m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00294)

Target Name	Interleukin-1 beta (IL1B)
Synonyms	IL-1 beta; Catabolin; IL1F2 Click to Show/Hide
Gene Name	IL1B
Chromosomal Location	2q14.1
Family	IL-1 family
Function	Potent proinflammatory cytokine. Initially discovered as the major endogenous pyrogen, induces prostaglandin synthesis, neutrophil influx and activation, T-cell activation and cytokine production, B-cell activation and antibody production, and fibroblast proliferation and collagen production. Promotes Th17 differentiation of T-cells. Synergizes with IL12/interleukin-12 to induce IFNG synthesis from T-helper 1 (Th1) cells. Plays a role in angiogenesis by inducing VEGF production synergistically with TNF and IL6. Involved in transduction of inflammation downstream of pyroptosis: its mature form is specifically released in the extracellular milieu by passing through the gasdermin-D (GSDMD) pore. Click to Show/Hide
Gene ID	3553
Uniprot ID	IL1B_HUMAN
HGNC ID	HGNC:5992
KEGG ID	hsa:3553

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

IL1B can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP2*
Cell Line	ES-2 cell line	Homo sapiens
Treatment: siIGF2BP2 ES-2 cells Control: siControl ES-2 cells		GSE109604
Regulation		logFC: 6.90E-01 p-value: 1.24E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, Interleukin-1 beta (IL1B) and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	YTHDF1 promotes pro-inflammatory Interleukin-1 beta (IL1B) production in macrophages during bacterial infections. YTHDF1 overexpression promotes NLRP3 translation. YTHDF1 participates in inflammatory responses and subsequent injuries, serving as a new potential therapeutic target in clinical treatment of inflammatory diseases.
Target Regulation	Up regulation
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
In-vivo Model	Female C57BL/6 mice (6-8 weeks) were intraperitoneally injected with 2 ml 3% sterile sodium thioglycolate solution. After 3 days, the cells in the abdominal cavity were collected, centrifugated and maintained in DMEM with 10% (vol/vol) FBS.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, Interleukin-1 beta (IL1B) and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

Gangrene or necrosis of lung [ICD-11: CA43]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, Interleukin-1 beta (IL1B) and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, Interleukin-1 beta (IL1B) and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05180		Crosstalk Info
Epigenetic Regulator	Long noncoding RNA HZ06 (Lnc-HZ06)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Abortion	Disease Info
Drug	Benzo[a]pyrene	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00294)

Interleukin-1 beta (IL1B)

N6-methyladenosine (m6A)

In total 8 m6A sequence/site(s) in this target gene
mod ID: M6ASITE047144		Click to Show/Hide the Full List
mod site	chr2:112830086-112830087:-		[4]
Sequence	TTAAAGCCCGCCTGACAGAAACCACGGCCACATTTGGTTCT
Motif Score	2.185083333
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263341.6
External Link	RMBase: m6A_site_489605
mod ID: M6ASITE047145		Click to Show/Hide the Full List
mod site	chr2:112830182-112830183:-		[4]
Sequence	TCTCCTGTCCATCAGCCAGGACAGTCAGCTCTCTCCTTTCA
Motif Score	3.643047619
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000263341.6
External Link	RMBase: m6A_site_489606
mod ID: M6ASITE047146		Click to Show/Hide the Full List
mod site	chr2:112830260-112830261:-		[5]
Sequence	TGAGTACGGCTATAGCCTGGACTTTCCTGTTGTCTACACCA
Motif Score	4.065041667
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000263341.6
External Link	RMBase: m6A_site_489607
mod ID: M6ASITE047147		Click to Show/Hide the Full List
mod site	chr2:112830322-112830323:-		[5]
Sequence	GAGTCCTGTGCTGAATGTGGACTCAATCCCTAGGGCTGGCA
Motif Score	4.065041667
Cell/Tissue List	CD8T; peripheral-blood
Seq Type List	m6A-CLIP/IP; m6A-seq
Transcript ID List	ENST00000263341.6
External Link	RMBase: m6A_site_489608
mod ID: M6ASITE047148		Click to Show/Hide the Full List
mod site	chr2:112832680-112832681:-		[6]
Sequence	AAAGCTCTCCACCTCCAGGGACAGGATATGGAGCAACAAGG
Motif Score	3.643047619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000487639.1; ENST00000263341.6; ENST00000491056.5
External Link	RMBase: m6A_site_489609
mod ID: M6ASITE047149		Click to Show/Hide the Full List
mod site	chr2:112832704-112832705:-		[6]
Sequence	GTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCA
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000418817.5; ENST00000263341.6; ENST00000491056.5; ENST00000487639.1
External Link	RMBase: m6A_site_489610
mod ID: M6ASITE047150		Click to Show/Hide the Full List
mod site	chr2:112835559-112835560:-		[7]
Sequence	CCTAAACAGATGAAGGTAAGACTATGGGTTTAACTCCCAAC
Motif Score	3.319380952
Cell/Tissue List	CD4T
Seq Type List	m6A-seq
Transcript ID List	ENST00000418817.5; ENST00000432018.5; ENST00000416750.1; ENST00000491056.5; ENST00000477398.1; ENST00000496280.5; ENST00000263341.6
External Link	RMBase: m6A_site_489611
mod ID: M6ASITE047151		Click to Show/Hide the Full List
mod site	chr2:112835574-112835575:-		[7]
Sequence	TTTGAAGCTGATGGCCCTAAACAGATGAAGGTAAGACTATG
Motif Score	2.20572619
Cell/Tissue List	CD4T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000496280.5; ENST00000418817.5; ENST00000263341.6; ENST00000477398.1; ENST00000491056.5; ENST00000416750.1; ENST00000432018.5
External Link	RMBase: m6A_site_489612

Ref 1	N6-methyladenosine reader YTH N6-methyladenosine RNA binding protein 3 or insulin like growth factor 2 mRNA binding protein 2 knockdown protects human bronchial epithelial cells from hypoxia/reoxygenation injury by inactivating p38 MAPK, AKT, ERK1/2, and NF-KappaB pathways. Bioengineered. 2022 May;13(5):11973-11986. doi: 10.1080/21655979.2021.1999550.
Ref 2	BMS-936564/MDX-1338: a fully human anti-CXCR4 antibody induces apoptosis in vitro and shows antitumor activity in vivo in hematologic malignancies. Clin Cancer Res. 2013 Jan 15;19(2):357-66. doi: 10.1158/1078-0432.CCR-12-2333. Epub 2012 Dec 4.
Ref 3	RNA m6A reader YTHDF1 facilitates inflammation via enhancing NLRP3 translation. Biochem Biophys Res Commun. 2022 Aug 6;616:76-81. doi: 10.1016/j.bbrc.2022.05.076. Epub 2022 May 24.
Ref 4	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 5	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 6	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 7	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map