General Information of the m6A Target Gene (ID: M6ATAR00244)
Target Name Ephrin type-B receptor 2 (ERK/EPHB2)
Synonyms
Developmentally-regulated Eph-related tyrosine kinase; ELK-related tyrosine kinase; EPH tyrosine kinase 3; EPH-like kinase 5; EK5; hEK5; Renal carcinoma antigen NY-REN-47; Tyrosine-protein kinase TYRO5; Tyrosine-protein kinase receptor EPH-3; DRT; EPHT3; EPTH3; ERK; HEK5; TYRO5
    Click to Show/Hide
Gene Name EPHB2
Chromosomal Location 1p36.12
Family protein kinase superfamily; Tyr protein kinase family; Ephrin receptor subfamily
Function
Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Functions in axon guidance during development. Involved in the guidance of commissural axons, that form a major interhemispheric connection between the 2 temporal lobes of the cerebral cortex. Also involved in guidance of contralateral inner ear efferent growth cones at the midline and of retinal ganglion cell axons to the optic disk. In addition to axon guidance, also regulates dendritic spines development and maturation and stimulates the formation of excitatory synapses. Upon activation by EFNB1, abolishes the ARHGEF15-mediated negative regulation on excitatory synapse formation. Controls other aspects of development including angiogenesis, palate development and in inner ear development through regulation of endolymph production. Forward and reverse signaling through the EFNB2/EPHB2 complex regulate movement and adhesion of cells that tubularize the urethra and septate the cloaca. May function as a tumor suppressor. May be involved in the regulation of platelet activation and blood coagulation.
    Click to Show/Hide
Gene ID 2048
Uniprot ID
EPHB2_HUMAN
HGNC ID
HGNC:3393
KEGG ID
hsa:2048
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
EPHB2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 1 (YTHDF1) [READER]
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line AGS cell line Homo sapiens
Treatment: shYTHDF1 AGS
Control: shControl AGS
GSE159425
Regulation
logFC: -7.59E-01
p-value: 2.20E-04
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between EPHB2 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.91E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contribute to regeneration.
Target Regulation Up regulation
Responsed Disease Muscular dystrophies ICD-11: 8C70
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Fat mass and obesity-associated protein (FTO) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line NB4 cell line Homo sapiens
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
GSE103494
Regulation
logFC: 1.37E+00
p-value: 3.20E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary FTO depended on its m6A RNA demethylase activity to activate PDGFRB/Ephrin type-B receptor 2 (ERK/EPHB2) signaling axis. FTO-mediated m6A demethylation plays an oncogenic role in NPM1-mutated Acute myeloid leukemia(AML).
Target Regulation Up regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model OCI-AML-3 Adult acute myeloid leukemia Homo sapiens CVCL_1844
OCI-AML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1619
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1
Cell Line MDA-MB-231 Homo sapiens
Treatment: HNRNPA2B1 knockdown MDA-MB-231 cells
Control: MDA-MB-231 cells
GSE70061
Regulation
logFC: 6.38E-01
p-value: 4.72E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary hnRNPA2B1 promotes colon cancer progression via the MAPK pathway. hnRNPA2B1 is an upstream regulator of the Ephrin type-B receptor 2 (ERK/EPHB2)/MAPK pathway and inhibition of MAPK signaling blocked the effects of hnRNPA2B1.
Target Regulation Up regulation
Responsed Disease Colon cancer ICD-11: 2B90
Pathway Response MAPK signaling hsa04010
Apoptosis hsa04210
Cell Process Arrest cell cycle at G0/G1 phase
Cell apoptosis
In-vitro Model HCT 116 Colon carcinoma Homo sapiens CVCL_0291
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
In-vivo Model Four-week-old male BALB/c nude mice (purchased from Lingchang company) were randomly divided into three groups, each group has five mice. Each of the mice was injected subcutaneously on the right lateral back with 1 × 106 of each lentivirus infected SW480 cells in which hnRNPA2B1 was knocked out or negative control cells. Mice were killed at day 29, and tumors were then isolated, photographed.
Methyltransferase-like 14 (METTL14) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line MDA-MB-231 Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells
Control: MDA-MB-231 cells
GSE81164
Regulation
logFC: -7.89E-01
p-value: 4.97E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration.
Target Regulation Up regulation
Responsed Disease Muscular dystrophies ICD-11: 8C70
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
GSE167075
Regulation
logFC: -6.74E-01
p-value: 5.11E-30
More Results Click to View More RNA-seq Results
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [4]
Response Summary METTL3 played a tumor-suppressive role in Colorectal cancer cell proliferation, migration and invasion through p38/Ephrin type-B receptor 2 (ERK/EPHB2) pathways, which indicated that METTL3 was a novel marker for CRC carcinogenesis, progression and survival.
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response MAPK signaling pathway hsa04010
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
KM12 Colon carcinoma Homo sapiens CVCL_1331
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration.
Target Regulation Up regulation
Responsed Disease Muscular dystrophies ICD-11: 8C70
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Acute myeloid leukaemia [ICD-11: 2A60]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary FTO depended on its m6A RNA demethylase activity to activate PDGFRB/Ephrin type-B receptor 2 (ERK/EPHB2) signaling axis. FTO-mediated m6A demethylation plays an oncogenic role in NPM1-mutated Acute myeloid leukemia(AML).
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell apoptosis
In-vitro Model OCI-AML-3 Adult acute myeloid leukemia Homo sapiens CVCL_1844
OCI-AML-2 Adult acute myeloid leukemia Homo sapiens CVCL_1619
Colon cancer [ICD-11: 2B90]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary hnRNPA2B1 promotes colon cancer progression via the MAPK pathway. hnRNPA2B1 is an upstream regulator of the Ephrin type-B receptor 2 (ERK/EPHB2)/MAPK pathway and inhibition of MAPK signaling blocked the effects of hnRNPA2B1.
Responsed Disease Colon cancer [ICD-11: 2B90]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Up regulation
Pathway Response MAPK signaling hsa04010
Apoptosis hsa04210
Cell Process Arrest cell cycle at G0/G1 phase
Cell apoptosis
In-vitro Model HCT 116 Colon carcinoma Homo sapiens CVCL_0291
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
In-vivo Model Four-week-old male BALB/c nude mice (purchased from Lingchang company) were randomly divided into three groups, each group has five mice. Each of the mice was injected subcutaneously on the right lateral back with 1 × 106 of each lentivirus infected SW480 cells in which hnRNPA2B1 was knocked out or negative control cells. Mice were killed at day 29, and tumors were then isolated, photographed.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [4]
Response Summary METTL3 played a tumor-suppressive role in Colorectal cancer cell proliferation, migration and invasion through p38/Ephrin type-B receptor 2 (ERK/EPHB2) pathways, which indicated that METTL3 was a novel marker for CRC carcinogenesis, progression and survival.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response MAPK signaling pathway hsa04010
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
KM12 Colon carcinoma Homo sapiens CVCL_1331
Muscular dystrophies [ICD-11: 8C70]
In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration.
Responsed Disease Muscular dystrophies [ICD-11: 8C70]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
Target Regulation Up regulation
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration.
Responsed Disease Muscular dystrophies [ICD-11: 8C70]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Experiment 3 Reporting the m6A-centered Disease Response [1]
Response Summary m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MNK2 expression posttranscriptionally and thus control Ephrin type-B receptor 2 (ERK/EPHB2) signaling, which is required for the maintenance of muscle myogenesis and contribute to regeneration.
Responsed Disease Muscular dystrophies [ICD-11: 8C70]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
Target Regulation Up regulation
Pathway Response MAPK signaling pathway hsa04010
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
C2C12 Normal Mus musculus CVCL_0188
In-vivo Model For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03544
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
Crosstalk ID: M6ACROT03589
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00244)
Ephrin type-B receptor 2 (ERK/EPHB2)
Adenosine-to-Inosine editing (A-to-I)
In total 6 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005256 Click to Show/Hide the Full List
mod site chr1:22717638-22717639:+ [5]
Sequence GATTCAGTGAGATGCTGTGTACCATGACTGGCAGAACTGCC
Transcript ID List ENST00000374632.7; rmsk_48767; ENST00000374630.7; ENST00000544305.5; ENST00000400191.7
External Link RMBase: RNA-editing_site_2522
mod ID: A2ISITE005257 Click to Show/Hide the Full List
mod site chr1:22782186-22782187:+ [5]
Sequence GCACTTCCTTAATCTCTCTGAGCTTCAGTTTCTTCATCTAT
Transcript ID List ENST00000374632.7; ENST00000374630.7; ENST00000544305.5; rmsk_48944; ENST00000374627.1; ENST00000400191.7
External Link RMBase: RNA-editing_site_2523
mod ID: A2ISITE005258 Click to Show/Hide the Full List
mod site chr1:22782205-22782206:+ [5]
Sequence GAGCTTCAGTTTCTTCATCTATAAAATGGTGATGATGTTTT
Transcript ID List ENST00000374630.7; ENST00000374632.7; ENST00000400191.7; ENST00000544305.5; rmsk_48944; ENST00000374627.1
External Link RMBase: RNA-editing_site_2524
mod ID: A2ISITE005259 Click to Show/Hide the Full List
mod site chr1:22807957-22807958:+ [5]
Sequence AGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATG
Transcript ID List ENST00000544305.5; ENST00000374632.7; rmsk_49007; ENST00000465676.1; ENST00000374630.7; ENST00000374627.1; ENST00000400191.7
External Link RMBase: RNA-editing_site_2525
mod ID: A2ISITE005260 Click to Show/Hide the Full List
mod site chr1:22889855-22889856:+ [5]
Sequence TTTTTAAAAATAAATGTTTTAGTACAAATATGTCCCAAATA
Transcript ID List ENST00000374627.1; ENST00000465676.1; ENST00000400191.7; ENST00000374630.7; ENST00000544305.5; ENST00000374632.7
External Link RMBase: RNA-editing_site_2526
mod ID: A2ISITE005261 Click to Show/Hide the Full List
mod site chr1:22901727-22901728:+ [5]
Sequence TTGGCAGCCTGAGGGTTACAAGTGGAGACTCTGTAGCCGGC
Transcript ID List ENST00000400191.7; ENST00000374627.1; ENST00000374632.7; rmsk_49246; ENST00000374630.7
External Link RMBase: RNA-editing_site_2527
N6-methyladenosine (m6A)
In total 71 m6A sequence/site(s) in this target gene
mod ID: M6ASITE004381 Click to Show/Hide the Full List
mod site chr1:22781432-22781433:+ [6]
Sequence CCCCACAGAAACGCTAATGGACTCCACTACAGCGACTGCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000374627.1; ENST00000400191.7; ENST00000544305.5; ENST00000374630.7
External Link RMBase: m6A_site_13451
mod ID: M6ASITE004382 Click to Show/Hide the Full List
mod site chr1:22784419-22784420:+ [6]
Sequence GGTGAGTGGCTACGATGAGAACATGAACACGATCCGCACGT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1B; H1A; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374627.1; ENST00000374632.7; ENST00000544305.5; ENST00000374630.7
External Link RMBase: m6A_site_13452
mod ID: M6ASITE004383 Click to Show/Hide the Full List
mod site chr1:22784425-22784426:+ [6]
Sequence TGGCTACGATGAGAACATGAACACGATCCGCACGTACCAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1B; H1A; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000374627.1; ENST00000374630.7; ENST00000544305.5; ENST00000400191.7
External Link RMBase: m6A_site_13453
mod ID: M6ASITE004384 Click to Show/Hide the Full List
mod site chr1:22784473-22784474:+ [6]
Sequence CGTGTTTGAGTCAAGCCAGAACAACTGGCTACGGACCAAGT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000544305.5; ENST00000374632.7; ENST00000374627.1; ENST00000374630.7; ENST00000400191.7
External Link RMBase: m6A_site_13454
mod ID: M6ASITE004385 Click to Show/Hide the Full List
mod site chr1:22784487-22784488:+ [6]
Sequence GCCAGAACAACTGGCTACGGACCAAGTTTATCCGGCGCCGT
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374630.7; ENST00000374632.7; ENST00000544305.5; ENST00000374627.1
External Link RMBase: m6A_site_13455
mod ID: M6ASITE004386 Click to Show/Hide the Full List
mod site chr1:22784551-22784552:+ [7]
Sequence GATGAAGTTTTCGGTGCGTGACTGCAGCAGCATCCCCAGCG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374627.1; ENST00000544305.5; ENST00000374632.7; ENST00000400191.7; ENST00000374630.7
External Link RMBase: m6A_site_13456
mod ID: M6ASITE004387 Click to Show/Hide the Full List
mod site chr1:22784592-22784593:+ [6]
Sequence TGCCTGGCTCCTGCAAGGAGACCTTCAACCTCTATTACTAT
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000544305.5; ENST00000374632.7; ENST00000374630.7; ENST00000374627.1
External Link RMBase: m6A_site_13457
mod ID: M6ASITE004388 Click to Show/Hide the Full List
mod site chr1:22784626-22784627:+ [8]
Sequence TTACTATGAGGCTGACTTTGACTCGGCCACCAAGACCTTCC
Motif Score 3.28175
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000374627.1; ENST00000374632.7; ENST00000400191.7; ENST00000374630.7; ENST00000544305.5
External Link RMBase: m6A_site_13458
mod ID: M6ASITE004389 Click to Show/Hide the Full List
mod site chr1:22784640-22784641:+ [6]
Sequence ACTTTGACTCGGCCACCAAGACCTTCCCCAACTGGATGGAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374630.7; ENST00000374627.1; ENST00000374632.7; ENST00000544305.5
External Link RMBase: m6A_site_13459
mod ID: M6ASITE004390 Click to Show/Hide the Full List
mod site chr1:22784716-22784717:+ [6]
Sequence CGAGAGCTTCTCCCAGGTGGACCTGGGTGGCCGCGTCATGA
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374630.7; ENST00000400191.7; ENST00000544305.5; ENST00000374627.1; ENST00000374632.7
External Link RMBase: m6A_site_13460
mod ID: M6ASITE004391 Click to Show/Hide the Full List
mod site chr1:22784743-22784744:+ [9]
Sequence TGGCCGCGTCATGAAAATCAACACCGAGGTGCGGAGCTTCG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374627.1; ENST00000400191.7; ENST00000374632.7; ENST00000374630.7; ENST00000544305.5
External Link RMBase: m6A_site_13461
mod ID: M6ASITE004392 Click to Show/Hide the Full List
mod site chr1:22784765-22784766:+ [6]
Sequence ACCGAGGTGCGGAGCTTCGGACCTGTGTCCCGCAGCGGCTT
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374630.7; ENST00000374627.1; ENST00000400191.7; ENST00000374632.7; ENST00000544305.5
External Link RMBase: m6A_site_13462
mod ID: M6ASITE004393 Click to Show/Hide the Full List
mod site chr1:22784803-22784804:+ [6]
Sequence CTTCTACCTGGCCTTCCAGGACTATGGCGGCTGCATGTCCC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374630.7; ENST00000374632.7; ENST00000374627.1; ENST00000400191.7; ENST00000544305.5
External Link RMBase: m6A_site_13463
mod ID: M6ASITE004394 Click to Show/Hide the Full List
mod site chr1:22784892-22784893:+ [6]
Sequence ATGGCGCCATCTTCCAGGAAACCCTGTCGGGGGCTGAGAGC
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; U2OS; GSC-11; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374627.1; ENST00000374630.7; ENST00000374632.7; ENST00000544305.5
External Link RMBase: m6A_site_13464
mod ID: M6ASITE004395 Click to Show/Hide the Full List
mod site chr1:22863050-22863051:+ [6]
Sequence TCTCAGGTTGTCCATCTGGGACTTTCAAGGCCAACCAAGGG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000400191.7; ENST00000465676.1; ENST00000544305.5; ENST00000374632.7; ENST00000374630.7; ENST00000374627.1
External Link RMBase: m6A_site_13465
mod ID: M6ASITE004396 Click to Show/Hide the Full List
mod site chr1:22863107-22863108:+ [6]
Sequence ACTGTCCCATCAACAGCCGGACCACTTCTGAAGGGGCCACC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544305.5; ENST00000374630.7; ENST00000374632.7; ENST00000400191.7; ENST00000374627.1; ENST00000465676.1
External Link RMBase: m6A_site_13466
mod ID: M6ASITE004397 Click to Show/Hide the Full List
mod site chr1:22863162-22863163:+ [6]
Sequence CAATGGCTACTACAGAGCAGACCTGGACCCCCTGGACATGC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374632.7; ENST00000374630.7; ENST00000465676.1; ENST00000544305.5; ENST00000374627.1; ENST00000400191.7
External Link RMBase: m6A_site_13467
mod ID: M6ASITE004398 Click to Show/Hide the Full List
mod site chr1:22863168-22863169:+ [6]
Sequence CTACTACAGAGCAGACCTGGACCCCCTGGACATGCCCTGCA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374630.7; ENST00000400191.7; ENST00000544305.5; ENST00000374632.7; ENST00000465676.1; ENST00000374627.1
External Link RMBase: m6A_site_13468
mod ID: M6ASITE004399 Click to Show/Hide the Full List
mod site chr1:22863177-22863178:+ [6]
Sequence AGCAGACCTGGACCCCCTGGACATGCCCTGCACAAGTAAGT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000465676.1; ENST00000544305.5; ENST00000374632.7; ENST00000400191.7; ENST00000374630.7; ENST00000374627.1
External Link RMBase: m6A_site_13469
mod ID: M6ASITE004400 Click to Show/Hide the Full List
mod site chr1:22863188-22863189:+ [9]
Sequence ACCCCCTGGACATGCCCTGCACAAGTAAGTCCTAGGGCCCC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000400191.7; ENST00000544305.5; ENST00000374630.7; ENST00000465676.1; ENST00000374627.1; ENST00000374632.7
External Link RMBase: m6A_site_13470
mod ID: M6ASITE004401 Click to Show/Hide the Full List
mod site chr1:22864920-22864921:+ [6]
Sequence TGATTTCCAGTGTCAATGAGACCTCCCTCATGCTGGAGTGG
Motif Score 2.876744048
Cell/Tissue List HeLa; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374630.7; ENST00000400191.7; ENST00000374627.1; ENST00000374632.7; ENST00000544305.5; ENST00000465676.1
External Link RMBase: m6A_site_13471
mod ID: M6ASITE004402 Click to Show/Hide the Full List
mod site chr1:22864941-22864942:+ [6]
Sequence CCTCCCTCATGCTGGAGTGGACCCCTCCCCGCGACTCCGGA
Motif Score 3.622404762
Cell/Tissue List HeLa; A549; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000465676.1; ENST00000374632.7; ENST00000544305.5; ENST00000374627.1; ENST00000374630.7; ENST00000400191.7
External Link RMBase: m6A_site_13472
mod ID: M6ASITE004403 Click to Show/Hide the Full List
mod site chr1:22864972-22864973:+ [6]
Sequence CGACTCCGGAGGCCGAGAGGACCTCGTCTACAACATCATCT
Motif Score 3.622404762
Cell/Tissue List HeLa; A549; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374630.7; ENST00000374627.1; ENST00000374632.7; ENST00000400191.7; ENST00000465676.1; ENST00000544305.5
External Link RMBase: m6A_site_13473
mod ID: M6ASITE004404 Click to Show/Hide the Full List
mod site chr1:22864981-22864982:+ [9]
Sequence AGGCCGAGAGGACCTCGTCTACAACATCATCTGCAAGAGCT
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374630.7; ENST00000544305.5; ENST00000465676.1; ENST00000374627.1; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13474
mod ID: M6ASITE004405 Click to Show/Hide the Full List
mod site chr1:22864984-22864985:+ [9]
Sequence CCGAGAGGACCTCGTCTACAACATCATCTGCAAGAGCTGTG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000544305.5; ENST00000400191.7; ENST00000465676.1; ENST00000374630.7; ENST00000374627.1; ENST00000374632.7
External Link RMBase: m6A_site_13475
mod ID: M6ASITE004406 Click to Show/Hide the Full List
mod site chr1:22865038-22865039:+ [6]
Sequence TGCCTGCACCCGCTGCGGGGACAATGTACAGTACGCACCAC
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T; A549; iSLK; TIME
Seq Type List m6A-seq; MAZTER-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7; ENST00000544305.5; ENST00000465676.1; ENST00000374627.1; ENST00000374630.7
External Link RMBase: m6A_site_13476
mod ID: M6ASITE004407 Click to Show/Hide the Full List
mod site chr1:22865089-22865090:+ [9]
Sequence CCTGACCGAGCCACGCATTTACATCAGTGACCTGCTGGCCC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374627.1; ENST00000374630.7; ENST00000544305.5; ENST00000465676.1; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13477
mod ID: M6ASITE004408 Click to Show/Hide the Full List
mod site chr1:22865119-22865120:+ [9]
Sequence CCTGCTGGCCCACACCCAGTACACCTTCGAGATCCAGGCTG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374630.7; ENST00000400191.7; ENST00000465676.1; ENST00000374627.1; ENST00000544305.5; ENST00000374632.7
External Link RMBase: m6A_site_13478
mod ID: M6ASITE004409 Click to Show/Hide the Full List
mod site chr1:22865191-22865192:+ [6]
Sequence GCCTCAGTTCGCCTCTGTGAACATCACCACCAACCAGGCAG
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T; iSLK; TIME
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000374627.1; ENST00000465676.1; ENST00000490436.1; ENST00000374632.7; ENST00000400191.7; ENST00000544305.5; ENST00000374630.7
External Link RMBase: m6A_site_13479
mod ID: M6ASITE004410 Click to Show/Hide the Full List
mod site chr1:22882403-22882404:+ [10]
Sequence TCAGGTGAGCCGCACCGTGGACAGCATTACCCTGTCGTGGT
Motif Score 3.643047619
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000465676.1; ENST00000544305.5; ENST00000374627.1; ENST00000490436.1; ENST00000400191.7; ENST00000374632.7; ENST00000374630.7
External Link RMBase: m6A_site_13480
mod ID: M6ASITE004411 Click to Show/Hide the Full List
mod site chr1:22895482-22895483:+ [9]
Sequence TCTCCCCAGCCGAGTACCAGACAAGCATCCAGGAGAAGTTG
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374627.1; ENST00000465676.1; ENST00000374630.7; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13481
mod ID: M6ASITE004412 Click to Show/Hide the Full List
mod site chr1:22906796-22906797:+ [9]
Sequence CAAGACGCTCAAGTCGGGCTACACGGAGAAGCAGCGCCGGG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374627.1; ENST00000374630.7; ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13482
mod ID: M6ASITE004413 Click to Show/Hide the Full List
mod site chr1:22906897-22906898:+ [9]
Sequence AGGGTGTCGTGACCAAGAGCACACCTGTGATGATCATCACC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000400191.7; ENST00000374630.7; ENST00000374627.1; ENST00000374632.7
External Link RMBase: m6A_site_13483
mod ID: M6ASITE004414 Click to Show/Hide the Full List
mod site chr1:22906943-22906944:+ [6]
Sequence CATGGAGAATGGCTCCCTGGACTCCTTTCTCCGGGTAGGGG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374627.1; ENST00000374630.7; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13484
mod ID: M6ASITE004415 Click to Show/Hide the Full List
mod site chr1:22908031-22908032:+ [6]
Sequence TGGCATGAAGTACCTGGCAGACATGAACTATGTTCACCGTG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7; ENST00000374627.1; ENST00000374630.7
External Link RMBase: m6A_site_13485
mod ID: M6ASITE004416 Click to Show/Hide the Full List
mod site chr1:22908037-22908038:+ [6]
Sequence GAAGTACCTGGCAGACATGAACTATGTTCACCGTGACCTGG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374632.7; ENST00000374627.1; ENST00000400191.7; ENST00000374630.7
External Link RMBase: m6A_site_13486
mod ID: M6ASITE004417 Click to Show/Hide the Full List
mod site chr1:22908106-22908107:+ [6]
Sequence CCTGGTCTGCAAGGTGTCGGACTTTGGGCTCTCACGCTTTC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374632.7; ENST00000374630.7; ENST00000400191.7; ENST00000374627.1
External Link RMBase: m6A_site_13487
mod ID: M6ASITE004418 Click to Show/Hide the Full List
mod site chr1:22910427-22910428:+ [6]
Sequence TCGGCTGCCACCGCCCATGGACTGCCCGAGCGCCCTGCACC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374627.1; ENST00000374630.7; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13488
mod ID: M6ASITE004419 Click to Show/Hide the Full List
mod site chr1:22910460-22910461:+ [6]
Sequence CCTGCACCAACTCATGCTGGACTGTTGGCAGAAGGACCGCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000400191.7; ENST00000374630.7; ENST00000374627.1; ENST00000374632.7
External Link RMBase: m6A_site_13489
mod ID: M6ASITE004420 Click to Show/Hide the Full List
mod site chr1:22910475-22910476:+ [6]
Sequence GCTGGACTGTTGGCAGAAGGACCGCAACCACCGGCCCAAGT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374627.1; ENST00000400191.7; ENST00000374630.7; ENST00000374632.7
External Link RMBase: m6A_site_13490
mod ID: M6ASITE004421 Click to Show/Hide the Full List
mod site chr1:22910520-22910521:+ [6]
Sequence CCAAATTGTCAACACGCTAGACAAGATGATCCGCAATCCCA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374630.7; ENST00000374632.7; ENST00000374627.1; ENST00000400191.7
External Link RMBase: m6A_site_13491
mod ID: M6ASITE004422 Click to Show/Hide the Full List
mod site chr1:22912463-22912464:+ [6]
Sequence CATCAACCTGCCGCTGCTGGACCGCACGATCCCCGACTACA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374630.7; ENST00000374627.1; ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13492
mod ID: M6ASITE004423 Click to Show/Hide the Full List
mod site chr1:22913514-22913515:+ [6]
Sequence CCACCAGAAAAAAATCCTGAACAGTATCCAGGTGATGCGGG
Motif Score 2.951386905
Cell/Tissue List HeLa; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374627.1; ENST00000374630.7; ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13493
mod ID: M6ASITE004424 Click to Show/Hide the Full List
mod site chr1:22913544-22913545:+ [6]
Sequence GGTGATGCGGGCGCAGATGAACCAGATTCAGTCTGTGGAGG
Motif Score 2.930744048
Cell/Tissue List HeLa; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7; ENST00000374630.7; ENST00000374627.1
External Link RMBase: m6A_site_13494
mod ID: M6ASITE004425 Click to Show/Hide the Full List
mod site chr1:22913696-22913697:+ [6]
Sequence GGCCACGGGCCACGGGAAGAACCAAGCGGTGCCAGCCACGA
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; TIME; MSC; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7; ENST00000374627.1; ENST00000374630.7
External Link RMBase: m6A_site_13495
mod ID: M6ASITE004426 Click to Show/Hide the Full List
mod site chr1:22913732-22913733:+ [6]
Sequence CACGAGACGTCACCAAGAAAACATGCAACTCAAACGACGGA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000374632.7; ENST00000374627.1; ENST00000374630.7; ENST00000400191.7
External Link RMBase: m6A_site_13496
mod ID: M6ASITE004427 Click to Show/Hide the Full List
mod site chr1:22913780-22913781:+ [6]
Sequence AGGGAATGGGAAAAAAGAAAACAGATCCTGGGAGGGGGCGG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13497
mod ID: M6ASITE004428 Click to Show/Hide the Full List
mod site chr1:22913850-22913851:+ [8]
Sequence TTCTCATAAGGAAAGCAATGACTGTTCTTGCGGGGGATAAA
Motif Score 3.28175
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13498
mod ID: M6ASITE004429 Click to Show/Hide the Full List
mod site chr1:22913910-22913911:+ [6]
Sequence TGCGATGTGTCCAATCGGAGACAAAAGCAGTTTCTCTCCAA
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13499
mod ID: M6ASITE004430 Click to Show/Hide the Full List
mod site chr1:22913967-22913968:+ [6]
Sequence GACCTGGCCAGAGCCAAGAAACACTTTCAGAAAAACAAATG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13500
mod ID: M6ASITE004431 Click to Show/Hide the Full List
mod site chr1:22913981-22913982:+ [6]
Sequence CAAGAAACACTTTCAGAAAAACAAATGTGAAGGGGAGAGAC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13501
mod ID: M6ASITE004432 Click to Show/Hide the Full List
mod site chr1:22914000-22914001:+ [6]
Sequence AACAAATGTGAAGGGGAGAGACAGGGGCCGCCCTTGGCTCC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13502
mod ID: M6ASITE004433 Click to Show/Hide the Full List
mod site chr1:22914051-22914052:+ [9]
Sequence GCTCCTCTAGGCCTCACTCAACAACCAAGCGCCTGGAGGAC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13503
mod ID: M6ASITE004434 Click to Show/Hide the Full List
mod site chr1:22914070-22914071:+ [8]
Sequence AACAACCAAGCGCCTGGAGGACGGGACAGATGGACAGACAG
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13504
mod ID: M6ASITE004435 Click to Show/Hide the Full List
mod site chr1:22914075-22914076:+ [6]
Sequence CCAAGCGCCTGGAGGACGGGACAGATGGACAGACAGCCACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13505
mod ID: M6ASITE004436 Click to Show/Hide the Full List
mod site chr1:22914083-22914084:+ [6]
Sequence CTGGAGGACGGGACAGATGGACAGACAGCCACCCTGAGAAC
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13506
mod ID: M6ASITE004437 Click to Show/Hide the Full List
mod site chr1:22914102-22914103:+ [6]
Sequence GACAGACAGCCACCCTGAGAACCCCTCTGGGAAAATCTATT
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13507
mod ID: M6ASITE004438 Click to Show/Hide the Full List
mod site chr1:22914132-22914133:+ [7]
Sequence GAAAATCTATTCCTGCCACCACTGGGCAAACAGAAGAATTT
Motif Score 2.475107143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13508
mod ID: M6ASITE004439 Click to Show/Hide the Full List
mod site chr1:22914141-22914142:+ [6]
Sequence TTCCTGCCACCACTGGGCAAACAGAAGAATTTTTCTGTCTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13509
mod ID: M6ASITE004440 Click to Show/Hide the Full List
mod site chr1:22914179-22914180:+ [6]
Sequence CTTTGGAGAGTATTTTAGAAACTCCAATGAAAGACACTGTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13510
mod ID: M6ASITE004441 Click to Show/Hide the Full List
mod site chr1:22914192-22914193:+ [6]
Sequence TTTAGAAACTCCAATGAAAGACACTGTTTCTCCTGTTGGCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7; ENST00000374632.7
External Link RMBase: m6A_site_13511
mod ID: M6ASITE004442 Click to Show/Hide the Full List
mod site chr1:22914263-22914264:+ [6]
Sequence GGGTCAGGGAGAACGCGGGGACCCCAGAAAGGTCAGCCTTC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hNPCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374632.7; ENST00000400191.7
External Link RMBase: m6A_site_13512
mod ID: M6ASITE004443 Click to Show/Hide the Full List
mod site chr1:22914390-22914391:+ [6]
Sequence CGCCAGCCCCTGCCTCGAGGACTGATACTGCAGTGACTGCC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13513
mod ID: M6ASITE004451 Click to Show/Hide the Full List
mod site chr1:22914396-22914397:+ [7]
Sequence CCCCTGCCTCGAGGACTGATACTGCAGTGACTGCCGTCAGC
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13514
mod ID: M6ASITE004462 Click to Show/Hide the Full List
mod site chr1:22914421-22914422:+ [7]
Sequence AGTGACTGCCGTCAGCTCCGACTGCCGCTGAGAAGGGTTGA
Motif Score 3.287565476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13515
mod ID: M6ASITE004473 Click to Show/Hide the Full List
mod site chr1:22914476-22914477:+ [6]
Sequence TTGTTTACAGCAATTCCTGGACTCGGGGGTATTTTGGTCAC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; U2OS; H1A; H1B; hESCs; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13516
mod ID: M6ASITE004484 Click to Show/Hide the Full List
mod site chr1:22914601-22914602:+ [6]
Sequence ACATTTCCTACCTTTTGAGGACTTGATCCTTCTCCAGGAAG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13517
mod ID: M6ASITE004495 Click to Show/Hide the Full List
mod site chr1:22914787-22914788:+ [6]
Sequence GCCATCTGGGCCATTCAGAGACTGGAGTGAGATTTGGGTGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; U2OS; H1B; H1A; hESCs; A549; GSC-11; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13518
mod ID: M6ASITE004504 Click to Show/Hide the Full List
mod site chr1:22914849-22914850:+ [6]
Sequence GAGGAGCTTCCCACTCCAGGACTGTTGATGAAAGGGACAGA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; H1B; H1A; hESCs; GSC-11; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13519
mod ID: M6ASITE004510 Click to Show/Hide the Full List
mod site chr1:22914865-22914866:+ [6]
Sequence CAGGACTGTTGATGAAAGGGACAGATTGAGGAGGAAGTGGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; H1B; H1A; hESCs; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13520
mod ID: M6ASITE004512 Click to Show/Hide the Full List
mod site chr1:22915005-22915006:+ [11]
Sequence AGTGCCCTCAGATGGTCAAAACCCAGTTTTCCCTCTGGGAG
Motif Score 2.185083333
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000400191.7
External Link RMBase: m6A_site_13521