m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00298)

Target Name	Integrin beta-1 (ITGB1)
Gene Name	ITGB1
Chromosomal Location	10p11.22
Family	integrin beta chain family
Function	Integrins alpha-1/beta-1, alpha-2/beta-1, alpha-10/beta-1 and alpha-11/beta-1 are receptors for collagen. Integrins alpha-1/beta-1 and alpha-2/beta-2 recognize the proline-hydroxylated sequence G-F-P-G-E-R in collagen. Integrins alpha-2/beta-1, alpha-3/beta-1, alpha-4/beta-1, alpha-5/beta-1, alpha-8/beta-1, alpha-10/beta-1, alpha-11/beta-1 and alpha-V/beta-1 are receptors for fibronectin. Alpha-4/beta-1 recognizes one or more domains within the alternatively spliced CS-1 and CS-5 regions of fibronectin. Integrin alpha-5/beta-1 is a receptor for fibrinogen. Integrin alpha-1/beta-1, alpha-2/beta-1, alpha-6/beta-1 and alpha-7/beta-1 are receptors for lamimin. Integrin alpha-6/beta-1 (ITGA6:ITGB1) is present in oocytes and is involved in sperm-egg fusion (By similarity). Integrin alpha-4/beta-1 is a receptor for VCAM1. It recognizes the sequence Q-I-D-S in VCAM1. Integrin alpha-9/beta-1 is a receptor for VCAM1, cytotactin and osteopontin. It recognizes the sequence A-E-I-D-G-I-E-L in cytotactin. Integrin alpha-3/beta-1 is a receptor for epiligrin, thrombospondin and CSPG4. Alpha-3/beta-1 may mediate with LGALS3 the stimulation by CSPG4 of endothelial cells migration. Integrin alpha-V/beta-1 is a receptor for vitronectin. Beta-1 integrins recognize the sequence R-G-D in a wide array of ligands. When associated with alpha-7 integrin, regulates cell adhesion and laminin matrix deposition. Involved in promoting endothelial cell motility and angiogenesis. Involved in osteoblast compaction through the fibronectin fibrillogenesis cell-mediated matrix assembly process and the formation of mineralized bone nodules. May be involved in up-regulation of the activity of kinases such as PKC via binding to KRT1. Together with KRT1 and RACK1, serves as a platform for SRC activation or inactivation. Plays a mechanistic adhesive role during telophase, required for the successful completion of cytokinesis. Integrin alpha-3/beta-1 provides a docking site for FAP (seprase) at invadopodia plasma membranes in a collagen-dependent manner and hence may participate in the adhesion, formation of invadopodia and matrix degradation processes, promoting cell invasion. ITGA4:ITGB1 binds to fractalkine (CX3CL1) and may act as its coreceptor in CX3CR1-dependent fractalkine signaling. ITGA4:ITGB1 and ITGA5:ITGB1 bind to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1. ITGA5:ITGB1 acts as a receptor for fibrillin-1 (FBN1) and mediates R-G-D-dependent cell adhesion to FBN1. ITGA5:ITGB1 is a receptor for IL1B and binding is essential for IL1B signaling. ITGA5:ITGB3 is a receptor for soluble CD40LG and is required for CD40/CD40LG signaling. Plays an important role in myoblast differentiation and fusion during skeletal myogenesis (By similarity). [Isoform 2]: Interferes with isoform 1 resulting in a dominant negative effect on cell adhesion and migration (in vitro). [Isoform 5]: Isoform 5 displaces isoform 1 in striated muscles. (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human echoviruses 1 and 8. (Microbial infection) Acts as a receptor for Cytomegalovirus/HHV-5. (Microbial infection) Acts as a receptor for Epstein-Barr virus/HHV-4. (Microbial infection) Integrin ITGA5:ITGB1 acts as a receptor for Human parvovirus B19. (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human rotavirus. (Microbial infection) Acts as a receptor for Mammalian reovirus. (Microbial infection) In case of HIV-1 infection, integrin ITGA5:ITGB1 binding to extracellular viral Tat protein seems to enhance angiogenesis in Kaposi's sarcoma lesions. (Microbial infection) Interacts with CotH proteins expressed by fungi of the order mucorales, the causative agent of mucormycosis, which plays an important role in epithelial cell invasion by the fungi. Integrin ITGA3:ITGB1 may act as a receptor for R.delemar CotH7 in alveolar epithelial cells, which may be an early step in pulmonary mucormycosis disease progression. Click to Show/Hide
Gene ID	3688
Uniprot ID	ITB1_HUMAN
HGNC ID	HGNC:6153
KEGG ID	hsa:3688

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ITGB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 6.90E-01 p-value: 1.74E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO was an independent risk factor for overall survival (OS) of GC patients and FTO could promote GC metastasis by upregulating the expression of Integrin beta-1 (ITGB1) via decreasing its m6A level.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
In-vitro Model	SNU-216	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_3946
	MKN7	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1417
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -2.05E+00 p-value: 1.83E-215
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 regulates the expression of Integrin beta-1 (ITGB1) through m6A-HuR-dependent mechanism, which affects the binding of ITGB1 to Collagen I and tumor cell motility, so as to promote the bone metastasis of prostate cancer.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
In-vitro Model	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
In-vivo Model	All the mice were randomly divided into five groups of four mice each, including PC3-shNC, PC3-shMETTL3-1/2, LNCaP-vector and LNCaP-METTL3 group.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[5]
Response Summary	KAT1 triggers YTHDF2-mediated Integrin beta-1 (ITGB1) mRNA instability to alleviate the progression of DR.
Target Regulation	Down regulation
Responsed Disease	Diabetic retinopathy	ICD-11: 9B71.0	Disease Info
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	RNA stability
In-vitro Model	RMECs (Retinal microvascular endothelial cells (RMECs) purchased from Olaf (Worcester, MA, USA))
	rMCs (Retinal Muller cells (rMCs) from Kerafast Inc. (Boston, MA))
In-vivo Model	Male mice (8-10 weeks old, SLAC Laboratory Animal Co., Ltd., Shanghai, China) were administrated with STZ through intraperitoneal injection (I.P) for continuous 5 days (d).

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO was an independent risk factor for overall survival (OS) of GC patients and FTO could promote GC metastasis by upregulating the expression of Integrin beta-1 (ITGB1) via decreasing its m6A level.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	SNU-216	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_3946
	MKN7	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1417
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	In lung squamous cell carcinoma, seven m6A-related autophagy genes were screened to construct a prognostic model: CASP4, CDKN1A, DLC1, Integrin beta-1 (ITGB1), PINK1, TP63, and EIF4EBP1.
Responsed Disease	Lung squamous cell carcinoma [ICD-11: 2C25.2]
Pathway Response	Autophagy	hsa04140
Cell Process	Cell proliferation and metastasis
	Cell autophagy

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 regulates the expression of Integrin beta-1 (ITGB1) through m6A-HuR-dependent mechanism, which affects the binding of ITGB1 to Collagen I and tumor cell motility, so as to promote the bone metastasis of prostate cancer.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
In-vitro Model	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
In-vivo Model	All the mice were randomly divided into five groups of four mice each, including PC3-shNC, PC3-shMETTL3-1/2, LNCaP-vector and LNCaP-METTL3 group.

Retinopathy [ICD-11: 9B71]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[5]
Response Summary	KAT1 triggers YTHDF2-mediated Integrin beta-1 (ITGB1) mRNA instability to alleviate the progression of DR.
Responsed Disease	Diabetic retinopathy [ICD-11: 9B71.0]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)	READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway		hsa04151
Cell Process	RNA stability
In-vitro Model	RMECs (Retinal microvascular endothelial cells (RMECs) purchased from Olaf (Worcester, MA, USA))
	rMCs (Retinal Muller cells (rMCs) from Kerafast Inc. (Boston, MA))
In-vivo Model	Male mice (8-10 weeks old, SLAC Laboratory Animal Co., Ltd., Shanghai, China) were administrated with STZ through intraperitoneal injection (I.P) for continuous 5 days (d).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02124		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Pancreatic cancer	Disease Info
Crosstalk ID: M6ACROT02133		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Pancreatic cancer	Disease Info

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03215		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase type B catalytic subunit (HAT1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Diabetic retinopathy	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00298)

Integrin beta-1 (ITGB1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000140		Click to Show/Hide the Full List
mod site	chr10:32920290-32920291:-		[6]
Sequence	CAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAAT
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: ac4C_site_203

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004690		Click to Show/Hide the Full List
mod site	chr10:32912126-32912127:-		[7]
Sequence	GCAATTTTGGCATGTTTCTTCAGGTGCAATGAAGGGCGTGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m5C_site_5206
mod ID: M5CSITE004691		Click to Show/Hide the Full List
mod site	chr10:32954260-32954261:-
Sequence	AAGCTGGGGGTGCTGGTTGGCTGGAGCAGAGGGGAAATGAT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000417122.6; ENST00000396033.6; ENST00000475184.5; ENST00000534049.5; ENST00000528877.5; ENST00000488494.5; ENST00000302278.8; ENST00000414670.2; ENST00000474568.5; ENST00000484088.5; ENST00000480226.5; ENST00000437302.5
External Link	RMBase: m5C_site_5207

N6-methyladenosine (m6A)

In total 85 m6A sequence/site(s) in this target gene
mod ID: M6ASITE096216		Click to Show/Hide the Full List
mod site	chr10:32900498-32900499:-		[8]
Sequence	TGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97504
mod ID: M6ASITE096217		Click to Show/Hide the Full List
mod site	chr10:32900549-32900550:-		[9]
Sequence	TACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACT
Motif Score	2.168095238
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97505
mod ID: M6ASITE096218		Click to Show/Hide the Full List
mod site	chr10:32900620-32900621:-		[8]
Sequence	TCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97506
mod ID: M6ASITE096219		Click to Show/Hide the Full List
mod site	chr10:32900786-32900787:-		[10]
Sequence	AAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATT
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97507
mod ID: M6ASITE096220		Click to Show/Hide the Full List
mod site	chr10:32900808-32900809:-		[8]
Sequence	TTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97508
mod ID: M6ASITE096221		Click to Show/Hide the Full List
mod site	chr10:32900826-32900827:-		[8]
Sequence	TCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97509
mod ID: M6ASITE096222		Click to Show/Hide the Full List
mod site	chr10:32900870-32900871:-		[10]
Sequence	TTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97510
mod ID: M6ASITE096223		Click to Show/Hide the Full List
mod site	chr10:32900895-32900896:-		[8]
Sequence	AACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97511
mod ID: M6ASITE096224		Click to Show/Hide the Full List
mod site	chr10:32901008-32901009:-		[8]
Sequence	ACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6; ENST00000488427.1
External Link	RMBase: m6A_site_97512
mod ID: M6ASITE096225		Click to Show/Hide the Full List
mod site	chr10:32901059-32901060:-		[8]
Sequence	ACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000488427.1; ENST00000302278.8
External Link	RMBase: m6A_site_97513
mod ID: M6ASITE096226		Click to Show/Hide the Full List
mod site	chr10:32901084-32901085:-		[8]
Sequence	TTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000488427.1; ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97514
mod ID: M6ASITE096227		Click to Show/Hide the Full List
mod site	chr10:32901184-32901185:-		[8]
Sequence	TAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000488427.1; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97515
mod ID: M6ASITE096228		Click to Show/Hide the Full List
mod site	chr10:32901200-32901201:-		[10]
Sequence	TCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000488427.1; ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97516
mod ID: M6ASITE096229		Click to Show/Hide the Full List
mod site	chr10:32901307-32901308:-		[10]
Sequence	TTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000488427.1; ENST00000302278.8
External Link	RMBase: m6A_site_97517
mod ID: M6ASITE096230		Click to Show/Hide the Full List
mod site	chr10:32901338-32901339:-		[8]
Sequence	TACTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000488427.1; ENST00000423113.5
External Link	RMBase: m6A_site_97518
mod ID: M6ASITE096231		Click to Show/Hide the Full List
mod site	chr10:32901368-32901369:-		[10]
Sequence	GGACTGACAAAAGACTTGAGACAGGATGGTTACTCTTGTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000302278.8; ENST00000488427.1
External Link	RMBase: m6A_site_97519
mod ID: M6ASITE096232		Click to Show/Hide the Full List
mod site	chr10:32901375-32901376:-		[10]
Sequence	ATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTACT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000488427.1; ENST00000396033.6
External Link	RMBase: m6A_site_97520
mod ID: M6ASITE096233		Click to Show/Hide the Full List
mod site	chr10:32901382-32901383:-		[8]
Sequence	GTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGAT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000488427.1; ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97521
mod ID: M6ASITE096234		Click to Show/Hide the Full List
mod site	chr10:32901386-32901387:-		[10]
Sequence	TGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000488427.1; ENST00000423113.5; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97522
mod ID: M6ASITE096235		Click to Show/Hide the Full List
mod site	chr10:32901450-32901451:-		[11]
Sequence	TGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAA
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000488427.1; ENST00000302278.8
External Link	RMBase: m6A_site_97523
mod ID: M6ASITE096236		Click to Show/Hide the Full List
mod site	chr10:32901475-32901476:-		[11]
Sequence	GGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000396033.6; ENST00000488427.1
External Link	RMBase: m6A_site_97524
mod ID: M6ASITE096237		Click to Show/Hide the Full List
mod site	chr10:32901513-32901514:-		[9]
Sequence	AAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGC
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000488427.1; ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97525
mod ID: M6ASITE096238		Click to Show/Hide the Full List
mod site	chr10:32901548-32901549:-		[8]
Sequence	GTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000488427.1; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97526
mod ID: M6ASITE096239		Click to Show/Hide the Full List
mod site	chr10:32901604-32901605:-		[8]
Sequence	CTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000494395.1; ENST00000488427.1; ENST00000423113.5; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97527
mod ID: M6ASITE096240		Click to Show/Hide the Full List
mod site	chr10:32907093-32907094:-		[10]
Sequence	TAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000396033.6; ENST00000494395.1; ENST00000423113.5; ENST00000302278.8; ENST00000488427.1
External Link	RMBase: m6A_site_97528
mod ID: M6ASITE096241		Click to Show/Hide the Full List
mod site	chr10:32908371-32908372:-		[10]
Sequence	GAAAATGAATGCCAAATGGGACACGGTAAGTTACAAAACAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000302278.8; ENST00000494395.1; ENST00000488427.1
External Link	RMBase: m6A_site_97529
mod ID: M6ASITE096242		Click to Show/Hide the Full List
mod site	chr10:32908515-32908516:-		[8]
Sequence	AGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000494395.1; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97530
mod ID: M6ASITE096243		Click to Show/Hide the Full List
mod site	chr10:32910257-32910258:-		[8]
Sequence	TACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5; ENST00000494395.1
External Link	RMBase: m6A_site_97531
mod ID: M6ASITE096244		Click to Show/Hide the Full List
mod site	chr10:32910356-32910357:-		[8]
Sequence	TACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6; ENST00000494395.1
External Link	RMBase: m6A_site_97532
mod ID: M6ASITE096245		Click to Show/Hide the Full List
mod site	chr10:32910410-32910411:-		[8]
Sequence	CAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000494395.1; ENST00000396033.6
External Link	RMBase: m6A_site_97533
mod ID: M6ASITE096246		Click to Show/Hide the Full List
mod site	chr10:32911475-32911476:-		[10]
Sequence	AAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5; ENST00000494395.1
External Link	RMBase: m6A_site_97534
mod ID: M6ASITE096247		Click to Show/Hide the Full List
mod site	chr10:32911566-32911567:-		[10]
Sequence	ACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5; ENST00000494395.1
External Link	RMBase: m6A_site_97535
mod ID: M6ASITE096248		Click to Show/Hide the Full List
mod site	chr10:32911624-32911625:-		[8]
Sequence	GTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000494395.1; ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97536
mod ID: M6ASITE096249		Click to Show/Hide the Full List
mod site	chr10:32911917-32911918:-		[11]
Sequence	CTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCT
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000302278.8; ENST00000494395.1
External Link	RMBase: m6A_site_97537
mod ID: M6ASITE096250		Click to Show/Hide the Full List
mod site	chr10:32911963-32911964:-		[11]
Sequence	TTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGC
Motif Score	2.110482143
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000494395.1; ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97538
mod ID: M6ASITE096251		Click to Show/Hide the Full List
mod site	chr10:32911991-32911992:-		[10]
Sequence	AATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000494395.1; ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97539
mod ID: M6ASITE096252		Click to Show/Hide the Full List
mod site	chr10:32912034-32912035:-		[10]
Sequence	TGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000494395.1; ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97540
mod ID: M6ASITE096253		Click to Show/Hide the Full List
mod site	chr10:32912061-32912062:-		[10]
Sequence	AGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000494395.1; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97541
mod ID: M6ASITE096254		Click to Show/Hide the Full List
mod site	chr10:32912099-32912100:-		[10]
Sequence	AATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97542
mod ID: M6ASITE096255		Click to Show/Hide the Full List
mod site	chr10:32919906-32919907:-		[10]
Sequence	AGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97543
mod ID: M6ASITE096256		Click to Show/Hide the Full List
mod site	chr10:32919974-32919975:-		[8]
Sequence	AGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97544
mod ID: M6ASITE096257		Click to Show/Hide the Full List
mod site	chr10:32920291-32920292:-		[10]
Sequence	GCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97545
mod ID: M6ASITE096258		Click to Show/Hide the Full List
mod site	chr10:32920323-32920324:-		[9]
Sequence	AGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACG
Motif Score	2.07285119
Cell/Tissue List	kidney; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97546
mod ID: M6ASITE096259		Click to Show/Hide the Full List
mod site	chr10:32920333-32920334:-		[8]
Sequence	GCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTAC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97547
mod ID: M6ASITE096260		Click to Show/Hide the Full List
mod site	chr10:32922260-32922261:-		[8]
Sequence	TCAGTTGATCATTGATGCATACAATGTGAGTACATCTTAAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97548
mod ID: M6ASITE096261		Click to Show/Hide the Full List
mod site	chr10:32922309-32922310:-		[10]
Sequence	TCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97549
mod ID: M6ASITE096262		Click to Show/Hide the Full List
mod site	chr10:32922335-32922336:-		[10]
Sequence	TTAATTGCAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97550
mod ID: M6ASITE096263		Click to Show/Hide the Full List
mod site	chr10:32922643-32922644:-		[8]
Sequence	TGAAGAATTTCAGCCTGTTTACAAGGTAAATGTGTGAGATA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97551
mod ID: M6ASITE096264		Click to Show/Hide the Full List
mod site	chr10:32922680-32922681:-		[10]
Sequence	TGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97552
mod ID: M6ASITE096265		Click to Show/Hide the Full List
mod site	chr10:32922702-32922703:-		[10]
Sequence	ATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97553
mod ID: M6ASITE096266		Click to Show/Hide the Full List
mod site	chr10:32923629-32923630:-		[10]
Sequence	ATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97554
mod ID: M6ASITE096267		Click to Show/Hide the Full List
mod site	chr10:32923659-32923660:-		[10]
Sequence	CACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97555
mod ID: M6ASITE096268		Click to Show/Hide the Full List
mod site	chr10:32923694-32923695:-		[9]
Sequence	CACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTT
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97556
mod ID: M6ASITE096269		Click to Show/Hide the Full List
mod site	chr10:32923715-32923716:-		[8]
Sequence	TGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: m6A_site_97557
mod ID: M6ASITE096270		Click to Show/Hide the Full List
mod site	chr10:32925942-32925943:-		[10]
Sequence	TTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000396033.6; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97558
mod ID: M6ASITE096271		Click to Show/Hide the Full List
mod site	chr10:32925954-32925955:-		[10]
Sequence	AAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCAT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEC-1-A; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97559
mod ID: M6ASITE096272		Click to Show/Hide the Full List
mod site	chr10:32925980-32925981:-		[11]
Sequence	ACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000423113.5; ENST00000484088.5; ENST00000302278.8; ENST00000396033.6
External Link	RMBase: m6A_site_97560
mod ID: M6ASITE096273		Click to Show/Hide the Full List
mod site	chr10:32926000-32926001:-		[8]
Sequence	CTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396033.6; ENST00000484088.5; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97561
mod ID: M6ASITE096274		Click to Show/Hide the Full List
mod site	chr10:32926021-32926022:-		[10]
Sequence	CCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000396033.6; ENST00000484088.5; ENST00000302278.8; ENST00000423113.5
External Link	RMBase: m6A_site_97562
mod ID: M6ASITE096275		Click to Show/Hide the Full List
mod site	chr10:32926026-32926027:-		[10]
Sequence	AGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484088.5; ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97563
mod ID: M6ASITE096276		Click to Show/Hide the Full List
mod site	chr10:32926042-32926043:-		[10]
Sequence	AACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484088.5; ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97564
mod ID: M6ASITE096277		Click to Show/Hide the Full List
mod site	chr10:32926072-32926073:-		[8]
Sequence	GGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000423113.5; ENST00000484088.5; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: m6A_site_97565
mod ID: M6ASITE096278		Click to Show/Hide the Full List
mod site	chr10:32926085-32926086:-		[10]
Sequence	TTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484088.5; ENST00000302278.8; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97566
mod ID: M6ASITE096279		Click to Show/Hide the Full List
mod site	chr10:32928104-32928105:-		[10]
Sequence	AATGAGGAGGATTACTTCGGACTTCAGAATTGGTAGGAATG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484088.5; ENST00000396033.6; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97567
mod ID: M6ASITE096280		Click to Show/Hide the Full List
mod site	chr10:32928141-32928142:-		[10]
Sequence	AGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000484088.5; ENST00000423113.5; ENST00000396033.6
External Link	RMBase: m6A_site_97568
mod ID: M6ASITE096281		Click to Show/Hide the Full List
mod site	chr10:32928191-32928192:-		[10]
Sequence	TGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; BGC823; H1299; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484088.5; ENST00000396033.6; ENST00000474568.5; ENST00000480226.5; ENST00000423113.5; ENST00000302278.8
External Link	RMBase: m6A_site_97569
mod ID: M6ASITE096282		Click to Show/Hide the Full List
mod site	chr10:32928221-32928222:-		[10]
Sequence	AAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACT
Motif Score	3.319380952
Cell/Tissue List	HeLa; BGC823; H1299; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000480226.5; ENST00000484088.5; ENST00000302278.8; ENST00000474568.5; ENST00000423113.5; ENST00000396033.6; ENST00000488494.5; ENST00000534049.5
External Link	RMBase: m6A_site_97570
mod ID: M6ASITE096283		Click to Show/Hide the Full List
mod site	chr10:32928246-32928247:-		[8]
Sequence	TAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000474568.5; ENST00000480226.5; ENST00000302278.8; ENST00000437302.5; ENST00000396033.6; ENST00000534049.5; ENST00000484088.5; ENST00000488494.5; ENST00000423113.5
External Link	RMBase: m6A_site_97571
mod ID: M6ASITE096284		Click to Show/Hide the Full List
mod site	chr10:32928252-32928253:-		[10]
Sequence	TCTAATTAGGGGAGCCACAGACATTTACATTAAAATTCAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; BGC823; hNPCs; H1299; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000302278.8; ENST00000423113.5; ENST00000480226.5; ENST00000534049.5; ENST00000396033.6; ENST00000474568.5; ENST00000484088.5; ENST00000437302.5; ENST00000488494.5
External Link	RMBase: m6A_site_97572
mod ID: M6ASITE096285		Click to Show/Hide the Full List
mod site	chr10:32929849-32929850:-		[11]
Sequence	GATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATT
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000484088.5; ENST00000437302.5; ENST00000423113.5; ENST00000474568.5; ENST00000475184.5; ENST00000488494.5; ENST00000480226.5; ENST00000302278.8; ENST00000396033.6; ENST00000534049.5
External Link	RMBase: m6A_site_97573
mod ID: M6ASITE096286		Click to Show/Hide the Full List
mod site	chr10:32929893-32929894:-		[10]
Sequence	TAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; BGC823; hNPCs; fibroblasts; H1299; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000528877.5; ENST00000475184.5; ENST00000423113.5; ENST00000302278.8; ENST00000396033.6; ENST00000488494.5; ENST00000484088.5; ENST00000480226.5; ENST00000534049.5; ENST00000437302.5; ENST00000474568.5
External Link	RMBase: m6A_site_97574
mod ID: M6ASITE096287		Click to Show/Hide the Full List
mod site	chr10:32929961-32929962:-		[11]
Sequence	GAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000534049.5; ENST00000488494.5; ENST00000417122.6; ENST00000493758.5; ENST00000302278.8; ENST00000474568.5; ENST00000437302.5; ENST00000484088.5; ENST00000396033.6; ENST00000480226.5; ENST00000423113.5; ENST00000464001.1; ENST00000475184.5; ENST00000528877.5
External Link	RMBase: m6A_site_97575
mod ID: M6ASITE096288		Click to Show/Hide the Full List
mod site	chr10:32932522-32932523:-		[11]
Sequence	GGCCAAATTGTGGGTGGTGCACAAATTCAGTAAGTAAGGTT
Motif Score	2.830589286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000488494.5; ENST00000464001.1; ENST00000437302.5; ENST00000534049.5; ENST00000484088.5; ENST00000396033.6; ENST00000480226.5; ENST00000474568.5; ENST00000528877.5; ENST00000472147.1; ENST00000493758.5; ENST00000475184.5; ENST00000414670.2; ENST00000302278.8; ENST00000423113.5; ENST00000417122.6
External Link	RMBase: m6A_site_97576
mod ID: M6ASITE096289		Click to Show/Hide the Full List
mod site	chr10:32932550-32932551:-		[8]
Sequence	AAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000484088.5; ENST00000437302.5; ENST00000474568.5; ENST00000423113.5; ENST00000488494.5; ENST00000464001.1; ENST00000302278.8; ENST00000480226.5; ENST00000414670.2; ENST00000534049.5; ENST00000528877.5; ENST00000472147.1; ENST00000396033.6; ENST00000475184.5; ENST00000493758.5; ENST00000417122.6
External Link	RMBase: m6A_site_97577
mod ID: M6ASITE096290		Click to Show/Hide the Full List
mod site	chr10:32935494-32935495:-		[10]
Sequence	TTTGCTGTGTGTTTGCTCAAACAGGTAAAAACAAAAAATTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000472147.1; ENST00000437302.5; ENST00000488494.5; ENST00000396033.6; ENST00000302278.8; ENST00000417122.6; ENST00000484088.5; ENST00000475184.5; ENST00000528877.5; ENST00000423113.5; ENST00000534049.5; ENST00000414670.2; ENST00000480226.5; ENST00000493758.5; ENST00000474568.5
External Link	RMBase: m6A_site_97578
mod ID: M6ASITE096291		Click to Show/Hide the Full List
mod site	chr10:32935528-32935529:-		[10]
Sequence	CAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000488494.5; ENST00000396033.6; ENST00000423113.5; ENST00000302278.8; ENST00000484088.5; ENST00000480226.5; ENST00000474568.5; ENST00000528877.5; ENST00000414670.2; ENST00000534049.5; ENST00000417122.6; ENST00000493758.5; ENST00000472147.1; ENST00000437302.5; ENST00000475184.5
External Link	RMBase: m6A_site_97579
mod ID: M6ASITE096292		Click to Show/Hide the Full List
mod site	chr10:32935549-32935550:-		[8]
Sequence	TTTACATTTCAGATGAATTTACAACCAATTTTCTGGATTGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000493758.5; ENST00000302278.8; ENST00000396033.6; ENST00000475184.5; ENST00000472147.1; ENST00000484088.5; ENST00000417122.6; ENST00000414670.2; ENST00000437302.5; ENST00000480226.5; ENST00000534049.5; ENST00000474568.5; ENST00000528877.5; ENST00000423113.5; ENST00000488494.5
External Link	RMBase: m6A_site_97580
mod ID: M6ASITE096293		Click to Show/Hide the Full List
mod site	chr10:32935900-32935901:-		[10]
Sequence	TAGAGATTCTATGGGCTGAGACCATTGGTAGGTTTTATGGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000474568.5; ENST00000534049.5; ENST00000396033.6; ENST00000302278.8; ENST00000475184.5; ENST00000528877.5; ENST00000472147.1; ENST00000437302.5; ENST00000488494.5; ENST00000484088.5; ENST00000417122.6; ENST00000480226.5; ENST00000414670.2
External Link	RMBase: m6A_site_97581
mod ID: M6ASITE096294		Click to Show/Hide the Full List
mod site	chr10:32955646-32955647:-		[12]
Sequence	TAATAATGAAAAGTGGTCAAACAACTTAACATGGTGCCAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; U2OS; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000528877.5; ENST00000417122.6; ENST00000302278.8; ENST00000437302.5; ENST00000474568.5; ENST00000475184.5; ENST00000480226.5; ENST00000534049.5; ENST00000396033.6; ENST00000484088.5; ENST00000488494.5; ENST00000414670.2
External Link	RMBase: m6A_site_97582
mod ID: M6ASITE096295		Click to Show/Hide the Full List
mod site	chr10:32957814-32957815:-		[13]
Sequence	GGCTGCCGGAGCTGCGGGGGACCGGGCCCGAACGGCCCCTG
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; A549; U2OS; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000484088.5; ENST00000414670.2; ENST00000417122.6; ENST00000302278.8; ENST00000396033.6; ENST00000474568.5; ENST00000488494.5; ENST00000475184.5; ENST00000528877.5; ENST00000534049.5
External Link	RMBase: m6A_site_97583
mod ID: M6ASITE096296		Click to Show/Hide the Full List
mod site	chr10:32958193-32958194:-		[10]
Sequence	GGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; U2OS; H1A; H1B; fibroblasts; Jurkat; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000414670.2; ENST00000484088.5; ENST00000534049.5; ENST00000417122.6; ENST00000475184.5; ENST00000488494.5; ENST00000302278.8; ENST00000528877.5; ENST00000474568.5
External Link	RMBase: m6A_site_97584
mod ID: M6ASITE096297		Click to Show/Hide the Full List
mod site	chr10:32958568-32958569:-		[10]
Sequence	CGCCCTTCGCAGAGGAGGAAACTGAGGCACGGCGACTGTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; U2OS; GSC-11; HEK293T; HEK293A-TOA; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534049.5; ENST00000475184.5; ENST00000528877.5; ENST00000439974.3
External Link	RMBase: m6A_site_97585
mod ID: M6ASITE096298		Click to Show/Hide the Full List
mod site	chr10:32958826-32958827:-		[10]
Sequence	GCCAGTTCCCTTCCAGAAGGACCACGTGGTTTTTGGCCCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000528877.5; ENST00000534049.5; ENST00000439974.3; ENST00000475184.5
External Link	RMBase: m6A_site_97586
mod ID: M6ASITE096299		Click to Show/Hide the Full List
mod site	chr10:32960298-32960299:-		[10]
Sequence	CACCCCCTGGTTGACCTTAGACATGGAAAGGTGAGAGCTAT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000528877.5; ENST00000439974.3; ENST00000475184.5; ENST00000534049.5
External Link	RMBase: m6A_site_97588
mod ID: M6ASITE096300		Click to Show/Hide the Full List
mod site	chr10:32960333-32960334:-		[10]
Sequence	AGCCATCTGGTCGACCTTAGACACGGGAAGGCAAGCACCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000439974.3; ENST00000528877.5; ENST00000475184.5; ENST00000534049.5
External Link	RMBase: m6A_site_97589

2'-O-Methylation (2'-O-Me)

In total 3 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000550		Click to Show/Hide the Full List
mod site	chr10:32920025-32920026:-		[14]
Sequence	AAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000423113.5; ENST00000396033.6; ENST00000302278.8
External Link	RMBase: Nm_site_701
mod ID: 2OMSITE000551		Click to Show/Hide the Full List
mod site	chr10:32922329-32922330:-		[14]
Sequence	GCAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000302278.8; ENST00000396033.6; ENST00000423113.5
External Link	RMBase: Nm_site_702
mod ID: 2OMSITE000552		Click to Show/Hide the Full List
mod site	chr10:32935509-32935510:-		[14]
Sequence	GACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGGT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000534049.5; ENST00000472147.1; ENST00000302278.8; ENST00000488494.5; ENST00000493758.5; ENST00000414670.2; ENST00000474568.5; ENST00000396033.6; ENST00000437302.5; ENST00000528877.5; ENST00000480226.5; ENST00000417122.6; ENST00000475184.5; ENST00000484088.5; ENST00000423113.5
External Link	RMBase: Nm_site_703

Ref 1	N(6)-Methyladenosine RNA Demethylase FTO Promotes Gastric Cancer Metastasis by Down-Regulating the m6A Methylation of ITGB1. Front Oncol. 2021 Jul 1;11:681280. doi: 10.3389/fonc.2021.681280. eCollection 2021.
Ref 2	METTL3 enhances cell adhesion through stabilizing integrin Beta1 mRNA via an m6A-HuR-dependent mechanism in prostatic carcinoma. Am J Cancer Res. 2020 Mar 1;10(3):1012-1025. eCollection 2020.
Ref 3	Pioglitazone is metabolised by CYP2C8 and CYP3A4 in vitro: potential for interactions with CYP2C8 inhibitors. Basic Clin Pharmacol Toxicol. 2006 Jul;99(1):44-51. doi: 10.1111/j.1742-7843.2006.pto_437.x.
Ref 4	Safety and biodistribution of an equine infectious anemia virus-based gene therapy, RetinoStat(?), for age-related macular degeneration. Hum Gene Ther. 2012 Sep;23(9):980-91. doi: 10.1089/hum.2012.008. Epub 2012 Aug 1.
Ref 5	KAT1 triggers YTHDF2-mediated ITGB1 mRNA instability to alleviate the progression of diabetic retinopathy. Pharmacol Res. 2021 Aug;170:105713. doi: 10.1016/j.phrs.2021.105713. Epub 2021 Jun 5.
Ref 6	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 7	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 12	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.
Ref 13	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 14	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map