | [15] | |
| Sequence | GGTGCAGATGAGAAGCTATAACAGTGAATATGTGGTTTCTC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556872 | ||
| mod ID: M6ASITE056682 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760876-21760877:- | [15] | |
| Sequence | GCTGGTGTTTGAAACATGATACTCCTGTGGTGCAGATGAGA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556873 | ||
| mod ID: M6ASITE056683 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760883-21760884:- | [15] | |
| Sequence | TTGTTATGCTGGTGTTTGAAACATGATACTCCTGTGGTGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556874 | ||
| mod ID: M6ASITE056684 | Click to Show/Hide the Full List | ||
| mod site | chr22:21760931-21760932:- | [14] | |
| Sequence | TGAGCAATCCTTTTGCTTATACATTTTTAAAGCATTTGTGC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556875 | ||
| mod ID: M6ASITE056685 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761034-21761035:- | [15] | |
| Sequence | GCTTTGGGTCCTTCCATAATACTTTTATATTTGTAAATCAA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556876 | ||
| mod ID: M6ASITE056686 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761076-21761077:- | [15] | |
| Sequence | TATGGTAACAGTATGTTAATACACACATACATACGCACACA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556877 | ||
| mod ID: M6ASITE056687 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761089-21761090:- | [15] | |
| Sequence | AACTTTTATATAGTATGGTAACAGTATGTTAATACACACAT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556878 | ||
| mod ID: M6ASITE056688 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761108-21761109:- | [15] | |
| Sequence | ATATGGTTTTTAAATTGGTAACTTTTATATAGTATGGTAAC | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556879 | ||
| mod ID: M6ASITE056690 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761158-21761159:- | [15] | |
| Sequence | ATTTCAGCCATTCAGAGGAAACTGTTTTCTCTTTATTTGCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556880 | ||
| mod ID: M6ASITE056691 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761192-21761193:- | [14] | |
| Sequence | CAAAAGTAAACTACCCAACCACATGCCACGTAATATTTCAG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556881 | ||
| mod ID: M6ASITE056692 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761248-21761249:- | [14] | |
| Sequence | ACCAGTAGCTTTGAGAAGCTACATGTAGCTCACCAGTGGTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556882 | ||
| mod ID: M6ASITE056693 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761290-21761291:- | [16] | |
| Sequence | CATTCCTTCTGCTCTTGGGCACAGGCAGTGGGTGTAGAGGT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | brain; kidney; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556883 | ||
| mod ID: M6ASITE056694 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761380-21761381:- | [17] | |
| Sequence | AAGCTAGCAGAGATACGCAGACATTGTGGCATCTGGGTAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556884 | ||
| mod ID: M6ASITE056695 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761386-21761387:- | [15] | |
| Sequence | TCCTCAAAGCTAGCAGAGATACGCAGACATTGTGGCATCTG | ||
| Motif Score | 2.084416667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556885 | ||
| mod ID: M6ASITE056696 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761413-21761414:- | [15] | |
| Sequence | ATCATGAGGACTCTGTCCTGACACAGGTCCTCAAAGCTAGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556886 | ||
| mod ID: M6ASITE056697 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761424-21761425:- | [17] | |
| Sequence | TGAAAGAACTAATCATGAGGACTCTGTCCTGACACAGGTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556887 | ||
| mod ID: M6ASITE056698 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761437-21761438:- | [17] | |
| Sequence | AGTGGGATGGAATTGAAAGAACTAATCATGAGGACTCTGTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556888 | ||
| mod ID: M6ASITE056699 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761464-21761465:- | [17] | |
| Sequence | TAGTATAAAAGAAATACTGAACAAGCCAGTGGGATGGAATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; peripheral-blood | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556889 | ||
| mod ID: M6ASITE056701 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761469-21761470:- | [15] | |
| Sequence | TCATTTAGTATAAAAGAAATACTGAACAAGCCAGTGGGATG | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556890 | ||
| mod ID: M6ASITE056702 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761503-21761504:- | [17] | |
| Sequence | AGCAAAAAATTCCTGCTGAAACATTCCAGTCCTTTCATTTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; peripheral-blood | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556891 | ||
| mod ID: M6ASITE056703 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761553-21761554:- | [17] | |
| Sequence | ATGTTCAAATAAGCTTTCAGACTAATAGCTTTTTTGGTGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556892 | ||
| mod ID: M6ASITE056704 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761593-21761594:- | [17] | |
| Sequence | ATTCATATTAGTGACACGGAACAGCACCTCCACTATTTGTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556893 | ||
| mod ID: M6ASITE056705 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761647-21761648:- | [15] | |
| Sequence | GCATCATTTTGGCTCTTCTTACATTTGTAAAAATGTACAGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556894 | ||
| mod ID: M6ASITE056706 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761742-21761743:- | [14] | |
| Sequence | CTTTTTATTAATCATGCCAAACATAATGTAACTGGGCAGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; peripheral-blood | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556895 | ||
| mod ID: M6ASITE056707 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761806-21761807:- | [18] | |
| Sequence | TGGAGTCAGATTGGCATGAAACCACTAACTTCATTCTAGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556896 | ||
| mod ID: M6ASITE056708 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761872-21761873:- | [14] | |
| Sequence | AACCATATCCTTGGCTACTAACATCTGGAGACTGTGAGCTC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556897 | ||
| mod ID: M6ASITE056709 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761932-21761933:- | [15] | |
| Sequence | TTCTTTTTAAATGGAAAGTTACTATTATAAGGTTAATTTGG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556898 | ||
| mod ID: M6ASITE056710 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761960-21761961:- | [15] | |
| Sequence | AAAGCATTGACAGTTTTATTACTCTTGTTTCTTTTTAAATG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556899 | ||
| mod ID: M6ASITE056712 | Click to Show/Hide the Full List | ||
| mod site | chr22:21761971-21761972:- | [15] | |
| Sequence | TCATTTATAAAAAAGCATTGACAGTTTTATTACTCTTGTTT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556900 | ||
| mod ID: M6ASITE056713 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762009-21762010:- | [15] | |
| Sequence | AATGTGACTGTTACCGGATAACACTGATTAGTCAGTTTTCA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556901 | ||
| mod ID: M6ASITE056714 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762017-21762018:- | [15] | |
| Sequence | GACACAGAAATGTGACTGTTACCGGATAACACTGATTAGTC | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556902 | ||
| mod ID: M6ASITE056715 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762052-21762053:- | [14] | |
| Sequence | GAGCTGCCGTCTGAAGGTCCACACAGCATTGACGGGACACA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556903 | ||
| mod ID: M6ASITE056716 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762120-21762121:- | [14] | |
| Sequence | CATCCTCGGAAAACAGACCCACATCTCTATTCTTGCCCTGA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556904 | ||
| mod ID: M6ASITE056717 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762128-21762129:- | [15] | |
| Sequence | AGCTGGCTCATCCTCGGAAAACAGACCCACATCTCTATTCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556905 | ||
| mod ID: M6ASITE056718 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762179-21762180:- | [15] | |
| Sequence | CCACCCAGCCCAGGGTGCTCACGCTCACCACTCCTGTGGCT | ||
| Motif Score | 2.021232143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556906 | ||
| mod ID: M6ASITE056719 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762216-21762217:- | [16] | |
| Sequence | GAGTTGGGAAGGGCCGCCCCACAGTACGCAGTCCTCACCAC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556907 | ||
| mod ID: M6ASITE056720 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762315-21762316:- | [14] | |
| Sequence | ACCCTAACAAAGAAGCCCCGACATCTCAGGTTGGATTCCCT | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556908 | ||
| mod ID: M6ASITE056721 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762364-21762365:- | [14] | |
| Sequence | GCTGTCATGTTCCTTTATTCACAATCTTAGGTCTCAAATAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556909 | ||
| mod ID: M6ASITE056723 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762450-21762451:- | [14] | |
| Sequence | CTGGCCCAGCACTTGGATTTACATAAGATGAGTTAGAAAGG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556910 | ||
| mod ID: M6ASITE056724 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762487-21762488:- | [15] | |
| Sequence | CAGAAATGCTCACAGGCCTCACTTTGCCGCCCAGGCACTGG | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556911 | ||
| mod ID: M6ASITE056725 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762534-21762535:- | [16] | |
| Sequence | GGATCAGCGTGTCTGAATGGACAGTCAGGTTCAGGTTGTGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556912 | ||
| mod ID: M6ASITE056726 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762588-21762589:- | [14] | |
| Sequence | AATGTACATCTTCTATCTTCACATTCATGTTAAGATTCAGT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556913 | ||
| mod ID: M6ASITE056727 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762603-21762604:- | [15] | |
| Sequence | TAATTCATGAAAATAAATGTACATCTTCTATCTTCACATTC | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556914 | ||
| mod ID: M6ASITE056728 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762638-21762639:- | [17] | |
| Sequence | AAGACTGCCTGCTAATATGAACAGAAATGCATTTGTAATTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; brain | ||
| Seq Type List | m6A-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556915 | ||
| mod ID: M6ASITE056729 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762655-21762656:- | [17] | |
| Sequence | GGAGAATGGGTTATATAAAGACTGCCTGCTAATATGAACAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556916 | ||
| mod ID: M6ASITE056730 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762683-21762684:- | [14] | |
| Sequence | TTTTTCTTGTTTGATTTTTGACAGCAATGGAGAATGGGTTA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556917 | ||
| mod ID: M6ASITE056731 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762776-21762777:- | [15] | |
| Sequence | TTACCTCTGAGTTGTGTTCCACGGAAAATGCTATCCAGCAG | ||
| Motif Score | 2.027047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556918 | ||
| mod ID: M6ASITE056732 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762805-21762806:- | [17] | |
| Sequence | TGCCTACGATTGAAATGAAAACTCTATTGTTACCTCTGAGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556919 | ||
| mod ID: M6ASITE056734 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762828-21762829:- | [14] | |
| Sequence | GAGATGACTGTCCAAGTGCCACATGCCTACGATTGAAATGA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556920 | ||
| mod ID: M6ASITE056735 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762863-21762864:- | [16] | |
| Sequence | TGTACCCTCGCATGACTGTTACAGCTTTCTGTGCAGAGATG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556921 | ||
| mod ID: M6ASITE056736 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762869-21762870:- | [19] | |
| Sequence | AATTACTGTACCCTCGCATGACTGTTACAGCTTTCTGTGCA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556922 | ||
| mod ID: M6ASITE056737 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762981-21762982:- | [15] | |
| Sequence | ATTTGTTCCTGCCACTGTGTACTGTGGAGTTGACTCGGTGT | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556923 | ||
| mod ID: M6ASITE056738 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763069-21763070:- | [17] | |
| Sequence | TTCTGATACTGCTGAGTCAGACTGTCAGAAAAAGCTAGCAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; A549; iSLK | ||
| Seq Type List | m6A-seq; DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556924 | ||
| mod ID: M6ASITE056739 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763126-21763127:- | [15] | |
| Sequence | AAAGCCTCCAGGAGCTCATGACGTGAAGCACTGTTCTGTCC | ||
| Motif Score | 2.833690476 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556925 | ||
| mod ID: M6ASITE056740 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763158-21763159:- | [14] | |
| Sequence | ATTTTTCAACCTACAGTATAACAATTTGTAATAAAGCCTCC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556926 | ||
| mod ID: M6ASITE056741 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763166-21763167:- | [16] | |
| Sequence | TCAAGTTCATTTTTCAACCTACAGTATAACAATTTGTAATA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556927 | ||
| mod ID: M6ASITE056742 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763202-21763203:- | [16] | |
| Sequence | ATACAATTCTTTTTCCTTCTACAGCATGTCAGCATCTCAAG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | kidney; HEK293T | ||
| Seq Type List | m6A-REF-seq; DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556928 | ||
| mod ID: M6ASITE056743 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763247-21763248:- | [14] | |
| Sequence | TGAGGATTTAGCAGAGAGGAACACTGCGTCTTTAAATGAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556929 | ||
| mod ID: M6ASITE056745 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763335-21763336:- | [16] | |
| Sequence | ATGTCCCAGGGTGGAACTCCACATGCTGGTGCATATACGCC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | brain; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556930 | ||
| mod ID: M6ASITE056746 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763394-21763395:- | [14] | |
| Sequence | CGACATTTGGTGAGAGAAGTACAAAGGTTGCAGTGCTGAGC | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556931 | ||
| mod ID: M6ASITE056747 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763445-21763446:- | [14] | |
| Sequence | ACTTAATGTTTGTAAGACTTACAAAAAAAGATTTAAAGTGG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556932 | ||
| mod ID: M6ASITE056748 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763493-21763494:- | [14] | |
| Sequence | TTGTACCATATAGAGGTGTAACACTTGTCAAGAAGCGTTAT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556933 | ||
| mod ID: M6ASITE056749 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763515-21763516:- | [15] | |
| Sequence | ACTCTGTAGTTACTGTGGTCACTTGTACCATATAGAGGTGT | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556934 | ||
| mod ID: M6ASITE056750 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763524-21763525:- | [15] | |
| Sequence | AGCAGTGTCACTCTGTAGTTACTGTGGTCACTTGTACCATA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556935 | ||
| mod ID: M6ASITE056751 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763624-21763625:- | [15] | |
| Sequence | TCATATCATGGTAGTCACTAACATATATAAGGTATGTGCTA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556936 | ||
| mod ID: M6ASITE056752 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763654-21763655:- | [15] | |
| Sequence | TCCTTGGGGAGCACTTGTCCACGTCTTTTCTCATATCATGG | ||
| Motif Score | 2.027047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556937 | ||
| mod ID: M6ASITE056753 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763772-21763773:- | [15] | |
| Sequence | AGTGACAGCCCCTTATTTGCACTTCACCTTTTGACCATAAC | ||
| Motif Score | 3.252583333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556938 | ||
| mod ID: M6ASITE056754 | Click to Show/Hide the Full List | ||
| mod site | chr22:21763893-21763894:- | [15] | |
| Sequence | TTCTACATGATGCCCTGCTGACCATGCAGCCGCACCAGAGA | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556939 | ||
| mod ID: M6ASITE056756 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764137-21764138:- | [15] | |
| Sequence | GTCTTGGCTTATCCACTTTGACTCCTTTGAGCCGTTTGGAG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000491588.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556940 | ||
| mod ID: M6ASITE056757 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764208-21764209:- | [17] | |
| Sequence | AGAGGACTGGACGTGCTCAGACATCGGTGTTCTTCTTCCCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; Jurkat | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000491588.1 | ||
| External Link | RMBase: m6A_site_556941 | ||
| mod ID: M6ASITE056758 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764223-21764224:- | [17] | |
| Sequence | ATAGGACAAGGGCTCAGAGGACTGGACGTGCTCAGACATCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; Jurkat | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000491588.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556942 | ||
| mod ID: M6ASITE056759 | Click to Show/Hide the Full List | ||
| mod site | chr22:21764238-21764239:- | [16] | |
| Sequence | TCTGTTTGTGTTTCTATAGGACAAGGGCTCAGAGGACTGGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | brain; kidney; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000491588.1 | ||
| External Link | RMBase: m6A_site_556943 | ||
| mod ID: M6ASITE056760 | Click to Show/Hide the Full List | ||
| mod site | chr22:21769213-21769214:- | [16] | |
| Sequence | TGCTAGATTCCAGCCAGGATACAGATCTTAAATTTGTCAGG | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | kidney; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000491588.1; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556944 | ||
| mod ID: M6ASITE056761 | Click to Show/Hide the Full List | ||
| mod site | chr22:21769235-21769236:- | [17] | |
| Sequence | AAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; Jurkat | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000491588.1; ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556945 | ||
| mod ID: M6ASITE056762 | Click to Show/Hide the Full List | ||
| mod site | chr22:21769251-21769252:- | [17] | |
| Sequence | CCTAAGGAAAAGCTCAAAGAACTAATTTTTGAAGAGACTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Jurkat | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000491588.1; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556946 | ||
| mod ID: M6ASITE056763 | Click to Show/Hide the Full List | ||
| mod site | chr22:21769291-21769292:- | [16] | |
| Sequence | CGAAGCACCATTCAAGTTCGACATGGAATTGGATGACTTGC | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | brain; kidney; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000491588.1; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556947 | ||
| mod ID: M6ASITE056764 | Click to Show/Hide the Full List | ||
| mod site | chr22:21772923-21772924:- | [17] | |
| Sequence | CACAAGAGGATTGAAGTAGAACAGGCTCTGGCCCACCCATA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556948 | ||
| mod ID: M6ASITE056765 | Click to Show/Hide the Full List | ||
| mod site | chr22:21772966-21772967:- | [17] | |
| Sequence | TATAGCTCTGGACTTATTGGACAAAATGTTGACATTCAACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556949 | ||
| mod ID: M6ASITE056767 | Click to Show/Hide the Full List | ||
| mod site | chr22:21772975-21772976:- | [17] | |
| Sequence | CTTTCTCTTTATAGCTCTGGACTTATTGGACAAAATGTTGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556950 | ||
| mod ID: M6ASITE056768 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788285-21788286:- | [17] | |
| Sequence | CAAAAATAAGGTGCCATGGAACAGGCTGTTCCCAAATGCTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556951 | ||
| mod ID: M6ASITE056769 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788308-21788309:- | [14] | |
| Sequence | AACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCATG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556952 | ||
| mod ID: M6ASITE056770 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788327-21788328:- | [17] | |
| Sequence | AATAAATTTAAAAGCTAGGAACTATTTGCTTTCTCTTCCAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556953 | ||
| mod ID: M6ASITE056771 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788360-21788361:- | [17] | |
| Sequence | TGGATCCCCATCACAAGAAGACCTGAATTGTATAATAAATT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556954 | ||
| mod ID: M6ASITE056772 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788368-21788369:- | [14] | |
| Sequence | GGTATTCTTGGATCCCCATCACAAGAAGACCTGAATTGTAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556955 | ||
| mod ID: M6ASITE056773 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788701-21788702:- | [14] | |
| Sequence | TTATCTTGACCAGCTGAACCACATTTTGGGTAAGGTTCCCG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556956 | ||
| mod ID: M6ASITE056774 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788704-21788705:- | [17] | |
| Sequence | GCATTATCTTGACCAGCTGAACCACATTTTGGGTAAGGTTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556957 | ||
| mod ID: M6ASITE056775 | Click to Show/Hide the Full List | ||
| mod site | chr22:21788803-21788804:- | [14] | |
| Sequence | TCTCTTTCTCCTGCAGGGCTACACCAAGTCCATTGATATTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556958 | ||
| mod ID: M6ASITE056776 | Click to Show/Hide the Full List | ||
| mod site | chr22:21799081-21799082:- | [14] | |
| Sequence | TGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556959 | ||
| mod ID: M6ASITE056778 | Click to Show/Hide the Full List | ||
| mod site | chr22:21799090-21799091:- | [17] | |
| Sequence | GGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556960 | ||
| mod ID: M6ASITE056779 | Click to Show/Hide the Full List | ||
| mod site | chr22:21805868-21805869:- | [14] | |
| Sequence | GCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGG | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556961 | ||
| mod ID: M6ASITE056780 | Click to Show/Hide the Full List | ||
| mod site | chr22:21805984-21805985:- | [14] | |
| Sequence | TACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATAT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556962 | ||
| mod ID: M6ASITE056781 | Click to Show/Hide the Full List | ||
| mod site | chr22:21805989-21805990:- | [17] | |
| Sequence | ATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556963 | ||
| mod ID: M6ASITE056782 | Click to Show/Hide the Full List | ||
| mod site | chr22:21806013-21806014:- | [17] | |
| Sequence | TAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000544786.1; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556964 | ||
| mod ID: M6ASITE056783 | Click to Show/Hide the Full List | ||
| mod site | chr22:21806024-21806025:- | [17] | |
| Sequence | AAACAGATATATAGTACAGGACCTCATGGAAACAGATCTTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556965 | ||
| mod ID: M6ASITE056784 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807702-21807703:- | [14] | |
| Sequence | GAACATCATTGGAATCAATGACATTATTCGAGCACCAACCA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556966 | ||
| mod ID: M6ASITE056785 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807720-21807721:- | [17] | |
| Sequence | ACTGCGCTTCAGACATGAGAACATCATTGGAATCAATGACA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556967 | ||
| mod ID: M6ASITE056786 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807728-21807729:- | [17] | |
| Sequence | AAAATCTTACTGCGCTTCAGACATGAGAACATCATTGGAAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556968 | ||
| mod ID: M6ASITE056787 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807763-21807764:- | [17] | |
| Sequence | ACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAAAAATC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7; ENST00000544786.1 | ||
| External Link | RMBase: m6A_site_556969 | ||
| mod ID: M6ASITE056789 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807778-21807779:- | [17] | |
| Sequence | TCAGCCCCTTTGAGCACCAGACCTACTGCCAGAGAACCCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556970 | ||
| mod ID: M6ASITE056790 | Click to Show/Hide the Full List | ||
| mod site | chr22:21807825-21807826:- | [14] | |
| Sequence | CTCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCA | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556971 | ||
| mod ID: M6ASITE056791 | Click to Show/Hide the Full List | ||
| mod site | chr22:21867351-21867352:- | [14] | |
| Sequence | GCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTACG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000544786.1; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556972 | ||
| mod ID: M6ASITE056792 | Click to Show/Hide the Full List | ||
| mod site | chr22:21867366-21867367:- | [14] | |
| Sequence | GTTCGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000544786.1; ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556973 | ||
| mod ID: M6ASITE056793 | Click to Show/Hide the Full List | ||
| mod site | chr22:21867441-21867442:- | [14] | |
| Sequence | CGGCGGCGGCCCGGCAGCCAACATGGCGGCGGCGGCGGCGG | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000215832.10; ENST00000398822.7 | ||
| External Link | RMBase: m6A_site_556974 | ||
| mod ID: M6ASITE056794 | Click to Show/Hide the Full List | ||
| mod site | chr22:21867510-21867511:- | [14] | |
| Sequence | CAGTCCCTGCGGGAGGGGCGACAAGAGCTGAGCGGCGGCCG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000398822.7; ENST00000215832.10 | ||
| External Link | RMBase: m6A_site_556975 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000177 | Click to Show/Hide the Full List | ||
| mod site | chr22:21762149-21762150:- | [20] | |
| Sequence | CTCCTGTGGCTGAGGAAGGATAGCTGGCTCATCCTCGGAAA | ||
| Transcript ID List | ENST00000215832.10 | ||
| External Link | RMBase: Pseudo_site_3409 | ||
References