m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00299)

Target Name	Tyrosine-protein kinase JAK2 (JAK2)
Synonyms	Janus kinase 2; JAK-2 Click to Show/Hide
Gene Name	JAK2
Chromosomal Location	9p24.1
Family	protein kinase superfamily; Tyr protein kinase family; JAK subfamily
Function	Non-receptor tyrosine kinase involved in various processes such as cell growth, development, differentiation or histone modifications. Mediates essential signaling events in both innate and adaptive immunity. In the cytoplasm, plays a pivotal role in signal transduction via its association with type I receptors such as growth hormone (GHR), prolactin (PRLR), leptin (LEPR), erythropoietin (EPOR), thrombopoietin (THPO); or type II receptors including IFN-alpha, IFN-beta, IFN-gamma and multiple interleukins. Following ligand-binding to cell surface receptors, phosphorylates specific tyrosine residues on the cytoplasmic tails of the receptor, creating docking sites for STATs proteins. Subsequently, phosphorylates the STATs proteins once they are recruited to the receptor. Phosphorylated STATs then form homodimer or heterodimers and translocate to the nucleus to activate gene transcription. For example, cell stimulation with erythropoietin (EPO) during erythropoiesis leads to JAK2 autophosphorylation, activation, and its association with erythropoietin receptor (EPOR) that becomes phosphorylated in its cytoplasmic domain. Then, STAT5 (STAT5A or STAT5B) is recruited, phosphorylated and activated by JAK2. Once activated, dimerized STAT5 translocates into the nucleus and promotes the transcription of several essential genes involved in the modulation of erythropoiesis. Part of a signaling cascade that is activated by increased cellular retinol and that leads to the activation of STAT5 (STAT5A or STAT5B). In addition, JAK2 mediates angiotensin-2-induced ARHGEF1 phosphorylation. Plays a role in cell cycle by phosphorylating CDKN1B. Cooperates with TEC through reciprocal phosphorylation to mediate cytokine-driven activation of FOS transcription. In the nucleus, plays a key role in chromatin by specifically mediating phosphorylation of 'Tyr-41' of histone H3 (H3Y41ph), a specific tag that promotes exclusion of CBX5 (HP1 alpha) from chromatin. Click to Show/Hide
Gene ID	3717
Uniprot ID	JAK2_HUMAN
HGNC ID	HGNC:6192
KEGG ID	hsa:3717

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

JAK2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Raw 264.7 cell line	Mus musculus
Treatment: METTL3 knockout Raw 264.7 cells Control: Wild type Raw 264.7 cells		GSE162248
Regulation		logFC: -7.87E-01 p-value: 4.26E-20
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between JAK2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 7.70E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 knockdown prevented Atherosclerosis progression by inhibiting Tyrosine-protein kinase JAK2 (JAK2)/STAT3 pathway via IGF2BP1.
Target Regulation	Up regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
Cell Process	Cell proliferation and migration
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	The adeno-associated viruses (AAV) that could silence METTL3 (sh-METTL3) and the negative control adeno-associated viruses (sh-NC) were obtained from WZ Biosciences Inc. (Jinan, China). APOE^-/- mice were randomly divided into AS + sh-NC and AS + sh-METTL3 groups. Each group contains five mice. Mice were fed with the standard diet for 1 week to acclimatize. After 1 week of acclimation, mice were challenged with a high-fat and high-cholesterol feed H10⁵40 (Beijing HFK BIOSCIENCE Co., Ltd., Beijing, China). The formula of the H10⁵40 feed was shown in Supplementary File S1. After 8 weeks of HFD feeding, sh-NC or sh-METTL3 adeno-associated virus serotype 9 (AAV9, 1012 viral genome copies per mouse) were respectively delivered into mice in AS + sh-NC or AS + sh-METTL3 group through tail vein injection. At 14 weeks after HDF feeding, mice fasted overnight.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 9.68E-01 p-value: 1.29E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	FTO inhibits adipocytes apoptosis via reducing m6A epigenetic modification-mediated UPRmt.UPRmt-induced increase in PKR and eIF2-alpha phosphorylation, and ATF5-mediated upregulation of BAX expression promoted apoptosis. Furthermore, adipocytes apoptosis is inhibited by FTO-activated Tyrosine-protein kinase JAK2 (JAK2)/STAT3 signaling pathway .
Pathway Response	Adipocytokine signaling pathway			hsa04920
	JAK-STAT signaling pathway			hsa04630
Cell Process	Mitochondria-dependent apoptosis
	Cell apoptosis
In-vitro Model	3T3-L1	Normal	Mus musculus	CVCL_0123
In-vivo Model	Mice were provided adlibitum with water and a standard laboratory chow diet. The animal room was held a standard temperature, humidity and illumination. After intraperitoneal injection of FTO overexpression vector and NR to mice for 7 days, inguinal white adipose tissue (iWAT) were collected from mice.

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: siIGF2BP1 HepG2 cells Control: siControl HepG2 cells		GSE161086
Regulation		logFC: -1.30E+00 p-value: 1.73E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 knockdown prevented Atherosclerosis progression by inhibiting Tyrosine-protein kinase JAK2 (JAK2)/STAT3 pathway via IGF2BP1.
Target Regulation	Up regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
Cell Process	Cell proliferation and migration
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	The adeno-associated viruses (AAV) that could silence METTL3 (sh-METTL3) and the negative control adeno-associated viruses (sh-NC) were obtained from WZ Biosciences Inc. (Jinan, China). APOE^-/- mice were randomly divided into AS + sh-NC and AS + sh-METTL3 groups. Each group contains five mice. Mice were fed with the standard diet for 1 week to acclimatize. After 1 week of acclimation, mice were challenged with a high-fat and high-cholesterol feed H10⁵40 (Beijing HFK BIOSCIENCE Co., Ltd., Beijing, China). The formula of the H10⁵40 feed was shown in Supplementary File S1. After 8 weeks of HFD feeding, sh-NC or sh-METTL3 adeno-associated virus serotype 9 (AAV9, 1012 viral genome copies per mouse) were respectively delivered into mice in AS + sh-NC or AS + sh-METTL3 group through tail vein injection. At 14 weeks after HDF feeding, mice fasted overnight.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	NOMO-1 cell line	Homo sapiens
Treatment: shALKBH5 NOMO-1 cells Control: shNS NOMO-1 cells		GSE144968
Regulation		logFC: 1.17E+00 p-value: 2.74E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	The ALKBH5-HOXA10 loop jointly activates the JAK2/STAT3 signaling pathway by mediating Tyrosine-protein kinase JAK2 (JAK2) m6A demethylation, promoting epithelial ovarian cancer resistance to cisplatin.
Target Regulation	Up regulation
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary		ICD-11: 2B5D.0	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
In-vitro Model	HO8910-DDP (HO8910 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell lines HO8910-DDP)
	HO-8910	Endocervical adenocarcinoma	Homo sapiens	CVCL_6868
	A2780-DDP (A2780 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell line)
	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
In-vivo Model	About 5× 10⁶ cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4 week-old, 18-20 g). When the average tumor size reached approximately 100mm³ (after 1 week), mice were then randomized into two groups and treated with cisplatin (5 mg/kg) or normal saline (NS) weekly.

Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	The ALKBH5-HOXA10 loop jointly activates the JAK2/STAT3 signaling pathway by mediating Tyrosine-protein kinase JAK2 (JAK2) m6A demethylation, promoting epithelial ovarian cancer resistance to cisplatin.
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
In-vitro Model	HO8910-DDP (HO8910 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell lines HO8910-DDP)
	HO-8910	Endocervical adenocarcinoma	Homo sapiens	CVCL_6868
	A2780-DDP (A2780 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell line)
	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
In-vivo Model	About 5× 10⁶ cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4 week-old, 18-20 g). When the average tumor size reached approximately 100mm³ (after 1 week), mice were then randomized into two groups and treated with cisplatin (5 mg/kg) or normal saline (NS) weekly.

Atherosclerosis [ICD-11: BD40]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 knockdown prevented Atherosclerosis progression by inhibiting Tyrosine-protein kinase JAK2 (JAK2)/STAT3 pathway via IGF2BP1.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	JAK-STAT signaling pathway			hsa04630
Cell Process	Cell proliferation and migration
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	The adeno-associated viruses (AAV) that could silence METTL3 (sh-METTL3) and the negative control adeno-associated viruses (sh-NC) were obtained from WZ Biosciences Inc. (Jinan, China). APOE^-/- mice were randomly divided into AS + sh-NC and AS + sh-METTL3 groups. Each group contains five mice. Mice were fed with the standard diet for 1 week to acclimatize. After 1 week of acclimation, mice were challenged with a high-fat and high-cholesterol feed H10⁵40 (Beijing HFK BIOSCIENCE Co., Ltd., Beijing, China). The formula of the H10⁵40 feed was shown in Supplementary File S1. After 8 weeks of HFD feeding, sh-NC or sh-METTL3 adeno-associated virus serotype 9 (AAV9, 1012 viral genome copies per mouse) were respectively delivered into mice in AS + sh-NC or AS + sh-METTL3 group through tail vein injection. At 14 weeks after HDF feeding, mice fasted overnight.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 knockdown prevented Atherosclerosis progression by inhibiting Tyrosine-protein kinase JAK2 (JAK2)/STAT3 pathway via IGF2BP1.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	JAK-STAT signaling pathway			hsa04630
Cell Process	Cell proliferation and migration
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	The adeno-associated viruses (AAV) that could silence METTL3 (sh-METTL3) and the negative control adeno-associated viruses (sh-NC) were obtained from WZ Biosciences Inc. (Jinan, China). APOE^-/- mice were randomly divided into AS + sh-NC and AS + sh-METTL3 groups. Each group contains five mice. Mice were fed with the standard diet for 1 week to acclimatize. After 1 week of acclimation, mice were challenged with a high-fat and high-cholesterol feed H10⁵40 (Beijing HFK BIOSCIENCE Co., Ltd., Beijing, China). The formula of the H10⁵40 feed was shown in Supplementary File S1. After 8 weeks of HFD feeding, sh-NC or sh-METTL3 adeno-associated virus serotype 9 (AAV9, 1012 viral genome copies per mouse) were respectively delivered into mice in AS + sh-NC or AS + sh-METTL3 group through tail vein injection. At 14 weeks after HDF feeding, mice fasted overnight.

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	The ALKBH5-HOXA10 loop jointly activates the JAK2/STAT3 signaling pathway by mediating Tyrosine-protein kinase JAK2 (JAK2) m6A demethylation, promoting epithelial ovarian cancer resistance to cisplatin.
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary		ICD-11: 2B5D.0	Disease Info
Pathway Response	JAK-STAT signaling pathway			hsa04630
In-vitro Model	HO8910-DDP (HO8910 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell lines HO8910-DDP)
	HO-8910	Endocervical adenocarcinoma	Homo sapiens	CVCL_6868
	A2780-DDP (A2780 underwent continuous stepwise exposure to increasing concentrations of cisplatin to create the cisplatin-resistant cell line)
	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
In-vivo Model	About 5× 10⁶ cells were injected subcutaneously into the axilla of the female athymic BALB/C nude mice (4 week-old, 18-20 g). When the average tumor size reached approximately 100mm³ (after 1 week), mice were then randomized into two groups and treated with cisplatin (5 mg/kg) or normal saline (NS) weekly.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00299)

Tyrosine-protein kinase JAK2 (JAK2)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003070		Click to Show/Hide the Full List
mod site	chr9:5120527-5120528:+		[4]
Sequence	CTAACAATATGGTTGACGGTAATAACTGGGGGAAAAAGTGC
Transcript ID List	ENST00000381652.3
External Link	RMBase: RNA-editing_site_134209

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004381		Click to Show/Hide the Full List
mod site	chr9:5109394-5109395:+		[5]
Sequence	AAGAACTGCTAACTCATGCCCCCATGCCTAACAATATGGCT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m5C_site_42334
mod ID: M5CSITE004382		Click to Show/Hide the Full List
mod site	chr9:5109395-5109396:+		[5]
Sequence	AGAACTGCTAACTCATGCCCCCATGCCTAACAATATGGCTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m5C_site_42335
mod ID: M5CSITE004383		Click to Show/Hide the Full List
mod site	chr9:5109396-5109397:+		[5]
Sequence	GAACTGCTAACTCATGCCCCCATGCCTAACAATATGGCTTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m5C_site_42336

N6-methyladenosine (m6A)

In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087547		Click to Show/Hide the Full List
mod site	chr9:4985095-4985096:+		[6]
Sequence	GTCTCCTGCCATTCGGGGAGACTGCAGGCCAACCGGGAGGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; GSC-11; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000476574.5
External Link	RMBase: m6A_site_815327
mod ID: M6ASITE087548		Click to Show/Hide the Full List
mod site	chr9:4985557-4985558:+		[7]
Sequence	CCCGTCCCGGGGCTTCGCAGACCTTGACCCGCCGGGTAGGA
Motif Score	2.876744048
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000476574.5; ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815328
mod ID: M6ASITE087549		Click to Show/Hide the Full List
mod site	chr9:4985961-4985962:+		[6]
Sequence	TTCAGAAGCAGGCAACAGGAACAAGATGTGAACTGTTTCTC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476574.5; ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815329
mod ID: M6ASITE087550		Click to Show/Hide the Full List
mod site	chr9:4985972-4985973:+		[6]
Sequence	GCAACAGGAACAAGATGTGAACTGTTTCTCTTCTGCAGAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1; ENST00000476574.5
External Link	RMBase: m6A_site_815330
mod ID: M6ASITE087551		Click to Show/Hide the Full List
mod site	chr9:5021980-5021981:+		[6]
Sequence	AGGCAAATGTTCTGAAAAAGACTCTGCATGGGAATGGCCTG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3; ENST00000476574.5
External Link	RMBase: m6A_site_815331
mod ID: M6ASITE087552		Click to Show/Hide the Full List
mod site	chr9:5022026-5022027:+		[6]
Sequence	CGATGACAGAAATGGAGGGAACATCCACCTCTTCTATATAT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476574.5; ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815332
mod ID: M6ASITE087553		Click to Show/Hide the Full List
mod site	chr9:5050736-5050737:+		[6]
Sequence	AAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815333
mod ID: M6ASITE087554		Click to Show/Hide the Full List
mod site	chr9:5050802-5050803:+		[6]
Sequence	TAGCCAAAGAAAACGATCAAACCCCACTGGCCATCTATAAC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815334
mod ID: M6ASITE087555		Click to Show/Hide the Full List
mod site	chr9:5054569-5054570:+		[6]
Sequence	TTTTTATCCCTAGCTACAAGACATTCTTACCAAAATGTATT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815335
mod ID: M6ASITE087556		Click to Show/Hide the Full List
mod site	chr9:5054606-5054607:+		[6]
Sequence	TATTCGAGCAAAGATCCAAGACTATCATATTTTGACAAGGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815336
mod ID: M6ASITE087557		Click to Show/Hide the Full List
mod site	chr9:5054693-5054694:+		[6]
Sequence	ATGCAAAGCCACTGCCAGAAACTTGAAACTTAAGTATCTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815337
mod ID: M6ASITE087558		Click to Show/Hide the Full List
mod site	chr9:5054700-5054701:+		[6]
Sequence	GCCACTGCCAGAAACTTGAAACTTAAGTATCTTATAAATCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815338
mod ID: M6ASITE087559		Click to Show/Hide the Full List
mod site	chr9:5054725-5054726:+		[6]
Sequence	AGTATCTTATAAATCTGGAAACTCTGCAGTCTGCCTTCTAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815339
mod ID: M6ASITE087560		Click to Show/Hide the Full List
mod site	chr9:5054769-5054770:+		[6]
Sequence	GAGAAATTTGAAGTAAAAGAACCTGGAAGTGGTCCTTCAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815340
mod ID: M6ASITE087561		Click to Show/Hide the Full List
mod site	chr9:5055726-5055727:+		[6]
Sequence	TGTCAGTATTAAGCAAGCAAACCAAGAGGGTTCAAATGAAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815341
mod ID: M6ASITE087562		Click to Show/Hide the Full List
mod site	chr9:5064890-5064891:+		[6]
Sequence	TTCTCTGCTTAGGAAATTGAACTTAGCTCATTAAGGGAAGC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815342
mod ID: M6ASITE087563		Click to Show/Hide the Full List
mod site	chr9:5066698-5066699:+		[6]
Sequence	ATGGATTTTGCCATTAGTAAACTGAAGAAAGCAGGTAATCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636127.1; ENST00000381652.3
External Link	RMBase: m6A_site_815343
mod ID: M6ASITE087564		Click to Show/Hide the Full List
mod site	chr9:5066720-5066721:+		[6]
Sequence	TGAAGAAAGCAGGTAATCAGACTGGACTGTATGTACTTCGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815344
mod ID: M6ASITE087565		Click to Show/Hide the Full List
mod site	chr9:5066725-5066726:+		[6]
Sequence	AAAGCAGGTAATCAGACTGGACTGTATGTACTTCGATGCAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815345
mod ID: M6ASITE087566		Click to Show/Hide the Full List
mod site	chr9:5066754-5066755:+		[6]
Sequence	ACTTCGATGCAGTCCTAAGGACTTTAATAAATATTTTTTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815346
mod ID: M6ASITE087567		Click to Show/Hide the Full List
mod site	chr9:5069093-5069094:+		[8]
Sequence	AAGAGTACAACCTCAGTGGGACAAAGAAGAACTTCAGCAGT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815347
mod ID: M6ASITE087568		Click to Show/Hide the Full List
mod site	chr9:5069160-5069161:+		[8]
Sequence	GATGGAAACTGTTCGCTCAGACAATATAATTTTCCAGTTTA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815348
mod ID: M6ASITE087569		Click to Show/Hide the Full List
mod site	chr9:5069933-5069934:+		[6]
Sequence	TATTTTTTCAGATAAATCAAACCTTCTAGTCTTCAGAACGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000636127.1
External Link	RMBase: m6A_site_815349
mod ID: M6ASITE087570		Click to Show/Hide the Full List
mod site	chr9:5089782-5089783:+
Sequence	TACTGAAGAGCACCTAAGAGACTTTGAAAGGGAAATTGAAA
Motif Score	3.319380952
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m6A_site_815350
mod ID: M6ASITE087571		Click to Show/Hide the Full List
mod site	chr9:5090539-5090540:+		[9]
Sequence	GAACGGATAGATCACATAAAACTTCTGCAGTACACATCTCA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m6A_site_815351
mod ID: M6ASITE087572		Click to Show/Hide the Full List
mod site	chr9:5094889-5094890:+		[9]
Sequence	CACCGTTTTTATGAATCCGAACAGCATACCTCCAATTCCAC
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000456661.1; ENST00000381652.3
External Link	RMBase: m6A_site_815352
mod ID: M6ASITE087573		Click to Show/Hide the Full List
mod site	chr9:5111064-5111065:+		[10]
Sequence	CAGAGGTTCAGGTCTTGAGAACTGGCCCAGCTCAGGCTCCT
Motif Score	3.373380952
Cell/Tissue List	GM12878
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000423021.2
External Link	RMBase: m6A_site_815353
mod ID: M6ASITE087574		Click to Show/Hide the Full List
mod site	chr9:5111103-5111104:+		[10]
Sequence	CTGGGGCAGCGGCGACCAGAACAGCTCCTCCTTTGACCCCA
Motif Score	2.951386905
Cell/Tissue List	GM12878
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000423021.2
External Link	RMBase: m6A_site_815354
mod ID: M6ASITE087575		Click to Show/Hide the Full List
mod site	chr9:5112413-5112414:+		[6]
Sequence	GGAGGAGGAGGATGAGGAGAACACGTCGGCGGCTGACCACT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423021.2; ENST00000381652.3
External Link	RMBase: m6A_site_815355
mod ID: M6ASITE087576		Click to Show/Hide the Full List
mod site	chr9:5112459-5112460:+		[6]
Sequence	GGAGAAGAAGGAGCTGAAGGACCCCCGGGACCGGACCAGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000423021.2
External Link	RMBase: m6A_site_815356
mod ID: M6ASITE087577		Click to Show/Hide the Full List
mod site	chr9:5112468-5112469:+		[6]
Sequence	GGAGCTGAAGGACCCCCGGGACCGGACCAGCCCAGACAAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423021.2; ENST00000381652.3
External Link	RMBase: m6A_site_815357
mod ID: M6ASITE087578		Click to Show/Hide the Full List
mod site	chr9:5112473-5112474:+		[6]
Sequence	TGAAGGACCCCCGGGACCGGACCAGCCCAGACAAGGACGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000423021.2
External Link	RMBase: m6A_site_815358
mod ID: M6ASITE087579		Click to Show/Hide the Full List
mod site	chr9:5112483-5112484:+		[6]
Sequence	CCGGGACCGGACCAGCCCAGACAAGGACGAGGAGGAAGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423021.2; ENST00000381652.3
External Link	RMBase: m6A_site_815359
mod ID: M6ASITE087580		Click to Show/Hide the Full List
mod site	chr9:5114405-5114406:+		[11]
Sequence	CCTGCTGGTGGGCACCAGAGACTGGATCAAGGGGGAGACCT
Motif Score	3.319380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000519308.1; ENST00000381652.3
External Link	RMBase: m6A_site_815360
mod ID: M6ASITE087581		Click to Show/Hide the Full List
mod site	chr9:5114422-5114423:+		[11]
Sequence	GAGACTGGATCAAGGGGGAGACCTACCAGTGCAGGGTGACC
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000519308.1
External Link	RMBase: m6A_site_815361
mod ID: M6ASITE087582		Click to Show/Hide the Full List
mod site	chr9:5114531-5114532:+		[11]
Sequence	AACGCTAGAAGAGCCGAGGAACCAGGACAAGCGCACCCTCA
Motif Score	2.930744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000519308.1
External Link	RMBase: m6A_site_815362
mod ID: M6ASITE087583		Click to Show/Hide the Full List
mod site	chr9:5114537-5114538:+		[11]
Sequence	AGAAGAGCCGAGGAACCAGGACAAGCGCACCCTCACCTGCC
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000519308.1; ENST00000381652.3
External Link	RMBase: m6A_site_815363
mod ID: M6ASITE087584		Click to Show/Hide the Full List
mod site	chr9:5114567-5114568:+		[12]
Sequence	CCTCACCTGCCTGATCCAGAACTTCTGGCCCAAGGACATCT
Motif Score	3.373380952
Cell/Tissue List	iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000519308.1
External Link	RMBase: m6A_site_815364
mod ID: M6ASITE087585		Click to Show/Hide the Full List
mod site	chr9:5114582-5114583:+		[12]
Sequence	CCAGAACTTCTGGCCCAAGGACATCTTGGTGCAGTGGCTGT
Motif Score	3.643047619
Cell/Tissue List	iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000519308.1; ENST00000381652.3
External Link	RMBase: m6A_site_815365
mod ID: M6ASITE087586		Click to Show/Hide the Full List
mod site	chr9:5114624-5114625:+		[12]
Sequence	CAACGAGGTGCAGCTCCCGGACACTTGGCACAGCATGACGC
Motif Score	3.643047619
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000381652.3; ENST00000519308.1
External Link	RMBase: m6A_site_815366
mod ID: M6ASITE087587		Click to Show/Hide the Full List
mod site	chr9:5114656-5114657:+		[12]
Sequence	GCATGACGCAGCCCCGCAAAACCAAGGGCTCTGGCGTCTTA
Motif Score	2.185083333
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000519308.1; ENST00000381652.3
External Link	RMBase: m6A_site_815367
mod ID: M6ASITE087588		Click to Show/Hide the Full List
mod site	chr9:5123081-5123082:+		[13]
Sequence	TTTGGAGTGGTTCTGTATGAACTTTTCACATACATTGAGAA
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m6A_site_815368
mod ID: M6ASITE087589		Click to Show/Hide the Full List
mod site	chr9:5126698-5126699:+		[14]
Sequence	TACAGATCTATATGATCATGACAGAATGCTGGAACAATAAT
Motif Score	2.859755952
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000487310.1; ENST00000381652.3
External Link	RMBase: m6A_site_815369
mod ID: M6ASITE087590		Click to Show/Hide the Full List
mod site	chr9:5126813-5126814:+
Sequence	GAAATGACCTTCATTCTGAGACCAAAGTAGATTTACAGAAC
Motif Score	2.876744048
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000487310.1; ENST00000381652.3
External Link	RMBase: m6A_site_815370
mod ID: M6ASITE087591		Click to Show/Hide the Full List
mod site	chr9:5126832-5126833:+
Sequence	GACCAAAGTAGATTTACAGAACAAAGTTTTATATTTCACAT
Motif Score	2.951386905
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000487310.1; ENST00000381652.3
External Link	RMBase: m6A_site_815371
mod ID: M6ASITE087592		Click to Show/Hide the Full List
mod site	chr9:5126861-5126862:+		[15]
Sequence	TATATTTCACATTGCTGTGGACTATTATTACATATATCATT
Motif Score	4.065041667
Cell/Tissue List	HEK293T; CD8T; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-CLIP/IP; m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000487310.1
External Link	RMBase: m6A_site_815372
mod ID: M6ASITE087593		Click to Show/Hide the Full List
mod site	chr9:5126934-5126935:+		[16]
Sequence	TGTGAAAATATCTGCTCAAAACTTTCAAAGTTTAGTAAGTT
Motif Score	2.627720238
Cell/Tissue List	HEK293T; Huh7; HEK293A-TOA; TIME; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000381652.3; ENST00000487310.1
External Link	RMBase: m6A_site_815373
mod ID: M6ASITE087594		Click to Show/Hide the Full List
mod site	chr9:5126981-5126982:+		[16]
Sequence	CATGAGGCCACCAGTAAAAGACATTAATGAGAATTCCTTAG
Motif Score	2.897386905
Cell/Tissue List	HEK293T; Huh7; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m6A_site_815374
mod ID: M6ASITE087595		Click to Show/Hide the Full List
mod site	chr9:5127028-5127029:+		[9]
Sequence	TTTTGTAAGAAGTTTCTTAAACATTGTCAGTTAACATCACT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000381652.3
External Link	RMBase: m6A_site_815375

Other RNA modification (t6A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: RNASITE000004		Click to Show/Hide the Full List
mod site	chr9:5109384-5109385:+		[17]
Sequence	GAAAGTATGCAAGAACTGCTAACTCATGCCCCCATGCCTAA
Cell/Tissue List	mitochondrial
Transcript ID List	ENST00000381652.3
External Link	RMBase: otherMod_site_1147

Ref 1	N6-Methyladenosine Methyltransferase METTL3 Promotes Angiogenesis and Atherosclerosis by Upregulating the JAK2/STAT3 Pathway via m6A Reader IGF2BP1. Front Cell Dev Biol. 2021 Dec 7;9:731810. doi: 10.3389/fcell.2021.731810. eCollection 2021.
Ref 2	FTO inhibits UPR(mt)-induced apoptosis by activating JAK2/STAT3 pathway and reducing m6A level in adipocytes. Apoptosis. 2021 Aug;26(7-8):474-487. doi: 10.1007/s10495-021-01683-z. Epub 2021 Jul 1.
Ref 3	ALKBH5-HOXA10 loop-mediated JAK2 m6A demethylation and cisplatin resistance in epithelial ovarian cancer. J Exp Clin Cancer Res. 2021 Sep 8;40(1):284. doi: 10.1186/s13046-021-02088-1.
Ref 4	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 5	Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):6784-6789. doi: 10.1073/pnas.1817334116. Epub 2019 Mar 14.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 10	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 11	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 12	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 13	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 14	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 15	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 16	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 17	MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res. 2018 Jan 4;46(D1):D303-D307. doi: 10.1093/nar/gkx1030.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map